data_6U7Z # _entry.id 6U7Z # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.395 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 6U7Z pdb_00006u7z 10.2210/pdb6u7z/pdb WWPDB D_1000244122 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2020-12-09 2 'Structure model' 1 1 2021-01-06 3 'Structure model' 1 2 2021-02-03 4 'Structure model' 1 3 2023-10-11 5 'Structure model' 2 0 2024-07-03 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' 5 4 'Structure model' 'Refinement description' 6 5 'Structure model' Advisory 7 5 'Structure model' 'Atomic model' 8 5 'Structure model' 'Data collection' 9 5 'Structure model' 'Derived calculations' 10 5 'Structure model' 'Non-polymer description' 11 5 'Structure model' 'Polymer sequence' 12 5 'Structure model' 'Structure summary' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 3 'Structure model' citation 3 4 'Structure model' chem_comp_atom 4 4 'Structure model' chem_comp_bond 5 4 'Structure model' database_2 6 4 'Structure model' pdbx_initial_refinement_model 7 5 'Structure model' atom_site 8 5 'Structure model' chem_comp 9 5 'Structure model' chem_comp_atom 10 5 'Structure model' chem_comp_bond 11 5 'Structure model' entity_poly 12 5 'Structure model' entity_poly_seq 13 5 'Structure model' ndb_struct_na_base_pair 14 5 'Structure model' ndb_struct_na_base_pair_step 15 5 'Structure model' pdbx_entity_nonpoly 16 5 'Structure model' pdbx_nonpoly_scheme 17 5 'Structure model' pdbx_poly_seq_scheme 18 5 'Structure model' pdbx_unobs_or_zero_occ_atoms 19 5 'Structure model' struct_conn 20 5 'Structure model' struct_site # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.pdbx_database_id_DOI' 2 2 'Structure model' '_citation.pdbx_database_id_PubMed' 3 2 'Structure model' '_citation.title' 4 3 'Structure model' '_citation.journal_volume' 5 3 'Structure model' '_citation.page_first' 6 3 'Structure model' '_citation.page_last' 7 3 'Structure model' '_citation.year' 8 4 'Structure model' '_database_2.pdbx_DOI' 9 4 'Structure model' '_database_2.pdbx_database_accession' 10 5 'Structure model' '_atom_site.B_iso_or_equiv' 11 5 'Structure model' '_atom_site.Cartn_x' 12 5 'Structure model' '_atom_site.Cartn_y' 13 5 'Structure model' '_atom_site.Cartn_z' 14 5 'Structure model' '_atom_site.auth_atom_id' 15 5 'Structure model' '_atom_site.auth_comp_id' 16 5 'Structure model' '_atom_site.group_PDB' 17 5 'Structure model' '_atom_site.label_atom_id' 18 5 'Structure model' '_atom_site.label_comp_id' 19 5 'Structure model' '_atom_site.type_symbol' 20 5 'Structure model' '_chem_comp.formula' 21 5 'Structure model' '_chem_comp.formula_weight' 22 5 'Structure model' '_chem_comp.id' 23 5 'Structure model' '_chem_comp.mon_nstd_flag' 24 5 'Structure model' '_chem_comp.name' 25 5 'Structure model' '_chem_comp.type' 26 5 'Structure model' '_entity_poly.pdbx_seq_one_letter_code' 27 5 'Structure model' '_entity_poly.pdbx_seq_one_letter_code_can' 28 5 'Structure model' '_entity_poly_seq.mon_id' 29 5 'Structure model' '_pdbx_entity_nonpoly.comp_id' 30 5 'Structure model' '_pdbx_nonpoly_scheme.mon_id' 31 5 'Structure model' '_pdbx_nonpoly_scheme.pdb_mon_id' 32 5 'Structure model' '_pdbx_poly_seq_scheme.mon_id' 33 5 'Structure model' '_pdbx_poly_seq_scheme.pdb_mon_id' 34 5 'Structure model' '_struct_site.details' 35 5 'Structure model' '_struct_site.pdbx_auth_comp_id' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 6U7Z _pdbx_database_status.recvd_initial_deposition_date 2019-09-03 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Szostak, J.W.' 1 ? 'Zhang, W.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 49 _citation.language ? _citation.page_first 646 _citation.page_last 656 _citation.title 'Structural interpretation of the effects of threo-nucleotides on nonenzymatic template-directed polymerization.' _citation.year 2021 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkaa1215 _citation.pdbx_database_id_PubMed 33347562 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Zhang, W.' 1 ? primary 'Kim, S.C.' 2 ? primary 'Tam, C.P.' 3 ? primary 'Lelyveld, V.S.' 4 ? primary 'Bala, S.' 5 ? primary 'Chaput, J.C.' 6 ? primary 'Szostak, J.W.' 7 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;RNA (5'-R(*CP*UP*GP*CP*UP*GP*GP*CP*UP*AP*AP*GP*GP*GP*CP*CP*GP*AP*AP*AP*GP*(TG))-3') ; 7121.296 1 ? ? ? ? 2 polymer syn ;RNA (5'-R(*CP*UP*AP*UP*GP*CP*CP*UP*GP*CP*UP*G)-3') ; 3765.256 1 ? ? ? ? 3 non-polymer syn "CYTIDINE-5'-MONOPHOSPHATE" 323.197 1 ? ? ? ? 4 water nat water 18.015 1 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polyribonucleotide no yes '(C5P)UGCUGGCUAAGGGCCGAAAG(TG)' XUGCUGGCUAAGGGCCGAAAGX A ? 2 polyribonucleotide no no CUAUGCCUGCUG CUAUGCCUGCUG B ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 3 "CYTIDINE-5'-MONOPHOSPHATE" C5P 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 C5P n 1 2 U n 1 3 G n 1 4 C n 1 5 U n 1 6 G n 1 7 G n 1 8 C n 1 9 U n 1 10 A n 1 11 A n 1 12 G n 1 13 G n 1 14 G n 1 15 C n 1 16 C n 1 17 G n 1 18 A n 1 19 A n 1 20 A n 1 21 G n 1 22 TG n 2 1 C n 2 2 U n 2 3 A n 2 4 U n 2 5 G n 2 6 C n 2 7 C n 2 8 U n 2 9 G n 2 10 C n 2 11 U n 2 12 G n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 22 'synthetic construct' ? 32630 ? 2 1 sample 1 12 'synthetic construct' ? 32630 ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 C5P non-polymer . "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 TG 'RNA linking' n '2-azanyl-9-[(2~{R},3~{R},4~{S})-3-oxidanyl-4-[oxidanyl-bis(oxidanylidene)-$l^{6}-phosphanyl]oxy-oxolan-2-yl]-1~{H}-purin-6-one' ? 'C9 H11 N5 O7 P' 332.187 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 C5P 1 1 1 C5P C A . n A 1 2 U 2 2 2 U U A . n A 1 3 G 3 3 3 G G A . n A 1 4 C 4 4 4 C C A . n A 1 5 U 5 5 5 U U A . n A 1 6 G 6 6 6 G G A . n A 1 7 G 7 7 7 G G A . n A 1 8 C 8 8 8 C C A . n A 1 9 U 9 9 9 U U A . n A 1 10 A 10 10 10 A A A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 G 13 13 13 G G A . n A 1 14 G 14 14 14 G G A . n A 1 15 C 15 15 15 C C A . n A 1 16 C 16 16 16 C C A . n A 1 17 G 17 17 17 G G A . n A 1 18 A 18 18 18 A A A . n A 1 19 A 19 19 19 A A A . n A 1 20 A 20 20 20 A A A . n A 1 21 G 21 21 21 G G A . n A 1 22 TG 22 22 22 TG TFG A . n B 2 1 C 1 1 1 C C B . n B 2 2 U 2 2 2 U U B . n B 2 3 A 3 3 3 A A B . n B 2 4 U 4 4 4 U U B . n B 2 5 G 5 5 5 G G B . n B 2 6 C 6 6 6 C C B . n B 2 7 C 7 7 7 C C B . n B 2 8 U 8 8 8 U U B . n B 2 9 G 9 9 9 G G B . n B 2 10 C 10 10 10 C C B . n B 2 11 U 11 11 11 U U B . n B 2 12 G 12 12 12 G G B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 3 C5P 1 101 1 C5P C A . D 4 HOH 1 201 1 HOH HOH A . # _pdbx_unobs_or_zero_occ_atoms.id 1 _pdbx_unobs_or_zero_occ_atoms.PDB_model_num 1 _pdbx_unobs_or_zero_occ_atoms.polymer_flag Y _pdbx_unobs_or_zero_occ_atoms.occupancy_flag 1 _pdbx_unobs_or_zero_occ_atoms.auth_asym_id A _pdbx_unobs_or_zero_occ_atoms.auth_comp_id C5P _pdbx_unobs_or_zero_occ_atoms.auth_seq_id 1 _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code ? _pdbx_unobs_or_zero_occ_atoms.auth_atom_id O3P _pdbx_unobs_or_zero_occ_atoms.label_alt_id ? _pdbx_unobs_or_zero_occ_atoms.label_asym_id A _pdbx_unobs_or_zero_occ_atoms.label_comp_id C5P _pdbx_unobs_or_zero_occ_atoms.label_seq_id 1 _pdbx_unobs_or_zero_occ_atoms.label_atom_id O3P # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? REFMAC ? ? ? 5.8.0189 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 6U7Z _cell.details ? _cell.formula_units_Z ? _cell.length_a 71.319 _cell.length_a_esd ? _cell.length_b 71.319 _cell.length_b_esd ? _cell.length_c 67.566 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 9 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 6U7Z _symmetry.cell_setting ? _symmetry.Int_Tables_number 146 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'H 3' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 6U7Z _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 3.01 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 59.17 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 7.0 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 291 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '3.5 M Sodium formate pH 7.0' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 99 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector CCD _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'MAR CCD 130 mm' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2019-05-28 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'ALS BEAMLINE 8.2.2' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 8.2.2 _diffrn_source.pdbx_synchrotron_site ALS # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 6U7Z _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.7 _reflns.d_resolution_low 50 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 3369 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 97.5 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 3.5 _reflns.pdbx_Rmerge_I_obs 0.117 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 9.48 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 1.18 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.137 _reflns.pdbx_Rpim_I_all 0.071 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.986 _reflns.pdbx_R_split ? # _reflns_shell.d_res_high 2.7 _reflns_shell.d_res_low 2.8 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 2.3 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 305 _reflns_shell.percent_possible_all 89.4 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 0.415 _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 2.8 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared 0.857 _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all 0.5 _reflns_shell.pdbx_Rpim_I_all 0.274 _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.974 _reflns_shell.pdbx_R_split ? # _refine.aniso_B[1][1] 0.1 _refine.aniso_B[1][2] 0.05 _refine.aniso_B[1][3] 0 _refine.aniso_B[2][2] 0.1 _refine.aniso_B[2][3] 0 _refine.aniso_B[3][3] -0.33 _refine.B_iso_max ? _refine.B_iso_mean 87.6 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 6U7Z _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.71 _refine.ls_d_res_low 45.59 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 3207 _refine.ls_number_reflns_R_free 162 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 96.2 _refine.ls_percent_reflns_R_free 4.8 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.173 _refine.ls_R_factor_R_free 0.23 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.17 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details ? _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F ? _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 5VCI _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_R_Free_selection_details random _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R 0.839 _refine.pdbx_overall_ESU_R_Free 0.314 _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.266 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 720 _refine_hist.pdbx_number_atoms_ligand 21 _refine_hist.number_atoms_solvent 1 _refine_hist.number_atoms_total 742 _refine_hist.d_res_high 2.71 _refine_hist.d_res_low 45.59 # _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.d_res_high 2.71 _refine_ls_shell.d_res_low 2.78 _refine_ls_shell.number_reflns_all ? _refine_ls_shell.number_reflns_obs ? _refine_ls_shell.number_reflns_R_free 16 _refine_ls_shell.number_reflns_R_work 183 _refine_ls_shell.percent_reflns_obs 72.36 _refine_ls_shell.percent_reflns_R_free ? _refine_ls_shell.R_factor_all ? _refine_ls_shell.R_factor_obs ? _refine_ls_shell.R_factor_R_free 0.39 _refine_ls_shell.R_factor_R_free_error ? _refine_ls_shell.R_factor_R_work 0.458 _refine_ls_shell.redundancy_reflns_all ? _refine_ls_shell.redundancy_reflns_obs ? _refine_ls_shell.wR_factor_all ? _refine_ls_shell.wR_factor_obs ? _refine_ls_shell.wR_factor_R_free ? _refine_ls_shell.wR_factor_R_work ? _refine_ls_shell.pdbx_total_number_of_bins_used ? _refine_ls_shell.pdbx_phase_error ? _refine_ls_shell.pdbx_fsc_work ? _refine_ls_shell.pdbx_fsc_free ? # _database_PDB_matrix.entry_id 6U7Z _database_PDB_matrix.origx[1][1] 1.000000 _database_PDB_matrix.origx[1][2] 0.000000 _database_PDB_matrix.origx[1][3] 0.000000 _database_PDB_matrix.origx[2][1] 0.000000 _database_PDB_matrix.origx[2][2] 1.000000 _database_PDB_matrix.origx[2][3] 0.000000 _database_PDB_matrix.origx[3][1] 0.000000 _database_PDB_matrix.origx[3][2] 0.000000 _database_PDB_matrix.origx[3][3] 1.000000 _database_PDB_matrix.origx_vector[1] 0.00000 _database_PDB_matrix.origx_vector[2] 0.00000 _database_PDB_matrix.origx_vector[3] 0.00000 # _struct.entry_id 6U7Z _struct.title 'RNA hairpin structure containing one TNA nucleotide as primer' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 6U7Z _struct_keywords.text RNA _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 6U7Z 6U7Z ? 1 ? 1 2 PDB 6U7Z 6U7Z ? 2 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 6U7Z A 1 ? 22 ? 6U7Z 1 ? 22 ? 1 22 2 2 6U7Z B 1 ? 12 ? 6U7Z 1 ? 12 ? 1 12 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 1530 ? 1 MORE -5 ? 1 'SSA (A^2)' 6270 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale one ? A C5P 1 "O3'" ? ? ? 1_555 A U 2 P ? ? A C5P 1 A U 2 1_555 ? ? ? ? ? ? ? 1.578 ? ? covale2 covale both ? A G 21 "O3'" ? ? ? 1_555 A TG 22 P ? ? A G 21 A TG 22 1_555 ? ? ? ? ? ? ? 1.626 ? ? hydrog1 hydrog ? ? A U 2 N3 ? ? ? 1_555 B U 11 O2 ? ? A U 2 B U 11 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog2 hydrog ? ? A U 2 O4 ? ? ? 1_555 B U 11 N3 ? ? A U 2 B U 11 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog3 hydrog ? ? A G 3 N1 ? ? ? 1_555 B C 10 N3 ? ? A G 3 B C 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 3 N2 ? ? ? 1_555 B C 10 O2 ? ? A G 3 B C 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 3 O6 ? ? ? 1_555 B C 10 N4 ? ? A G 3 B C 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 4 N3 ? ? ? 1_555 B G 9 N1 ? ? A C 4 B G 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 4 N4 ? ? ? 1_555 B G 9 O6 ? ? A C 4 B G 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 4 O2 ? ? ? 1_555 B G 9 N2 ? ? A C 4 B G 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 5 O4 ? ? ? 1_555 B U 8 N3 ? ? A U 5 B U 8 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog10 hydrog ? ? A G 6 N1 ? ? ? 1_555 B C 7 N3 ? ? A G 6 B C 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 6 N2 ? ? ? 1_555 B C 7 O2 ? ? A G 6 B C 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 6 O6 ? ? ? 1_555 B C 7 N4 ? ? A G 6 B C 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 7 N1 ? ? ? 1_555 B C 6 N3 ? ? A G 7 B C 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 7 N2 ? ? ? 1_555 B C 6 O2 ? ? A G 7 B C 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 7 O6 ? ? ? 1_555 B C 6 N4 ? ? A G 7 B C 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 8 N3 ? ? ? 1_555 B G 5 N1 ? ? A C 8 B G 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 8 N4 ? ? ? 1_555 B G 5 O6 ? ? A C 8 B G 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 8 O2 ? ? ? 1_555 B G 5 N2 ? ? A C 8 B G 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 9 N3 ? ? ? 1_555 B A 3 N7 ? ? A U 9 B A 3 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog20 hydrog ? ? A U 9 O2 ? ? ? 1_555 B A 3 N6 ? ? A U 9 B A 3 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog21 hydrog ? ? A A 11 N1 ? ? ? 1_555 B U 4 N3 ? ? A A 11 B U 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A A 11 N6 ? ? ? 1_555 B U 4 O4 ? ? A A 11 B U 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 12 N1 ? ? ? 1_555 B U 2 O2 ? ? A G 12 B U 2 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog24 hydrog ? ? A G 12 O6 ? ? ? 1_555 B U 2 N3 ? ? A G 12 B U 2 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog25 hydrog ? ? A G 12 N2 ? ? ? 1_555 B U 4 O4 ? ? A G 12 B U 4 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog26 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 1 N3 ? ? A G 13 B C 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 1 O2 ? ? A G 13 B C 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 1 N4 ? ? A G 13 B C 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 15 N3 ? ? ? 1_555 A TG 22 N1 ? ? A C 15 A TG 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 15 N4 ? ? ? 1_555 A TG 22 O6 ? ? A C 15 A TG 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 15 O2 ? ? ? 1_555 A TG 22 N2 ? ? A C 15 A TG 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 21 N1 ? ? A C 16 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 21 O6 ? ? A C 16 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 21 N2 ? ? A C 16 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 17 N2 ? ? ? 1_555 A A 20 N7 ? ? A G 17 A A 20 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _struct_site.id AC1 _struct_site.pdbx_evidence_code Software _struct_site.pdbx_auth_asym_id A _struct_site.pdbx_auth_comp_id C5P _struct_site.pdbx_auth_seq_id 101 _struct_site.pdbx_auth_ins_code ? _struct_site.pdbx_num_residues 3 _struct_site.details 'binding site for residue C5P A 101' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 3 G A 14 ? G A 14 . ? 1_555 ? 2 AC1 3 TG A 22 ? TG A 22 . ? 1_555 ? 3 AC1 3 C B 1 ? C B 1 . ? 1_555 ? # _pdbx_entry_details.entry_id 6U7Z _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 C5P O3P O N N 73 C5P P P N N 74 C5P O1P O N N 75 C5P O2P O N N 76 C5P "O5'" O N N 77 C5P "C5'" C N N 78 C5P "C4'" C N R 79 C5P "O4'" O N N 80 C5P "C3'" C N S 81 C5P "O3'" O N N 82 C5P "C2'" C N R 83 C5P "O2'" O N N 84 C5P "C1'" C N R 85 C5P N1 N N N 86 C5P C2 C N N 87 C5P N3 N N N 88 C5P C4 C N N 89 C5P C5 C N N 90 C5P C6 C N N 91 C5P O2 O N N 92 C5P N4 N N N 93 C5P HOP3 H N N 94 C5P HOP2 H N N 95 C5P "H5'1" H N N 96 C5P "H5'2" H N N 97 C5P "H4'" H N N 98 C5P "H3'" H N N 99 C5P "HO3'" H N N 100 C5P "H2'1" H N N 101 C5P "HO2'" H N N 102 C5P "H1'" H N N 103 C5P H5 H N N 104 C5P H6 H N N 105 C5P HN41 H N N 106 C5P HN42 H N N 107 G OP3 O N N 108 G P P N N 109 G OP1 O N N 110 G OP2 O N N 111 G "O5'" O N N 112 G "C5'" C N N 113 G "C4'" C N R 114 G "O4'" O N N 115 G "C3'" C N S 116 G "O3'" O N N 117 G "C2'" C N R 118 G "O2'" O N N 119 G "C1'" C N R 120 G N9 N Y N 121 G C8 C Y N 122 G N7 N Y N 123 G C5 C Y N 124 G C6 C N N 125 G O6 O N N 126 G N1 N N N 127 G C2 C N N 128 G N2 N N N 129 G N3 N N N 130 G C4 C Y N 131 G HOP3 H N N 132 G HOP2 H N N 133 G "H5'" H N N 134 G "H5''" H N N 135 G "H4'" H N N 136 G "H3'" H N N 137 G "HO3'" H N N 138 G "H2'" H N N 139 G "HO2'" H N N 140 G "H1'" H N N 141 G H8 H N N 142 G H1 H N N 143 G H21 H N N 144 G H22 H N N 145 HOH O O N N 146 HOH H1 H N N 147 HOH H2 H N N 148 TG "C1'" C N R 149 TG C2 C N N 150 TG "C2'" C N R 151 TG "C3'" C N S 152 TG C4 C Y N 153 TG "C4'" C N N 154 TG C5 C Y N 155 TG C6 C N N 156 TG C8 C Y N 157 TG N1 N N N 158 TG N2 N N N 159 TG N3 N N N 160 TG N7 N Y N 161 TG N9 N Y N 162 TG O1P O N N 163 TG "O2'" O N N 164 TG O2P O N N 165 TG "O3'" O N N 166 TG "O4'" O N N 167 TG O6 O N N 168 TG P P N N 169 TG H1 H N N 170 TG H2 H N N 171 TG H3 H N N 172 TG H4 H N N 173 TG H5 H N N 174 TG H6 H N N 175 TG H7 H N N 176 TG H8 H N N 177 TG H9 H N N 178 TG H11 H N N 179 TG O3P O N N 180 TG H10 H N N 181 U OP3 O N N 182 U P P N N 183 U OP1 O N N 184 U OP2 O N N 185 U "O5'" O N N 186 U "C5'" C N N 187 U "C4'" C N R 188 U "O4'" O N N 189 U "C3'" C N S 190 U "O3'" O N N 191 U "C2'" C N R 192 U "O2'" O N N 193 U "C1'" C N R 194 U N1 N N N 195 U C2 C N N 196 U O2 O N N 197 U N3 N N N 198 U C4 C N N 199 U O4 O N N 200 U C5 C N N 201 U C6 C N N 202 U HOP3 H N N 203 U HOP2 H N N 204 U "H5'" H N N 205 U "H5''" H N N 206 U "H4'" H N N 207 U "H3'" H N N 208 U "HO3'" H N N 209 U "H2'" H N N 210 U "HO2'" H N N 211 U "H1'" H N N 212 U H3 H N N 213 U H5 H N N 214 U H6 H N N 215 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 C5P O3P P sing N N 76 C5P O3P HOP3 sing N N 77 C5P P O1P doub N N 78 C5P P O2P sing N N 79 C5P P "O5'" sing N N 80 C5P O2P HOP2 sing N N 81 C5P "O5'" "C5'" sing N N 82 C5P "C5'" "C4'" sing N N 83 C5P "C5'" "H5'1" sing N N 84 C5P "C5'" "H5'2" sing N N 85 C5P "C4'" "O4'" sing N N 86 C5P "C4'" "C3'" sing N N 87 C5P "C4'" "H4'" sing N N 88 C5P "O4'" "C1'" sing N N 89 C5P "C3'" "O3'" sing N N 90 C5P "C3'" "C2'" sing N N 91 C5P "C3'" "H3'" sing N N 92 C5P "O3'" "HO3'" sing N N 93 C5P "C2'" "O2'" sing N N 94 C5P "C2'" "C1'" sing N N 95 C5P "C2'" "H2'1" sing N N 96 C5P "O2'" "HO2'" sing N N 97 C5P "C1'" N1 sing N N 98 C5P "C1'" "H1'" sing N N 99 C5P N1 C2 sing N N 100 C5P N1 C6 sing N N 101 C5P C2 N3 sing N N 102 C5P C2 O2 doub N N 103 C5P N3 C4 doub N N 104 C5P C4 C5 sing N N 105 C5P C4 N4 sing N N 106 C5P C5 C6 doub N N 107 C5P C5 H5 sing N N 108 C5P C6 H6 sing N N 109 C5P N4 HN41 sing N N 110 C5P N4 HN42 sing N N 111 G OP3 P sing N N 112 G OP3 HOP3 sing N N 113 G P OP1 doub N N 114 G P OP2 sing N N 115 G P "O5'" sing N N 116 G OP2 HOP2 sing N N 117 G "O5'" "C5'" sing N N 118 G "C5'" "C4'" sing N N 119 G "C5'" "H5'" sing N N 120 G "C5'" "H5''" sing N N 121 G "C4'" "O4'" sing N N 122 G "C4'" "C3'" sing N N 123 G "C4'" "H4'" sing N N 124 G "O4'" "C1'" sing N N 125 G "C3'" "O3'" sing N N 126 G "C3'" "C2'" sing N N 127 G "C3'" "H3'" sing N N 128 G "O3'" "HO3'" sing N N 129 G "C2'" "O2'" sing N N 130 G "C2'" "C1'" sing N N 131 G "C2'" "H2'" sing N N 132 G "O2'" "HO2'" sing N N 133 G "C1'" N9 sing N N 134 G "C1'" "H1'" sing N N 135 G N9 C8 sing Y N 136 G N9 C4 sing Y N 137 G C8 N7 doub Y N 138 G C8 H8 sing N N 139 G N7 C5 sing Y N 140 G C5 C6 sing N N 141 G C5 C4 doub Y N 142 G C6 O6 doub N N 143 G C6 N1 sing N N 144 G N1 C2 sing N N 145 G N1 H1 sing N N 146 G C2 N2 sing N N 147 G C2 N3 doub N N 148 G N2 H21 sing N N 149 G N2 H22 sing N N 150 G N3 C4 sing N N 151 HOH O H1 sing N N 152 HOH O H2 sing N N 153 TG N2 C2 sing N N 154 TG N1 C2 sing N N 155 TG N1 C6 sing N N 156 TG O6 C6 doub N N 157 TG C2 N3 doub N N 158 TG C6 C5 sing N N 159 TG N3 C4 sing N N 160 TG C5 C4 doub Y N 161 TG C5 N7 sing Y N 162 TG C4 N9 sing Y N 163 TG N7 C8 doub Y N 164 TG N9 C8 sing Y N 165 TG N9 "C1'" sing N N 166 TG "C1'" "O4'" sing N N 167 TG "C1'" "C2'" sing N N 168 TG "O4'" "C4'" sing N N 169 TG "C2'" "O2'" sing N N 170 TG "C2'" "C3'" sing N N 171 TG "C4'" "C3'" sing N N 172 TG "C3'" "O3'" sing N N 173 TG "O3'" P sing N N 174 TG P O1P doub N N 175 TG P O2P doub N N 176 TG "C1'" H1 sing N N 177 TG "C2'" H2 sing N N 178 TG "C3'" H3 sing N N 179 TG "C4'" H4 sing N N 180 TG "C4'" H5 sing N N 181 TG C8 H6 sing N N 182 TG N1 H7 sing N N 183 TG N2 H8 sing N N 184 TG N2 H9 sing N N 185 TG "O2'" H11 sing N N 186 TG P O3P sing N N 187 TG O3P H10 sing N N 188 U OP3 P sing N N 189 U OP3 HOP3 sing N N 190 U P OP1 doub N N 191 U P OP2 sing N N 192 U P "O5'" sing N N 193 U OP2 HOP2 sing N N 194 U "O5'" "C5'" sing N N 195 U "C5'" "C4'" sing N N 196 U "C5'" "H5'" sing N N 197 U "C5'" "H5''" sing N N 198 U "C4'" "O4'" sing N N 199 U "C4'" "C3'" sing N N 200 U "C4'" "H4'" sing N N 201 U "O4'" "C1'" sing N N 202 U "C3'" "O3'" sing N N 203 U "C3'" "C2'" sing N N 204 U "C3'" "H3'" sing N N 205 U "O3'" "HO3'" sing N N 206 U "C2'" "O2'" sing N N 207 U "C2'" "C1'" sing N N 208 U "C2'" "H2'" sing N N 209 U "O2'" "HO2'" sing N N 210 U "C1'" N1 sing N N 211 U "C1'" "H1'" sing N N 212 U N1 C2 sing N N 213 U N1 C6 sing N N 214 U C2 O2 doub N N 215 U C2 N3 sing N N 216 U N3 C4 sing N N 217 U N3 H3 sing N N 218 U C4 O4 doub N N 219 U C4 C5 sing N N 220 U C5 C6 doub N N 221 U C5 H5 sing N N 222 U C6 H6 sing N N 223 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 6U7Z 'double helix' 6U7Z 'a-form double helix' 6U7Z tetraloop # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A U 2 1_555 B U 11 1_555 -0.883 -1.354 0.619 -1.930 -25.516 10.533 1 A_U2:U11_B A 2 ? B 11 ? 16 1 1 A G 3 1_555 B C 10 1_555 0.167 -0.059 -0.164 -11.756 -20.512 5.396 2 A_G3:C10_B A 3 ? B 10 ? 19 1 1 A C 4 1_555 B G 9 1_555 0.181 -0.343 -0.258 -1.370 -12.515 -2.876 3 A_C4:G9_B A 4 ? B 9 ? 19 1 1 A U 5 1_555 B U 8 1_555 -2.704 -1.442 0.069 2.350 -13.237 -20.594 4 A_U5:U8_B A 5 ? B 8 ? ? ? 1 A G 6 1_555 B C 7 1_555 0.057 -0.127 0.190 3.614 -4.000 1.373 5 A_G6:C7_B A 6 ? B 7 ? 19 1 1 A G 7 1_555 B C 6 1_555 -0.118 -0.030 -0.228 -10.417 -11.989 3.000 6 A_G7:C6_B A 7 ? B 6 ? 19 1 1 A C 8 1_555 B G 5 1_555 -0.284 0.005 -0.030 0.178 -5.044 -2.618 7 A_C8:G5_B A 8 ? B 5 ? 19 1 1 B A 3 1_555 A U 9 1_555 -4.272 -2.019 -0.375 14.854 -0.409 -91.848 8 B_A3:U9_A B 3 ? A 9 ? 24 4 1 A A 11 1_555 B U 4 1_555 0.009 -0.042 -0.555 -21.250 14.786 -9.136 9 A_A11:U4_B A 11 ? B 4 ? 20 1 1 A G 12 1_555 B U 2 1_555 -1.885 -0.550 -0.244 -4.696 -14.958 -7.531 10 A_G12:U2_B A 12 ? B 2 ? 28 1 1 A G 13 1_555 B C 1 1_555 0.493 -0.024 -0.027 -2.137 -10.169 -2.209 11 A_G13:C1_B A 13 ? B 1 ? 19 1 1 A C 15 1_555 A TG 22 1_555 0.109 0.014 -0.165 -6.560 5.653 -2.413 12 A_C15:TG22_A A 15 ? A 22 ? 19 1 1 A C 16 1_555 A G 21 1_555 0.212 -0.063 0.139 1.324 8.948 0.105 13 A_C16:G21_A A 16 ? A 21 ? 19 1 1 A G 17 1_555 A A 20 1_555 6.940 -4.588 1.525 12.219 1.735 -10.644 14 A_G17:A20_A A 17 ? A 20 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A U 2 1_555 B U 11 1_555 A G 3 1_555 B C 10 1_555 -0.397 -1.102 3.517 4.391 11.379 39.102 -2.858 1.063 3.033 16.519 -6.375 40.889 1 AA_U2G3:C10U11_BB A 2 ? B 11 ? A 3 ? B 10 ? 1 A G 3 1_555 B C 10 1_555 A C 4 1_555 B G 9 1_555 -0.590 -1.159 2.992 -0.389 6.013 29.618 -3.300 1.062 2.717 11.612 0.750 30.211 2 AA_G3C4:G9C10_BB A 3 ? B 10 ? A 4 ? B 9 ? 1 A C 4 1_555 B G 9 1_555 A U 5 1_555 B U 8 1_555 -0.906 -2.155 3.060 -4.932 14.275 17.473 -9.107 0.982 1.194 38.859 13.427 23.057 3 AA_C4U5:U8G9_BB A 4 ? B 9 ? A 5 ? B 8 ? 1 A U 5 1_555 B U 8 1_555 A G 6 1_555 B C 7 1_555 1.151 -1.303 3.232 -2.282 2.362 45.399 -1.886 -1.683 3.106 3.056 2.952 45.512 4 AA_U5G6:C7U8_BB A 5 ? B 8 ? A 6 ? B 7 ? 1 A G 6 1_555 B C 7 1_555 A G 7 1_555 B C 6 1_555 0.323 -1.974 3.519 2.630 8.775 32.386 -4.852 -0.127 2.916 15.354 -4.602 33.623 5 AA_G6G7:C6C7_BB A 6 ? B 7 ? A 7 ? B 6 ? 1 A G 7 1_555 B C 6 1_555 A C 8 1_555 B G 5 1_555 -0.961 -2.380 3.073 -2.851 0.921 28.337 -5.034 1.338 3.075 1.875 5.804 28.492 6 AA_G7C8:G5C6_BB A 7 ? B 6 ? A 8 ? B 5 ? 1 A C 8 1_555 B G 5 1_555 B A 3 1_555 A U 9 1_555 -0.163 -4.969 0.031 -131.036 -108.316 89.069 -2.170 -0.305 2.364 -55.106 66.665 172.882 7 AB_C8A3:U9G5_AB A 8 ? B 5 ? B 3 ? A 9 ? 1 B A 3 1_555 A U 9 1_555 A A 11 1_555 B U 4 1_555 -2.599 3.631 2.352 -146.670 -18.530 66.999 2.050 -0.121 3.083 -10.148 80.321 153.288 8 BA_A3A11:U4U9_BA B 3 ? A 9 ? A 11 ? B 4 ? 1 A A 11 1_555 B U 4 1_555 A G 12 1_555 B U 2 1_555 4.491 -0.507 2.831 -7.952 31.022 62.417 -1.321 -4.168 1.910 28.072 7.196 69.408 9 AA_A11G12:U2U4_BB A 11 ? B 4 ? A 12 ? B 2 ? 1 A G 12 1_555 B U 2 1_555 A G 13 1_555 B C 1 1_555 0.601 -1.142 3.236 -3.447 5.953 40.136 -2.273 -1.229 2.984 8.597 4.978 40.697 10 AA_G12G13:C1U2_BB A 12 ? B 2 ? A 13 ? B 1 ? 1 A G 13 1_555 B C 1 1_555 A C 15 1_555 A TG 22 1_555 0.686 -2.782 6.429 8.673 10.917 70.887 -3.067 -0.025 6.043 9.323 -7.406 72.068 11 AA_G13C15:TG22C1_AB A 13 ? B 1 ? A 15 ? A 22 ? 1 A C 15 1_555 A TG 22 1_555 A C 16 1_555 A G 21 1_555 -0.027 -1.691 3.283 -1.825 16.026 23.581 -6.555 -0.300 1.789 34.516 3.930 28.505 12 AA_C15C16:G21TG22_AA A 15 ? A 22 ? A 16 ? A 21 ? 1 A C 16 1_555 A G 21 1_555 A G 17 1_555 A A 20 1_555 -1.430 -1.252 2.903 -1.010 15.643 48.377 -2.386 1.610 2.442 18.532 1.196 50.708 13 AA_C16G17:A20G21_AA A 16 ? A 21 ? A 17 ? A 20 ? # _pdbx_audit_support.funding_organization 'Howard Hughes Medical Institute (HHMI)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id TG _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id TG _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 5VCI _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 6U7Z _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.014022 _atom_sites.fract_transf_matrix[1][2] 0.008095 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.016191 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.014800 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C N O P # loop_