data_6UES # _entry.id 6UES # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.388 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 6UES pdb_00006ues 10.2210/pdb6ues/pdb WWPDB D_1000244479 ? ? EMDB EMD-20755 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2019-12-18 2 'Structure model' 1 1 2024-03-20 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' chem_comp_atom 2 2 'Structure model' chem_comp_bond 3 2 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_database_2.pdbx_DOI' 2 2 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 6UES _pdbx_database_status.recvd_initial_deposition_date 2019-09-23 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data ? # _pdbx_database_related.db_name EMDB _pdbx_database_related.details 'Apo SAM-IV Riboswitch' _pdbx_database_related.db_id EMD-20755 _pdbx_database_related.content_type 'associated EM volume' # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Zhang, K.' 1 0000-0003-0414-4776 'Li, S.' 2 0000-0002-5625-5809 'Kappel, K.' 3 ? 'Pintilie, G.' 4 ? 'Su, Z.' 5 ? 'Mou, T.' 6 ? 'Schmid, M.' 7 ? 'Das, R.' 8 ? 'Chiu, W.' 9 0000-0002-8910-3078 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nat Commun' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2041-1723 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 10 _citation.language ? _citation.page_first 5511 _citation.page_last 5511 _citation.title 'Cryo-EM structure of a 40 kDa SAM-IV riboswitch RNA at 3.7 angstrom resolution.' _citation.year 2019 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41467-019-13494-7 _citation.pdbx_database_id_PubMed 31796736 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Zhang, K.' 1 0000-0003-0414-4776 primary 'Li, S.' 2 0000-0002-7041-5960 primary 'Kappel, K.' 3 0000-0002-2129-199X primary 'Pintilie, G.' 4 ? primary 'Su, Z.' 5 0000-0002-9279-1721 primary 'Mou, T.C.' 6 ? primary 'Schmid, M.F.' 7 0000-0003-1077-5750 primary 'Das, R.' 8 0000-0001-7497-0972 primary 'Chiu, W.' 9 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (119-MER)' _entity.formula_weight 38522.906 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGUCAUGAGUGCCAGCGUCAAGCCCCGGCUUGCUGGCCGGCAACCCUCCAACCGCGGUGGGGUGCCCCGGGUGAUGACCA GGUUGAGUAGCCGUGACGGCUACGCGGCAAGCGCGGGUC ; _entity_poly.pdbx_seq_one_letter_code_can ;GGUCAUGAGUGCCAGCGUCAAGCCCCGGCUUGCUGGCCGGCAACCCUCCAACCGCGGUGGGGUGCCCCGGGUGAUGACCA GGUUGAGUAGCCGUGACGGCUACGCGGCAAGCGCGGGUC ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 U n 1 4 C n 1 5 A n 1 6 U n 1 7 G n 1 8 A n 1 9 G n 1 10 U n 1 11 G n 1 12 C n 1 13 C n 1 14 A n 1 15 G n 1 16 C n 1 17 G n 1 18 U n 1 19 C n 1 20 A n 1 21 A n 1 22 G n 1 23 C n 1 24 C n 1 25 C n 1 26 C n 1 27 G n 1 28 G n 1 29 C n 1 30 U n 1 31 U n 1 32 G n 1 33 C n 1 34 U n 1 35 G n 1 36 G n 1 37 C n 1 38 C n 1 39 G n 1 40 G n 1 41 C n 1 42 A n 1 43 A n 1 44 C n 1 45 C n 1 46 C n 1 47 U n 1 48 C n 1 49 C n 1 50 A n 1 51 A n 1 52 C n 1 53 C n 1 54 G n 1 55 C n 1 56 G n 1 57 G n 1 58 U n 1 59 G n 1 60 G n 1 61 G n 1 62 G n 1 63 U n 1 64 G n 1 65 C n 1 66 C n 1 67 C n 1 68 C n 1 69 G n 1 70 G n 1 71 G n 1 72 U n 1 73 G n 1 74 A n 1 75 U n 1 76 G n 1 77 A n 1 78 C n 1 79 C n 1 80 A n 1 81 G n 1 82 G n 1 83 U n 1 84 U n 1 85 G n 1 86 A n 1 87 G n 1 88 U n 1 89 A n 1 90 G n 1 91 C n 1 92 C n 1 93 G n 1 94 U n 1 95 G n 1 96 A n 1 97 C n 1 98 G n 1 99 G n 1 100 C n 1 101 U n 1 102 A n 1 103 C n 1 104 G n 1 105 C n 1 106 G n 1 107 G n 1 108 C n 1 109 A n 1 110 A n 1 111 G n 1 112 C n 1 113 G n 1 114 C n 1 115 G n 1 116 G n 1 117 G n 1 118 U n 1 119 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 119 _pdbx_entity_src_syn.organism_scientific 'Mycobacterium sp. MCS' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 164756 _pdbx_entity_src_syn.details 'RNA was prepared by in vitro transcription with T7 RNA polymerase' # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 U 3 3 3 U U A . n A 1 4 C 4 4 4 C C A . n A 1 5 A 5 5 5 A A A . n A 1 6 U 6 6 6 U U A . n A 1 7 G 7 7 7 G G A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 U 10 10 10 U U A . n A 1 11 G 11 11 11 G G A . n A 1 12 C 12 12 12 C C A . n A 1 13 C 13 13 13 C C A . n A 1 14 A 14 14 14 A A A . n A 1 15 G 15 15 15 G G A . n A 1 16 C 16 16 16 C C A . n A 1 17 G 17 17 17 G G A . n A 1 18 U 18 18 18 U U A . n A 1 19 C 19 19 19 C C A . n A 1 20 A 20 20 20 A A A . n A 1 21 A 21 21 21 A A A . n A 1 22 G 22 22 22 G G A . n A 1 23 C 23 23 23 C C A . n A 1 24 C 24 24 24 C C A . n A 1 25 C 25 25 25 C C A . n A 1 26 C 26 26 26 C C A . n A 1 27 G 27 27 27 G G A . n A 1 28 G 28 28 28 G G A . n A 1 29 C 29 29 29 C C A . n A 1 30 U 30 30 30 U U A . n A 1 31 U 31 31 31 U U A . n A 1 32 G 32 32 32 G G A . n A 1 33 C 33 33 33 C C A . n A 1 34 U 34 34 34 U U A . n A 1 35 G 35 35 35 G G A . n A 1 36 G 36 36 36 G G A . n A 1 37 C 37 37 37 C C A . n A 1 38 C 38 38 38 C C A . n A 1 39 G 39 39 39 G G A . n A 1 40 G 40 40 40 G G A . n A 1 41 C 41 41 41 C C A . n A 1 42 A 42 42 42 A A A . n A 1 43 A 43 43 43 A A A . n A 1 44 C 44 44 44 C C A . n A 1 45 C 45 45 45 C C A . n A 1 46 C 46 46 46 C C A . n A 1 47 U 47 47 47 U U A . n A 1 48 C 48 48 48 C C A . n A 1 49 C 49 49 49 C C A . n A 1 50 A 50 50 50 A A A . n A 1 51 A 51 51 51 A A A . n A 1 52 C 52 52 52 C C A . n A 1 53 C 53 53 53 C C A . n A 1 54 G 54 54 54 G G A . n A 1 55 C 55 55 55 C C A . n A 1 56 G 56 56 56 G G A . n A 1 57 G 57 57 57 G G A . n A 1 58 U 58 58 58 U U A . n A 1 59 G 59 59 59 G G A . n A 1 60 G 60 60 60 G G A . n A 1 61 G 61 61 61 G G A . n A 1 62 G 62 62 62 G G A . n A 1 63 U 63 63 63 U U A . n A 1 64 G 64 64 64 G G A . n A 1 65 C 65 65 65 C C A . n A 1 66 C 66 66 66 C C A . n A 1 67 C 67 67 67 C C A . n A 1 68 C 68 68 68 C C A . n A 1 69 G 69 69 69 G G A . n A 1 70 G 70 70 70 G G A . n A 1 71 G 71 71 71 G G A . n A 1 72 U 72 72 72 U U A . n A 1 73 G 73 73 73 G G A . n A 1 74 A 74 74 74 A A A . n A 1 75 U 75 75 75 U U A . n A 1 76 G 76 76 76 G G A . n A 1 77 A 77 77 77 A A A . n A 1 78 C 78 78 78 C C A . n A 1 79 C 79 79 79 C C A . n A 1 80 A 80 80 80 A A A . n A 1 81 G 81 81 81 G G A . n A 1 82 G 82 82 82 G G A . n A 1 83 U 83 83 83 U U A . n A 1 84 U 84 84 84 U U A . n A 1 85 G 85 85 85 G G A . n A 1 86 A 86 86 86 A A A . n A 1 87 G 87 87 87 G G A . n A 1 88 U 88 88 88 U U A . n A 1 89 A 89 89 89 A A A . n A 1 90 G 90 90 90 G G A . n A 1 91 C 91 91 91 C C A . n A 1 92 C 92 92 92 C C A . n A 1 93 G 93 93 93 G G A . n A 1 94 U 94 94 94 U U A . n A 1 95 G 95 95 95 G G A . n A 1 96 A 96 96 96 A A A . n A 1 97 C 97 97 97 C C A . n A 1 98 G 98 98 98 G G A . n A 1 99 G 99 99 99 G G A . n A 1 100 C 100 100 100 C C A . n A 1 101 U 101 101 101 U U A . n A 1 102 A 102 102 102 A A A . n A 1 103 C 103 103 103 C C A . n A 1 104 G 104 104 104 G G A . n A 1 105 C 105 105 105 C C A . n A 1 106 G 106 106 106 G G A . n A 1 107 G 107 107 107 G G A . n A 1 108 C 108 108 108 C C A . n A 1 109 A 109 109 109 A A A . n A 1 110 A 110 110 110 A A A . n A 1 111 G 111 111 111 G G A . n A 1 112 C 112 112 112 C C A . n A 1 113 G 113 113 113 G G A . n A 1 114 C 114 114 114 C C A . n A 1 115 G 115 115 115 G G A . n A 1 116 G 116 116 116 G G A . n A 1 117 G 117 117 117 G G A . n A 1 118 U 118 118 118 U U A . n A 1 119 C 119 119 119 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 6UES _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _struct.entry_id 6UES _struct.title 'Apo SAM-IV Riboswitch' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 6UES _struct_keywords.text 'SAM-IV riboswitch, Cryo-EM, Small RNA, RNA' _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name GB _struct_ref.db_code CP000384.1 _struct_ref.pdbx_db_accession 108767400 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ;GGUCAUGAGUGCCAGCGUCAAGCCCCGGCUUGCUGGCCGGCAACCCUCCAACCGCGGUGGGGUGCCCCGGGUGAUGACCA GGUUGAGUAGCCGUGACGGCUACGCGGCAAGCGCGGGUC ; _struct_ref.pdbx_align_begin 1307439 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 6UES _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 119 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 108767400 _struct_ref_seq.db_align_beg 1307439 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 1307321 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 119 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 79 N3 ? ? A G 1 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 79 O2 ? ? A G 1 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 79 N4 ? ? A G 1 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 78 N3 ? ? A G 2 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 78 O2 ? ? A G 2 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 78 N4 ? ? A G 2 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 79 N3 ? ? A G 2 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 79 O2 ? ? A G 2 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 79 N4 ? ? A G 2 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 77 N1 ? ? A U 3 A A 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 3 O4 ? ? ? 1_555 A A 77 N6 ? ? A U 3 A A 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 3 N3 ? ? ? 1_555 A C 78 N3 ? ? A U 3 A C 78 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog13 hydrog ? ? A U 3 O4 ? ? ? 1_555 A C 78 N4 ? ? A U 3 A C 78 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog14 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 76 N1 ? ? A C 4 A G 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 76 O6 ? ? A C 4 A G 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 76 N2 ? ? A C 4 A G 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A A 5 N6 ? ? ? 1_555 A G 73 N7 ? ? A A 5 A G 73 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog18 hydrog ? ? A U 6 O4 ? ? ? 1_555 A C 24 N4 ? ? A U 6 A C 24 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog19 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 38 N3 ? ? A G 9 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 38 O2 ? ? A G 9 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 38 N4 ? ? A G 9 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 37 N3 ? ? A G 11 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 37 O2 ? ? A G 11 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 37 N4 ? ? A G 11 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 36 N1 ? ? A C 12 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 36 O6 ? ? A C 12 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 36 N2 ? ? A C 12 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 35 N1 ? ? A C 13 A G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 35 O6 ? ? A C 13 A G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 35 N2 ? ? A C 13 A G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A A 14 N1 ? ? ? 1_555 A U 34 N3 ? ? A A 14 A U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A A 14 N6 ? ? ? 1_555 A U 34 O4 ? ? A A 14 A U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 15 N1 ? ? ? 1_555 A C 33 N3 ? ? A G 15 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 15 N2 ? ? ? 1_555 A C 33 O2 ? ? A G 15 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 15 O6 ? ? ? 1_555 A C 33 N4 ? ? A G 15 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 32 N1 ? ? A C 16 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 32 O6 ? ? A C 16 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 32 N2 ? ? A C 16 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 17 N1 ? ? ? 1_555 A U 31 O4 ? ? A G 17 A U 31 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog40 hydrog ? ? A A 21 N1 ? ? ? 1_555 A U 30 N3 ? ? A A 21 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A A 21 N6 ? ? ? 1_555 A U 30 O4 ? ? A A 21 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 22 N1 ? ? ? 1_555 A C 29 N3 ? ? A G 22 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 22 N2 ? ? ? 1_555 A C 29 O2 ? ? A G 22 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 22 O6 ? ? ? 1_555 A C 29 N4 ? ? A G 22 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 23 N4 ? ? ? 1_555 A G 73 O6 ? ? A C 23 A G 73 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog46 hydrog ? ? A C 24 N3 ? ? ? 1_555 A G 71 N1 ? ? A C 24 A G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 24 N4 ? ? ? 1_555 A G 71 O6 ? ? A C 24 A G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 71 N2 ? ? A C 24 A G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 25 N3 ? ? ? 1_555 A G 70 N1 ? ? A C 25 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 25 N4 ? ? ? 1_555 A G 70 O6 ? ? A C 25 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A C 25 O2 ? ? ? 1_555 A G 70 N2 ? ? A C 25 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 26 N3 ? ? ? 1_555 A G 69 N1 ? ? A C 26 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 26 N4 ? ? ? 1_555 A G 69 O6 ? ? A C 26 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 26 O2 ? ? ? 1_555 A G 69 N2 ? ? A C 26 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 68 N3 ? ? A G 27 A C 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 68 O2 ? ? A G 27 A C 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 68 N4 ? ? A G 27 A C 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A G 28 N1 ? ? ? 1_555 A C 67 N3 ? ? A G 28 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 67 O2 ? ? A G 28 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 28 O6 ? ? ? 1_555 A C 67 N4 ? ? A G 28 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 39 N1 ? ? ? 1_555 A C 66 N3 ? ? A G 39 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 39 N2 ? ? ? 1_555 A C 66 O2 ? ? A G 39 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 39 O6 ? ? ? 1_555 A C 66 N4 ? ? A G 39 A C 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 40 N1 ? ? ? 1_555 A C 65 N3 ? ? A G 40 A C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 40 N2 ? ? ? 1_555 A C 65 O2 ? ? A G 40 A C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 40 O6 ? ? ? 1_555 A C 65 N4 ? ? A G 40 A C 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A C 41 N3 ? ? ? 1_555 A G 64 N1 ? ? A C 41 A G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A C 41 N4 ? ? ? 1_555 A G 64 O6 ? ? A C 41 A G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A C 41 O2 ? ? ? 1_555 A G 64 N2 ? ? A C 41 A G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A A 42 N6 ? ? ? 1_555 A U 63 O4 ? ? A A 42 A U 63 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog71 hydrog ? ? A C 44 N3 ? ? ? 1_555 A G 62 N1 ? ? A C 44 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A C 44 N4 ? ? ? 1_555 A G 62 O6 ? ? A C 44 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A C 44 O2 ? ? ? 1_555 A G 62 N2 ? ? A C 44 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A C 44 N3 ? ? ? 1_555 A U 63 N3 ? ? A C 44 A U 63 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog75 hydrog ? ? A C 44 N4 ? ? ? 1_555 A U 63 O4 ? ? A C 44 A U 63 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog76 hydrog ? ? A C 45 N3 ? ? ? 1_555 A G 61 N1 ? ? A C 45 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A C 45 N4 ? ? ? 1_555 A G 61 O6 ? ? A C 45 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A C 45 O2 ? ? ? 1_555 A G 61 N2 ? ? A C 45 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A C 46 N3 ? ? ? 1_555 A G 60 N1 ? ? A C 46 A G 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A C 46 N4 ? ? ? 1_555 A G 60 O6 ? ? A C 46 A G 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A C 46 O2 ? ? ? 1_555 A G 60 N2 ? ? A C 46 A G 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A U 47 O2 ? ? ? 1_555 A G 59 N2 ? ? A U 47 A G 59 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog83 hydrog ? ? A C 48 N3 ? ? ? 1_555 A G 57 N1 ? ? A C 48 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A C 48 N4 ? ? ? 1_555 A G 57 O6 ? ? A C 48 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A C 48 O2 ? ? ? 1_555 A G 57 N2 ? ? A C 48 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A C 49 N3 ? ? ? 1_555 A G 56 N1 ? ? A C 49 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A C 49 N4 ? ? ? 1_555 A G 56 O6 ? ? A C 49 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A C 49 O2 ? ? ? 1_555 A G 56 N2 ? ? A C 49 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A C 49 N3 ? ? ? 1_555 A G 57 N1 ? ? A C 49 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A C 49 N4 ? ? ? 1_555 A G 57 O6 ? ? A C 49 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A C 49 O2 ? ? ? 1_555 A G 57 N2 ? ? A C 49 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A A 51 N1 ? ? ? 1_555 A U 118 N3 ? ? A A 51 A U 118 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A A 51 N6 ? ? ? 1_555 A U 118 O4 ? ? A A 51 A U 118 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? A C 52 N3 ? ? ? 1_555 A G 116 N1 ? ? A C 52 A G 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A C 52 N4 ? ? ? 1_555 A G 116 O6 ? ? A C 52 A G 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A C 52 O2 ? ? ? 1_555 A G 116 N2 ? ? A C 52 A G 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? A C 53 N3 ? ? ? 1_555 A G 115 N1 ? ? A C 53 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? A C 53 N4 ? ? ? 1_555 A G 115 O6 ? ? A C 53 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? A C 53 O2 ? ? ? 1_555 A G 115 N2 ? ? A C 53 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? A G 54 N1 ? ? ? 1_555 A C 114 N3 ? ? A G 54 A C 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog101 hydrog ? ? A G 54 N2 ? ? ? 1_555 A C 114 O2 ? ? A G 54 A C 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog102 hydrog ? ? A G 54 O6 ? ? ? 1_555 A C 114 N4 ? ? A G 54 A C 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog103 hydrog ? ? A C 55 N3 ? ? ? 1_555 A G 113 N1 ? ? A C 55 A G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog104 hydrog ? ? A C 55 N4 ? ? ? 1_555 A G 113 O6 ? ? A C 55 A G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog105 hydrog ? ? A C 55 O2 ? ? ? 1_555 A G 113 N2 ? ? A C 55 A G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog106 hydrog ? ? A G 57 N3 ? ? ? 1_555 A C 112 N4 ? ? A G 57 A C 112 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog107 hydrog ? ? A U 58 N3 ? ? ? 1_555 A G 111 O6 ? ? A U 58 A G 111 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog108 hydrog ? ? A U 58 O2 ? ? ? 1_555 A G 111 N1 ? ? A U 58 A G 111 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog109 hydrog ? ? A G 59 N2 ? ? ? 1_555 A A 110 N7 ? ? A G 59 A A 110 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog110 hydrog ? ? A G 59 N3 ? ? ? 1_555 A A 110 N6 ? ? A G 59 A A 110 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog111 hydrog ? ? A G 61 N2 ? ? ? 1_555 A G 81 N3 ? ? A G 61 A G 81 1_555 ? ? ? ? ? ? TYPE_4_PAIR ? ? ? hydrog112 hydrog ? ? A G 61 N3 ? ? ? 1_555 A G 81 N2 ? ? A G 61 A G 81 1_555 ? ? ? ? ? ? TYPE_4_PAIR ? ? ? hydrog113 hydrog ? ? A G 81 N1 ? ? ? 1_555 A A 109 N1 ? ? A G 81 A A 109 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog114 hydrog ? ? A G 81 O6 ? ? ? 1_555 A A 109 N6 ? ? A G 81 A A 109 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog115 hydrog ? ? A G 82 N1 ? ? ? 1_555 A C 108 N3 ? ? A G 82 A C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog116 hydrog ? ? A G 82 N2 ? ? ? 1_555 A C 108 O2 ? ? A G 82 A C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog117 hydrog ? ? A G 82 O6 ? ? ? 1_555 A C 108 N4 ? ? A G 82 A C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog118 hydrog ? ? A U 83 N3 ? ? ? 1_555 A G 107 O6 ? ? A U 83 A G 107 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog119 hydrog ? ? A U 83 O2 ? ? ? 1_555 A G 107 N1 ? ? A U 83 A G 107 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog120 hydrog ? ? A U 84 N3 ? ? ? 1_555 A G 106 O6 ? ? A U 84 A G 106 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog121 hydrog ? ? A U 84 O2 ? ? ? 1_555 A G 106 N1 ? ? A U 84 A G 106 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog122 hydrog ? ? A G 85 N1 ? ? ? 1_555 A C 105 N3 ? ? A G 85 A C 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog123 hydrog ? ? A G 85 N2 ? ? ? 1_555 A C 105 O2 ? ? A G 85 A C 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog124 hydrog ? ? A G 85 O6 ? ? ? 1_555 A C 105 N4 ? ? A G 85 A C 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog125 hydrog ? ? A A 86 N1 ? ? ? 1_555 A G 104 N1 ? ? A A 86 A G 104 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog126 hydrog ? ? A A 86 N6 ? ? ? 1_555 A G 104 O6 ? ? A A 86 A G 104 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog127 hydrog ? ? A G 87 N1 ? ? ? 1_555 A C 103 N3 ? ? A G 87 A C 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog128 hydrog ? ? A G 87 N2 ? ? ? 1_555 A C 103 O2 ? ? A G 87 A C 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog129 hydrog ? ? A G 87 O6 ? ? ? 1_555 A C 103 N4 ? ? A G 87 A C 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog130 hydrog ? ? A U 88 N3 ? ? ? 1_555 A A 102 N1 ? ? A U 88 A A 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog131 hydrog ? ? A U 88 O4 ? ? ? 1_555 A A 102 N6 ? ? A U 88 A A 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog132 hydrog ? ? A A 89 N1 ? ? ? 1_555 A U 101 N3 ? ? A A 89 A U 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog133 hydrog ? ? A A 89 N6 ? ? ? 1_555 A U 101 O4 ? ? A A 89 A U 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog134 hydrog ? ? A G 90 N1 ? ? ? 1_555 A C 100 N3 ? ? A G 90 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog135 hydrog ? ? A G 90 N2 ? ? ? 1_555 A C 100 O2 ? ? A G 90 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog136 hydrog ? ? A G 90 O6 ? ? ? 1_555 A C 100 N4 ? ? A G 90 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog137 hydrog ? ? A C 91 N3 ? ? ? 1_555 A G 99 N1 ? ? A C 91 A G 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog138 hydrog ? ? A C 91 N4 ? ? ? 1_555 A G 99 O6 ? ? A C 91 A G 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog139 hydrog ? ? A C 91 O2 ? ? ? 1_555 A G 99 N2 ? ? A C 91 A G 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog140 hydrog ? ? A C 92 N3 ? ? ? 1_555 A G 98 N1 ? ? A C 92 A G 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog141 hydrog ? ? A C 92 N4 ? ? ? 1_555 A G 98 O6 ? ? A C 92 A G 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog142 hydrog ? ? A C 92 O2 ? ? ? 1_555 A G 98 N2 ? ? A C 92 A G 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog143 hydrog ? ? A U 94 O2 ? ? ? 1_555 A C 97 N4 ? ? A U 94 A C 97 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 1 _pdbx_validate_close_contact.auth_atom_id_1 O2 _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 U _pdbx_validate_close_contact.auth_seq_id_1 58 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 O6 _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 G _pdbx_validate_close_contact.auth_seq_id_2 111 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 2.16 # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 N3 _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 C _pdbx_validate_rmsd_angle.auth_seq_id_1 49 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 C2 _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 C _pdbx_validate_rmsd_angle.auth_seq_id_2 49 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 O2 _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 C _pdbx_validate_rmsd_angle.auth_seq_id_3 49 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 116.73 _pdbx_validate_rmsd_angle.angle_target_value 121.90 _pdbx_validate_rmsd_angle.angle_deviation -5.17 _pdbx_validate_rmsd_angle.angle_standard_deviation 0.70 _pdbx_validate_rmsd_angle.linker_flag N # _em_3d_fitting.entry_id 6UES _em_3d_fitting.id 1 _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_protocol 'BACKBONE TRACE' _em_3d_fitting.ref_space REAL _em_3d_fitting.target_criteria ? _em_3d_fitting.method ? # _em_3d_reconstruction.entry_id 6UES _em_3d_reconstruction.id 1 _em_3d_reconstruction.algorithm ? _em_3d_reconstruction.details ? _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.num_class_averages ? _em_3d_reconstruction.num_particles 796923 _em_3d_reconstruction.resolution 3.7 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.symmetry_type POINT _em_3d_reconstruction.method ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.magnification_calibration ? _em_3d_reconstruction.citation_id ? _em_3d_reconstruction.euler_angles_details ? # _em_buffer.id 1 _em_buffer.details ? _em_buffer.pH 7.2 _em_buffer.specimen_id 1 _em_buffer.name ? # loop_ _em_entity_assembly.id _em_entity_assembly.parent_id _em_entity_assembly.details _em_entity_assembly.name _em_entity_assembly.source _em_entity_assembly.type _em_entity_assembly.entity_id_list _em_entity_assembly.synonym _em_entity_assembly.oligomeric_details 1 0 ? 'Apo SAM-IV Riboswitch' 'MULTIPLE SOURCES' COMPLEX 1 ? ? 2 1 ? 'Apo SAM-IV riboswitch' 'MULTIPLE SOURCES' COMPLEX 1 ? ? # _em_image_scans.entry_id 6UES _em_image_scans.id 1 _em_image_scans.dimension_height ? _em_image_scans.dimension_width ? _em_image_scans.frames_per_image 30 _em_image_scans.image_recording_id 1 _em_image_scans.sampling_size ? _em_image_scans.scanner_model ? _em_image_scans.used_frames_per_image 1-30 _em_image_scans.citation_id ? _em_image_scans.number_digital_images ? _em_image_scans.od_range ? _em_image_scans.quant_bit_size ? _em_image_scans.details ? # _em_imaging.id 1 _em_imaging.entry_id 6UES _em_imaging.accelerating_voltage 300 _em_imaging.alignment_procedure 'COMA FREE' _em_imaging.c2_aperture_diameter 70 _em_imaging.calibrated_defocus_max ? _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_magnification ? _em_imaging.cryogen NITROGEN _em_imaging.details ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.illumination_mode 'FLOOD BEAM' _em_imaging.microscope_model 'FEI TITAN KRIOS' _em_imaging.mode 'BRIGHT FIELD' _em_imaging.nominal_cs 2.7 _em_imaging.nominal_defocus_max 3500 _em_imaging.nominal_defocus_min 1500 _em_imaging.nominal_magnification 130000 _em_imaging.recording_temperature_maximum ? _em_imaging.recording_temperature_minimum ? _em_imaging.residual_tilt ? _em_imaging.specimen_holder_model 'FEI TITAN KRIOS AUTOGRID HOLDER' _em_imaging.specimen_id 1 _em_imaging.citation_id ? _em_imaging.date ? _em_imaging.temperature ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.astigmatism ? _em_imaging.detector_distance ? _em_imaging.electron_beam_tilt_params ? _em_imaging.specimen_holder_type ? # _em_sample_support.id 1 _em_sample_support.specimen_id 1 _em_sample_support.details ? _em_sample_support.grid_material COPPER _em_sample_support.grid_mesh_size 200 _em_sample_support.grid_type 'Quantifoil R3.5/1' _em_sample_support.method ? _em_sample_support.film_material ? _em_sample_support.citation_id ? # _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.chamber_temperature ? _em_vitrification.cryogen_name ETHANE _em_vitrification.details ? _em_vitrification.humidity 100 _em_vitrification.instrument 'FEI VITROBOT MARK IV' _em_vitrification.entry_id 6UES _em_vitrification.citation_id ? _em_vitrification.method ? _em_vitrification.temp ? _em_vitrification.time_resolved_state ? # _em_experiment.entry_id 6UES _em_experiment.id 1 _em_experiment.aggregation_state PARTICLE _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.entity_assembly_id 1 # _em_single_particle_entity.entry_id 6UES _em_single_particle_entity.id 1 _em_single_particle_entity.image_processing_id 1 _em_single_particle_entity.point_symmetry C1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # _em_ctf_correction.id 1 _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.type 'PHASE FLIPPING AND AMPLITUDE CORRECTION' _em_ctf_correction.details ? # loop_ _em_entity_assembly_molwt.entity_assembly_id _em_entity_assembly_molwt.id _em_entity_assembly_molwt.experimental_flag _em_entity_assembly_molwt.units _em_entity_assembly_molwt.value 1 1 YES MEGADALTONS 0.040 1 2 YES MEGADALTONS 0.040 # loop_ _em_entity_assembly_naturalsource.id _em_entity_assembly_naturalsource.entity_assembly_id _em_entity_assembly_naturalsource.cell _em_entity_assembly_naturalsource.cellular_location _em_entity_assembly_naturalsource.ncbi_tax_id _em_entity_assembly_naturalsource.organ _em_entity_assembly_naturalsource.organelle _em_entity_assembly_naturalsource.organism _em_entity_assembly_naturalsource.strain _em_entity_assembly_naturalsource.tissue 1 1 ? ? 210 ? ? 'Helicobacter pylori' 60190 ? 2 2 ? ? 210 ? ? 'Helicobacter pylori' 60190 ? # _em_image_processing.id 1 _em_image_processing.image_recording_id 1 _em_image_processing.details ? # _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.avg_electron_dose_per_image 7.6 _em_image_recording.average_exposure_time 6 _em_image_recording.details ? _em_image_recording.detector_mode COUNTING _em_image_recording.film_or_detector_model 'GATAN K2 SUMMIT (4k x 4k)' _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged 2 _em_image_recording.num_real_images 7200 # _em_imaging_optics.id 1 _em_imaging_optics.imaging_id 1 _em_imaging_optics.chr_aberration_corrector ? _em_imaging_optics.energyfilter_lower ? _em_imaging_optics.energyfilter_name 'GIF Quantum LS' _em_imaging_optics.energyfilter_upper ? _em_imaging_optics.energyfilter_slit_width 20 _em_imaging_optics.phase_plate ? _em_imaging_optics.sph_aberration_corrector ? # _em_particle_selection.id 1 _em_particle_selection.image_processing_id 1 _em_particle_selection.details ? _em_particle_selection.method ? _em_particle_selection.num_particles_selected 2102569 _em_particle_selection.reference_model ? # loop_ _em_software.id _em_software.category _em_software.details _em_software.name _em_software.version _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id 1 'CRYSTALLOGRAPHY MERGING' ? ? ? 1 1 1 2 'IMAGE ACQUISITION' ? EPU ? ? ? 1 3 MASKING ? ? ? ? ? ? 4 'CTF CORRECTION' ? CTFFIND 4 1 ? ? 5 'LAYERLINE INDEXING' ? ? ? ? ? ? 6 'DIFFRACTION INDEXING' ? ? ? ? ? ? 7 'MODEL FITTING' ? 'UCSF Chimera' 1.13.1 ? 1 ? 8 OTHER ? ? ? ? ? ? 9 'INITIAL EULER ASSIGNMENT' ? RELION 2.1 1 ? ? 10 'FINAL EULER ASSIGNMENT' ? cryoSPARC 2 1 ? ? 11 CLASSIFICATION ? cryoSPARC 2 1 ? ? 12 RECONSTRUCTION ? cryoSPARC 2 1 ? ? 13 'MODEL REFINEMENT' ? PHENIX 1.14 ? 1 ? # _em_specimen.id 1 _em_specimen.experiment_id 1 _em_specimen.concentration 1.2 _em_specimen.details 'Apo SAM-IV riboswitch' _em_specimen.embedding_applied NO _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 6UES 'double helix' 6UES 'a-form double helix' 6UES 'hairpin loop' 6UES 'bulge loop' 6UES 'mismatched base pair' 6UES 'triple helix' 6UES 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 79 1_555 -0.045 -0.513 -1.760 -13.521 2.419 -2.747 1 A_G1:C79_A A 1 ? A 79 ? 19 1 1 A G 2 1_555 A C 78 1_555 -0.026 -0.466 -1.362 -3.743 7.613 -5.990 2 A_G2:C78_A A 2 ? A 78 ? 19 1 1 A U 3 1_555 A A 77 1_555 -0.141 -0.294 -1.099 1.267 -1.196 -3.853 3 A_U3:A77_A A 3 ? A 77 ? 20 1 1 A C 4 1_555 A G 76 1_555 0.222 -0.196 -0.480 -5.784 -5.345 1.908 4 A_C4:G76_A A 4 ? A 76 ? 19 1 1 A C 23 1_555 A G 73 1_555 -1.374 1.439 -1.573 36.774 9.000 -32.681 5 A_C23:G73_A A 23 ? A 73 ? ? ? 1 A U 31 1_555 A G 17 1_555 -2.600 0.605 -1.715 -19.372 -27.982 -44.642 6 A_U31:G17_A A 31 ? A 17 ? ? ? 1 A G 32 1_555 A C 16 1_555 -0.228 -0.143 -0.846 -18.736 -9.186 2.784 7 A_G32:C16_A A 32 ? A 16 ? 19 1 1 A C 33 1_555 A G 15 1_555 0.172 -0.238 -0.504 -7.511 0.569 -2.427 8 A_C33:G15_A A 33 ? A 15 ? 19 1 1 A U 34 1_555 A A 14 1_555 -0.028 -0.089 -0.079 1.763 -6.607 0.793 9 A_U34:A14_A A 34 ? A 14 ? 20 1 1 A G 35 1_555 A C 13 1_555 -0.192 -0.135 -0.135 -2.076 2.577 0.914 10 A_G35:C13_A A 35 ? A 13 ? 19 1 1 A G 36 1_555 A C 12 1_555 -0.185 -0.207 -0.729 1.545 -2.983 2.168 11 A_G36:C12_A A 36 ? A 12 ? 19 1 1 A C 37 1_555 A G 11 1_555 0.200 -0.199 -0.757 3.216 -4.065 1.563 12 A_C37:G11_A A 37 ? A 11 ? 19 1 1 A C 38 1_555 A G 9 1_555 0.191 -0.138 -0.406 2.749 -2.107 0.637 13 A_C38:G9_A A 38 ? A 9 ? 19 1 1 A G 39 1_555 A C 66 1_555 -0.216 -0.132 0.029 -6.338 -9.794 -1.011 14 A_G39:C66_A A 39 ? A 66 ? 19 1 1 A G 40 1_555 A C 65 1_555 -0.190 -0.332 -1.244 -7.893 -6.216 2.154 15 A_G40:C65_A A 40 ? A 65 ? 19 1 1 A C 41 1_555 A G 64 1_555 0.174 -0.389 -1.215 -5.069 -3.515 2.501 16 A_C41:G64_A A 41 ? A 64 ? 19 1 1 A A 42 1_555 A U 63 1_555 0.627 1.167 -0.547 -7.978 1.758 -26.617 17 A_A42:U63_A A 42 ? A 63 ? ? ? 1 A C 44 1_555 A G 62 1_555 0.176 -0.224 -0.554 -3.716 9.698 -2.555 18 A_C44:G62_A A 44 ? A 62 ? 19 1 1 A C 45 1_555 A G 61 1_555 0.215 -0.132 -0.220 0.142 1.280 0.159 19 A_C45:G61_A A 45 ? A 61 ? 19 1 1 A C 46 1_555 A G 60 1_555 0.211 -0.132 -0.186 -0.621 -9.650 1.214 20 A_C46:G60_A A 46 ? A 60 ? 19 1 1 A U 47 1_555 A G 59 1_555 0.926 0.360 0.754 -3.218 -14.166 -3.340 21 A_U47:G59_A A 47 ? A 59 ? ? ? 1 A G 111 1_555 A U 58 1_555 -4.370 -1.464 1.054 -3.107 5.630 21.874 22 A_G111:U58_A A 111 ? A 58 ? 28 1 1 A C 48 1_555 A G 57 1_555 0.093 -0.380 -1.373 -3.229 2.124 -2.632 23 A_C48:G57_A A 48 ? A 57 ? 19 1 1 A C 49 1_555 A G 56 1_555 -0.011 -0.401 -1.461 12.992 3.090 -7.465 24 A_C49:G56_A A 49 ? A 56 ? 19 1 1 A G 113 1_555 A C 55 1_555 -0.160 -0.171 -0.564 -6.490 3.407 -0.574 25 A_G113:C55_A A 113 ? A 55 ? 19 1 1 A C 114 1_555 A G 54 1_555 0.191 -0.158 -0.368 2.338 0.121 0.507 26 A_C114:G54_A A 114 ? A 54 ? 19 1 1 A G 115 1_555 A C 53 1_555 -0.162 -0.160 -0.210 5.080 4.674 -1.605 27 A_G115:C53_A A 115 ? A 53 ? 19 1 1 A G 116 1_555 A C 52 1_555 -0.125 -0.403 -1.064 14.057 7.512 -5.714 28 A_G116:C52_A A 116 ? A 52 ? 19 1 1 A U 118 1_555 A A 51 1_555 0.085 -0.188 -0.076 6.049 -3.359 8.684 29 A_U118:A51_A A 118 ? A 51 ? 20 1 1 A A 21 1_555 A U 30 1_555 0.081 -0.341 -1.343 -6.183 -7.497 -0.330 30 A_A21:U30_A A 21 ? A 30 ? 20 1 1 A G 22 1_555 A C 29 1_555 -0.149 -0.417 -1.343 -7.351 -3.876 -0.069 31 A_G22:C29_A A 22 ? A 29 ? 19 1 1 A C 67 1_555 A G 28 1_555 0.145 -0.358 -1.197 -2.523 1.152 -0.487 32 A_C67:G28_A A 67 ? A 28 ? 19 1 1 A C 68 1_555 A G 27 1_555 0.195 -0.168 -0.343 2.446 -2.810 -0.453 33 A_C68:G27_A A 68 ? A 27 ? 19 1 1 A G 69 1_555 A C 26 1_555 -0.179 -0.173 -0.312 -0.628 -0.708 -0.715 34 A_G69:C26_A A 69 ? A 26 ? 19 1 1 A G 70 1_555 A C 25 1_555 -0.120 -0.394 -1.116 5.559 4.780 -3.648 35 A_G70:C25_A A 70 ? A 25 ? 19 1 1 A G 71 1_555 A C 24 1_555 -0.151 -0.356 -1.069 7.463 0.645 -0.333 36 A_G71:C24_A A 71 ? A 24 ? 19 1 1 A G 81 1_555 A A 109 1_555 -0.942 1.039 -1.006 2.375 -1.209 -15.238 37 A_G81:A109_A A 81 ? A 109 ? 8 1 1 A G 82 1_555 A C 108 1_555 -0.151 -0.139 0.032 -2.331 4.894 -1.278 38 A_G82:C108_A A 82 ? A 108 ? 19 1 1 A U 83 1_555 A G 107 1_555 1.763 -0.412 0.055 3.286 3.494 -1.334 39 A_U83:G107_A A 83 ? A 107 ? 28 1 1 A U 84 1_555 A G 106 1_555 1.612 -0.337 0.446 -0.042 -3.483 -1.049 40 A_U84:G106_A A 84 ? A 106 ? 28 1 1 A G 85 1_555 A C 105 1_555 -0.208 -0.190 -0.562 -1.460 -1.208 -0.998 41 A_G85:C105_A A 85 ? A 105 ? 19 1 1 A A 86 1_555 A G 104 1_555 -0.615 1.302 -0.685 2.042 -1.435 -13.719 42 A_A86:G104_A A 86 ? A 104 ? 8 1 1 A G 87 1_555 A C 103 1_555 -0.135 -0.139 -0.302 -2.421 3.083 -1.120 43 A_G87:C103_A A 87 ? A 103 ? 19 1 1 A U 88 1_555 A A 102 1_555 -0.036 -0.081 0.167 1.634 1.205 0.693 44 A_U88:A102_A A 88 ? A 102 ? 20 1 1 A A 89 1_555 A U 101 1_555 0.094 -0.085 -0.455 -7.065 2.692 -0.355 45 A_A89:U101_A A 89 ? A 101 ? 20 1 1 A G 90 1_555 A C 100 1_555 -0.187 -0.161 -0.597 -2.792 -1.892 1.029 46 A_G90:C100_A A 90 ? A 100 ? 19 1 1 A C 91 1_555 A G 99 1_555 0.200 -0.152 -0.426 2.123 -1.626 0.861 47 A_C91:G99_A A 91 ? A 99 ? 19 1 1 A C 92 1_555 A G 98 1_555 0.095 -0.155 -0.497 6.897 8.970 -3.193 48 A_C92:G98_A A 92 ? A 98 ? 19 1 1 A U 94 1_555 A C 97 1_555 4.807 -2.455 0.899 21.529 -11.624 -76.305 49 A_U94:C97_A A 94 ? A 97 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 79 1_555 A G 2 1_555 A C 78 1_555 -0.470 -1.099 3.504 -3.687 4.761 31.188 -2.930 0.146 3.337 8.753 6.779 31.750 1 AA_G1G2:C78C79_AA A 1 ? A 79 ? A 2 ? A 78 ? 1 A G 2 1_555 A C 78 1_555 A U 3 1_555 A A 77 1_555 0.769 -2.020 3.029 0.246 8.869 34.670 -4.381 -1.223 2.459 14.590 -0.404 35.754 2 AA_G2U3:A77C78_AA A 2 ? A 78 ? A 3 ? A 77 ? 1 A U 3 1_555 A A 77 1_555 A C 4 1_555 A G 76 1_555 1.449 -2.065 3.622 5.754 7.069 34.432 -4.494 -1.464 3.338 11.690 -9.515 35.583 3 AA_U3C4:G76A77_AA A 3 ? A 77 ? A 4 ? A 76 ? 1 A C 4 1_555 A G 76 1_555 A C 23 1_555 A G 73 1_555 1.000 5.707 1.411 51.587 -44.805 105.546 3.415 -0.441 0.126 -26.520 -30.534 119.924 4 AA_C4C23:G73G76_AA A 4 ? A 76 ? A 23 ? A 73 ? 1 A U 31 1_555 A G 17 1_555 A G 32 1_555 A C 16 1_555 2.502 -0.385 4.377 -7.958 -3.943 33.225 0.124 -5.802 3.717 -6.746 13.618 34.359 5 AA_U31G32:C16G17_AA A 31 ? A 17 ? A 32 ? A 16 ? 1 A G 32 1_555 A C 16 1_555 A C 33 1_555 A G 15 1_555 -1.158 -1.159 2.899 -4.438 1.176 37.498 -1.927 1.273 2.975 1.821 6.872 37.768 6 AA_G32C33:G15C16_AA A 32 ? A 16 ? A 33 ? A 15 ? 1 A C 33 1_555 A G 15 1_555 A U 34 1_555 A A 14 1_555 1.245 -1.331 2.827 -1.448 7.499 34.706 -3.076 -2.213 2.444 12.386 2.392 35.511 7 AA_C33U34:A14G15_AA A 33 ? A 15 ? A 34 ? A 14 ? 1 A U 34 1_555 A A 14 1_555 A G 35 1_555 A C 13 1_555 -0.219 -1.481 2.958 -0.965 27.607 35.251 -3.911 0.221 1.480 39.049 1.365 44.513 8 AA_U34G35:C13A14_AA A 34 ? A 14 ? A 35 ? A 13 ? 1 A G 35 1_555 A C 13 1_555 A G 36 1_555 A C 12 1_555 0.677 -1.760 3.140 3.872 10.005 30.834 -4.688 -0.605 2.525 18.142 -7.021 32.604 9 AA_G35G36:C12C13_AA A 35 ? A 13 ? A 36 ? A 12 ? 1 A G 36 1_555 A C 12 1_555 A C 37 1_555 A G 11 1_555 0.325 -1.814 3.247 1.348 0.177 35.751 -2.978 -0.336 3.248 0.289 -2.195 35.776 10 AA_G36C37:G11C12_AA A 36 ? A 12 ? A 37 ? A 11 ? 1 A C 37 1_555 A G 11 1_555 A C 38 1_555 A G 9 1_555 -0.534 -1.981 3.296 -0.092 12.057 28.012 -5.913 1.001 2.271 23.574 0.180 30.449 11 AA_C37C38:G9G11_AA A 37 ? A 11 ? A 38 ? A 9 ? 1 A C 38 1_555 A G 9 1_555 A G 39 1_555 A C 66 1_555 0.576 -1.552 3.059 -1.319 31.861 36.626 -3.846 -0.786 1.348 42.242 1.748 48.200 12 AA_C38G39:C66G9_AA A 38 ? A 9 ? A 39 ? A 66 ? 1 A G 39 1_555 A C 66 1_555 A G 40 1_555 A C 65 1_555 -0.466 -1.316 4.013 -2.158 -1.016 32.709 -2.115 0.366 4.073 -1.801 3.826 32.793 13 AA_G39G40:C65C66_AA A 39 ? A 66 ? A 40 ? A 65 ? 1 A G 40 1_555 A C 65 1_555 A C 41 1_555 A G 64 1_555 0.119 -1.560 3.536 -4.683 -1.351 32.367 -2.515 -1.091 3.545 -2.406 8.341 32.722 14 AA_G40C41:G64C65_AA A 40 ? A 65 ? A 41 ? A 64 ? 1 A C 41 1_555 A G 64 1_555 A A 42 1_555 A U 63 1_555 -1.935 -1.008 3.708 -0.010 16.187 31.064 -4.290 3.222 2.853 27.972 0.017 34.936 15 AA_C41A42:U63G64_AA A 41 ? A 64 ? A 42 ? A 63 ? 1 A A 42 1_555 A U 63 1_555 A C 44 1_555 A G 62 1_555 -1.485 -2.673 2.973 -4.593 2.336 49.996 -3.300 1.449 2.970 2.755 5.418 50.244 16 AA_A42C44:G62U63_AA A 42 ? A 63 ? A 44 ? A 62 ? 1 A C 44 1_555 A G 62 1_555 A C 45 1_555 A G 61 1_555 -0.613 -2.321 3.080 -1.157 12.693 26.358 -6.774 1.017 1.817 25.991 2.369 29.229 17 AA_C44C45:G61G62_AA A 44 ? A 62 ? A 45 ? A 61 ? 1 A C 45 1_555 A G 61 1_555 A C 46 1_555 A G 60 1_555 0.422 -1.722 3.129 2.901 8.934 32.140 -4.311 -0.306 2.598 15.723 -5.106 33.449 18 AA_C45C46:G60G61_AA A 45 ? A 61 ? A 46 ? A 60 ? 1 A C 46 1_555 A G 60 1_555 A U 47 1_555 A G 59 1_555 0.278 -1.607 3.344 -1.392 -0.577 37.279 -2.434 -0.624 3.355 -0.902 2.177 37.308 19 AA_C46U47:G59G60_AA A 46 ? A 60 ? A 47 ? A 59 ? 1 A U 47 1_555 A G 59 1_555 A G 111 1_555 A U 58 1_555 -0.741 -3.550 2.582 -8.797 7.086 18.478 -11.294 -0.304 1.355 19.842 24.633 21.632 20 AA_U47G111:U58G59_AA A 47 ? A 59 ? A 111 ? A 58 ? 1 A G 111 1_555 A U 58 1_555 A C 48 1_555 A G 57 1_555 0.256 0.916 3.881 2.943 -0.316 2.707 17.540 37.757 2.735 -5.077 -47.296 4.011 21 AA_G111C48:G57U58_AA A 111 ? A 58 ? A 48 ? A 57 ? 1 A C 48 1_555 A G 57 1_555 A C 49 1_555 A G 56 1_555 0.271 -0.420 3.224 -0.572 1.458 20.917 -1.759 -0.981 3.179 4.009 1.572 20.975 22 AA_C48C49:G56G57_AA A 48 ? A 57 ? A 49 ? A 56 ? 1 A C 49 1_555 A G 56 1_555 A G 113 1_555 A C 55 1_555 -4.472 -0.481 3.680 -18.596 3.893 42.181 -1.084 3.472 5.067 5.110 24.410 46.084 23 AA_C49G113:C55G56_AA A 49 ? A 56 ? A 113 ? A 55 ? 1 A G 113 1_555 A C 55 1_555 A C 114 1_555 A G 54 1_555 0.213 -1.763 3.099 -0.066 3.218 37.541 -3.116 -0.338 2.943 4.988 0.102 37.674 24 AA_G113C114:G54C55_AA A 113 ? A 55 ? A 114 ? A 54 ? 1 A C 114 1_555 A G 54 1_555 A G 115 1_555 A C 53 1_555 -0.280 -1.636 3.161 1.859 10.490 30.516 -4.590 0.795 2.458 19.209 -3.405 32.281 25 AA_C114G115:C53G54_AA A 114 ? A 54 ? A 115 ? A 53 ? 1 A G 115 1_555 A C 53 1_555 A G 116 1_555 A C 52 1_555 -0.806 -1.463 3.048 6.224 13.003 35.231 -3.639 1.904 2.222 20.457 -9.792 37.980 26 AA_G115G116:C52C53_AA A 115 ? A 53 ? A 116 ? A 52 ? 1 A G 116 1_555 A C 52 1_555 A U 118 1_555 A A 51 1_555 2.010 -1.497 7.066 13.425 1.773 35.053 -2.855 0.859 7.248 2.818 -21.331 37.501 27 AA_G116U118:A51C52_AA A 116 ? A 52 ? A 118 ? A 51 ? 1 A A 21 1_555 A U 30 1_555 A G 22 1_555 A C 29 1_555 -0.739 -0.644 4.090 -0.979 -1.074 25.907 -1.061 1.305 4.138 -2.394 2.182 25.947 28 AA_A21G22:C29U30_AA A 21 ? A 30 ? A 22 ? A 29 ? 1 A G 22 1_555 A C 29 1_555 A C 67 1_555 A G 28 1_555 -2.501 -0.211 3.212 -6.450 0.118 53.297 -0.241 2.357 3.470 0.130 7.160 53.657 29 AA_G22C67:G28C29_AA A 22 ? A 29 ? A 67 ? A 28 ? 1 A C 67 1_555 A G 28 1_555 A C 68 1_555 A G 27 1_555 0.323 -1.629 3.534 0.674 2.383 28.867 -3.815 -0.487 3.397 4.769 -1.348 28.970 30 AA_C67C68:G27G28_AA A 67 ? A 28 ? A 68 ? A 27 ? 1 A C 68 1_555 A G 27 1_555 A G 69 1_555 A C 26 1_555 -1.005 -1.110 3.178 -4.354 40.947 36.770 -3.371 0.864 1.458 49.703 5.285 54.668 31 AA_C68G69:C26G27_AA A 68 ? A 27 ? A 69 ? A 26 ? 1 A G 69 1_555 A C 26 1_555 A G 70 1_555 A C 25 1_555 -0.450 -1.397 3.253 3.063 8.168 34.053 -3.465 1.178 2.804 13.670 -5.126 35.121 32 AA_G69G70:C25C26_AA A 69 ? A 26 ? A 70 ? A 25 ? 1 A G 70 1_555 A C 25 1_555 A G 71 1_555 A C 24 1_555 1.699 -1.256 4.221 3.177 0.821 19.695 -4.131 -2.933 4.381 2.380 -9.204 19.964 33 AA_G70G71:C24C25_AA A 70 ? A 25 ? A 71 ? A 24 ? 1 A G 81 1_555 A A 109 1_555 A G 82 1_555 A C 108 1_555 -0.290 -1.804 3.420 -7.148 6.337 35.591 -3.726 -0.520 3.064 10.144 11.441 36.811 34 AA_G81G82:C108A109_AA A 81 ? A 109 ? A 82 ? A 108 ? 1 A G 82 1_555 A C 108 1_555 A U 83 1_555 A G 107 1_555 1.406 -1.345 3.156 1.941 3.844 43.690 -2.149 -1.705 3.089 5.151 -2.601 43.891 35 AA_G82U83:G107C108_AA A 82 ? A 108 ? A 83 ? A 107 ? 1 A U 83 1_555 A G 107 1_555 A U 84 1_555 A G 106 1_555 0.039 -2.318 3.117 2.394 14.776 28.163 -6.352 0.273 1.714 28.002 -4.537 31.823 36 AA_U83U84:G106G107_AA A 83 ? A 107 ? A 84 ? A 106 ? 1 A U 84 1_555 A G 106 1_555 A G 85 1_555 A C 105 1_555 -1.033 -1.571 2.865 4.953 17.971 32.565 -4.202 2.094 1.638 29.253 -8.062 37.397 37 AA_U84G85:C105G106_AA A 84 ? A 106 ? A 85 ? A 105 ? 1 A G 85 1_555 A C 105 1_555 A A 86 1_555 A G 104 1_555 0.009 -1.741 3.282 1.800 1.859 27.226 -4.137 0.422 3.152 3.937 -3.812 27.347 38 AA_G85A86:G104C105_AA A 85 ? A 105 ? A 86 ? A 104 ? 1 A A 86 1_555 A G 104 1_555 A G 87 1_555 A C 103 1_555 0.110 -1.758 3.467 -5.937 6.063 29.380 -4.544 -1.392 2.975 11.652 11.408 30.555 39 AA_A86G87:C103G104_AA A 86 ? A 104 ? A 87 ? A 103 ? 1 A G 87 1_555 A C 103 1_555 A U 88 1_555 A A 102 1_555 0.545 -1.749 3.222 -1.651 2.705 34.125 -3.376 -1.174 3.050 4.597 2.805 34.267 40 AA_G87U88:A102C103_AA A 87 ? A 103 ? A 88 ? A 102 ? 1 A U 88 1_555 A A 102 1_555 A A 89 1_555 A U 101 1_555 -0.320 -1.659 3.307 4.271 22.583 32.617 -4.710 0.900 1.783 35.278 -6.672 39.721 41 AA_U88A89:U101A102_AA A 88 ? A 102 ? A 89 ? A 101 ? 1 A A 89 1_555 A U 101 1_555 A G 90 1_555 A C 100 1_555 0.419 -1.571 3.218 -1.337 9.271 28.678 -4.740 -1.053 2.574 18.117 2.612 30.138 42 AA_A89G90:C100U101_AA A 89 ? A 101 ? A 90 ? A 100 ? 1 A G 90 1_555 A C 100 1_555 A C 91 1_555 A G 99 1_555 -0.066 -1.672 3.182 -1.521 1.625 33.632 -3.138 -0.123 3.101 2.804 2.624 33.703 43 AA_G90C91:G99C100_AA A 90 ? A 100 ? A 91 ? A 99 ? 1 A C 91 1_555 A G 99 1_555 A C 92 1_555 A G 98 1_555 -0.898 -1.629 2.916 -0.752 19.684 37.232 -3.876 1.192 1.879 28.519 1.090 41.958 44 AA_C91C92:G98G99_AA A 91 ? A 99 ? A 92 ? A 98 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Institutes of Health/National Human Genome Research Institute (NIH/NHGRI)' 'United States' P41GM103832 1 'National Institutes of Health/National Human Genome Research Institute (NIH/NHGRI)' 'United States' R01GM079429 2 'National Institutes of Health/National Human Genome Research Institute (NIH/NHGRI)' 'United States' S10OD021600 3 # _atom_sites.entry_id 6UES _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_