data_6VMY # _entry.id 6VMY # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.416 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 6VMY pdb_00006vmy 10.2210/pdb6vmy/pdb WWPDB D_1000246516 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date _pdbx_audit_revision_history.part_number 1 'Structure model' 1 0 2020-06-10 ? 2 'Structure model' 1 1 2020-07-01 ? 3 'Structure model' 1 2 2020-07-29 ? 4 'Structure model' 1 3 2024-03-06 ? 5 'Structure model' 2 0 2026-08-12 ? # loop_ _pdbx_audit_revision_details.ordinal _pdbx_audit_revision_details.revision_ordinal _pdbx_audit_revision_details.data_content_type _pdbx_audit_revision_details.provider _pdbx_audit_revision_details.type _pdbx_audit_revision_details.description _pdbx_audit_revision_details.details 1 1 'Structure model' repository 'Initial release' ? ? 2 5 'Structure model' repository Remediation 'Metalloprotein remediation' ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' 3 3 'Structure model' 'Derived calculations' 4 4 'Structure model' 'Data collection' 5 4 'Structure model' 'Database references' 6 5 'Structure model' 'Derived calculations' 7 5 'Structure model' 'Non-polymer description' 8 5 'Structure model' 'Structure summary' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' citation 4 3 'Structure model' pdbx_struct_conn_angle 5 3 'Structure model' struct_conn 6 4 'Structure model' chem_comp_atom 7 4 'Structure model' chem_comp_bond 8 4 'Structure model' database_2 9 5 'Structure model' chem_comp 10 5 'Structure model' pdbx_entry_details 11 5 'Structure model' pdbx_nonpoly_atom_coordination 12 5 'Structure model' pdbx_nonpoly_atom_coordination_sphere 13 5 'Structure model' pdbx_nonpoly_atom_coordination_sphere_order # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_ASTM' 4 2 'Structure model' '_citation.journal_id_CSD' 5 2 'Structure model' '_citation.journal_id_ISSN' 6 2 'Structure model' '_citation.pdbx_database_id_DOI' 7 2 'Structure model' '_citation.pdbx_database_id_PubMed' 8 2 'Structure model' '_citation.title' 9 2 'Structure model' '_citation.year' 10 2 'Structure model' '_citation_author.identifier_ORCID' 11 3 'Structure model' '_citation.journal_volume' 12 3 'Structure model' '_citation.page_first' 13 3 'Structure model' '_citation.page_last' 14 3 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_seq_id' 15 3 'Structure model' '_pdbx_struct_conn_angle.ptnr1_symmetry' 16 3 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_seq_id' 17 3 'Structure model' '_pdbx_struct_conn_angle.ptnr3_symmetry' 18 3 'Structure model' '_pdbx_struct_conn_angle.value' 19 3 'Structure model' '_struct_conn.pdbx_dist_value' 20 3 'Structure model' '_struct_conn.ptnr1_auth_seq_id' 21 3 'Structure model' '_struct_conn.ptnr1_label_asym_id' 22 3 'Structure model' '_struct_conn.ptnr2_auth_seq_id' 23 3 'Structure model' '_struct_conn.ptnr2_symmetry' 24 4 'Structure model' '_database_2.pdbx_DOI' 25 4 'Structure model' '_database_2.pdbx_database_accession' 26 5 'Structure model' '_chem_comp.formula' 27 5 'Structure model' '_pdbx_entry_details.has_protein_modification' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 6VMY _pdbx_database_status.recvd_initial_deposition_date 2020-01-28 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Chan, C.W.' 1 0000-0001-5472-4803 'Mondragon, A.' 2 0000-0002-0423-6323 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 48 _citation.language ? _citation.page_first 7569 _citation.page_last 7583 _citation.title 'Crystal structure of an atypical cobalamin riboswitch reveals RNA structural adaptability as basis for promiscuous ligand binding.' _citation.year 2020 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkaa507 _citation.pdbx_database_id_PubMed 32544228 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Chan, C.W.' 1 ? primary 'Mondragon, A.' 2 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'B. subtilis cobalamin riboswitch' 48052.559 1 ? ? ? ? 2 non-polymer syn 'MAGNESIUM ION' 24.305 12 ? ? ? ? 3 non-polymer syn 'COBALT HEXAMMINE(III)' 161.116 7 ? ? ? ? 4 non-polymer syn Adenosylcobalamin 1580.590 1 ? ? ? ? 5 water nat water 18.015 48 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code ;(GTP)GUCAAAUAGGUGCCGGUCCGUGAACAACAGCCGGCUUAAAAGGGAAACCGGUAAAAGCCGGUGCGGUCCCGCCAC UGUAAUUGGCCAAGCGCCAAGAGCCAGGAUACCUGCCUGUUUGAUCAGCACGAAUUCUGCGAGGACAGAUGA ; _entity_poly.pdbx_seq_one_letter_code_can ;GGUCAAAUAGGUGCCGGUCCGUGAACAACAGCCGGCUUAAAAGGGAAACCGGUAAAAGCCGGUGCGGUCCCGCCACUGUA AUUGGCCAAGCGCCAAGAGCCAGGAUACCUGCCUGUUUGAUCAGCACGAAUUCUGCGAGGACAGAUGA ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'MAGNESIUM ION' MG 3 'COBALT HEXAMMINE(III)' NCO 4 Adenosylcobalamin B1Z 5 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 U n 1 4 C n 1 5 A n 1 6 A n 1 7 A n 1 8 U n 1 9 A n 1 10 G n 1 11 G n 1 12 U n 1 13 G n 1 14 C n 1 15 C n 1 16 G n 1 17 G n 1 18 U n 1 19 C n 1 20 C n 1 21 G n 1 22 U n 1 23 G n 1 24 A n 1 25 A n 1 26 C n 1 27 A n 1 28 A n 1 29 C n 1 30 A n 1 31 G n 1 32 C n 1 33 C n 1 34 G n 1 35 G n 1 36 C n 1 37 U n 1 38 U n 1 39 A n 1 40 A n 1 41 A n 1 42 A n 1 43 G n 1 44 G n 1 45 G n 1 46 A n 1 47 A n 1 48 A n 1 49 C n 1 50 C n 1 51 G n 1 52 G n 1 53 U n 1 54 A n 1 55 A n 1 56 A n 1 57 A n 1 58 G n 1 59 C n 1 60 C n 1 61 G n 1 62 G n 1 63 U n 1 64 G n 1 65 C n 1 66 G n 1 67 G n 1 68 U n 1 69 C n 1 70 C n 1 71 C n 1 72 G n 1 73 C n 1 74 C n 1 75 A n 1 76 C n 1 77 U n 1 78 G n 1 79 U n 1 80 A n 1 81 A n 1 82 U n 1 83 U n 1 84 G n 1 85 G n 1 86 C n 1 87 C n 1 88 A n 1 89 A n 1 90 G n 1 91 C n 1 92 G n 1 93 C n 1 94 C n 1 95 A n 1 96 A n 1 97 G n 1 98 A n 1 99 G n 1 100 C n 1 101 C n 1 102 A n 1 103 G n 1 104 G n 1 105 A n 1 106 U n 1 107 A n 1 108 C n 1 109 C n 1 110 U n 1 111 G n 1 112 C n 1 113 C n 1 114 U n 1 115 G n 1 116 U n 1 117 U n 1 118 U n 1 119 G n 1 120 A n 1 121 U n 1 122 C n 1 123 A n 1 124 G n 1 125 C n 1 126 A n 1 127 C n 1 128 G n 1 129 A n 1 130 A n 1 131 U n 1 132 U n 1 133 C n 1 134 U n 1 135 G n 1 136 C n 1 137 G n 1 138 A n 1 139 G n 1 140 G n 1 141 A n 1 142 C n 1 143 A n 1 144 G n 1 145 A n 1 146 U n 1 147 G n 1 148 A n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 148 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Bacillus subtilis' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 1423 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'Escherichia coli K-12' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 83333 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details 'RNA was produced by in vitro transcription using T7 RNA polymerase. The recombinant T7 polymerase was purified from E. coli.' _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 B1Z non-polymer . Adenosylcobalamin Cobamamide 'C72 H101 Co N18 O17 P' 1580.590 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 NCO non-polymer . 'COBALT HEXAMMINE(III)' ? 'Co H18 N6' 161.116 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 202 201 GTP 3PO A . n A 1 2 G 2 203 1 G G A . n A 1 3 U 3 204 2 U U A . n A 1 4 C 4 205 3 C C A . n A 1 5 A 5 206 4 A A A . n A 1 6 A 6 207 5 A A A . n A 1 7 A 7 208 6 A A A . n A 1 8 U 8 209 7 U U A . n A 1 9 A 9 210 8 A A A . n A 1 10 G 10 211 9 G G A . n A 1 11 G 11 212 10 G G A . n A 1 12 U 12 213 11 U U A . n A 1 13 G 13 214 12 G G A . n A 1 14 C 14 215 13 C C A . n A 1 15 C 15 216 14 C C A . n A 1 16 G 16 217 15 G G A . n A 1 17 G 17 218 16 G G A . n A 1 18 U 18 219 17 U U A . n A 1 19 C 19 220 18 C C A . n A 1 20 C 20 221 19 C C A . n A 1 21 G 21 222 20 G G A . n A 1 22 U 22 223 21 U U A . n A 1 23 G 23 224 22 G G A . n A 1 24 A 24 225 23 A A A . n A 1 25 A 25 226 24 A A A . n A 1 26 C 26 227 25 C C A . n A 1 27 A 27 228 26 A A A . n A 1 28 A 28 229 27 A A A . n A 1 29 C 29 230 28 C C A . n A 1 30 A 30 231 29 A A A . n A 1 31 G 31 232 30 G G A . n A 1 32 C 32 233 31 C C A . n A 1 33 C 33 234 32 C C A . n A 1 34 G 34 235 33 G G A . n A 1 35 G 35 236 34 G G A . n A 1 36 C 36 237 35 C C A . n A 1 37 U 37 238 36 U U A . n A 1 38 U 38 239 37 U U A . n A 1 39 A 39 240 38 A A A . n A 1 40 A 40 241 39 A A A . n A 1 41 A 41 242 40 A A A . n A 1 42 A 42 243 41 A A A . n A 1 43 G 43 244 42 G G A . n A 1 44 G 44 245 43 G G A . n A 1 45 G 45 246 44 G G A . n A 1 46 A 46 247 45 A A A . n A 1 47 A 47 248 46 A A A . n A 1 48 A 48 249 47 A A A . n A 1 49 C 49 250 48 C C A . n A 1 50 C 50 251 49 C C A . n A 1 51 G 51 252 50 G G A . n A 1 52 G 52 253 51 G G A . n A 1 53 U 53 254 52 U U A . n A 1 54 A 54 255 53 A A A . n A 1 55 A 55 256 54 A A A . n A 1 56 A 56 257 55 A A A . n A 1 57 A 57 258 56 A A A . n A 1 58 G 58 259 57 G G A . n A 1 59 C 59 260 58 C C A . n A 1 60 C 60 261 59 C C A . n A 1 61 G 61 262 60 G G A . n A 1 62 G 62 263 61 G G A . n A 1 63 U 63 264 62 U U A . n A 1 64 G 64 265 63 G G A . n A 1 65 C 65 266 64 C C A . n A 1 66 G 66 267 65 G G A . n A 1 67 G 67 268 66 G G A . n A 1 68 U 68 269 67 U U A . n A 1 69 C 69 270 68 C C A . n A 1 70 C 70 271 69 C C A . n A 1 71 C 71 272 70 C C A . n A 1 72 G 72 273 71 G G A . n A 1 73 C 73 274 72 C C A . n A 1 74 C 74 275 73 C C A . n A 1 75 A 75 276 74 A A A . n A 1 76 C 76 277 75 C C A . n A 1 77 U 77 278 76 U U A . n A 1 78 G 78 279 77 G G A . n A 1 79 U 79 280 78 U U A . n A 1 80 A 80 281 79 A A A . n A 1 81 A 81 282 80 A A A . n A 1 82 U 82 283 81 U U A . n A 1 83 U 83 284 82 U U A . n A 1 84 G 84 285 83 G G A . n A 1 85 G 85 286 84 G G A . n A 1 86 C 86 287 85 C C A . n A 1 87 C 87 288 86 C C A . n A 1 88 A 88 289 87 A A A . n A 1 89 A 89 290 88 A A A . n A 1 90 G 90 291 89 G G A . n A 1 91 C 91 292 90 C C A . n A 1 92 G 92 293 91 G G A . n A 1 93 C 93 294 92 C C A . n A 1 94 C 94 295 93 C C A . n A 1 95 A 95 296 94 A A A . n A 1 96 A 96 297 95 A A A . n A 1 97 G 97 298 96 G G A . n A 1 98 A 98 299 97 A A A . n A 1 99 G 99 300 98 G G A . n A 1 100 C 100 301 99 C C A . n A 1 101 C 101 302 100 C C A . n A 1 102 A 102 303 101 A A A . n A 1 103 G 103 304 102 G G A . n A 1 104 G 104 305 103 G G A . n A 1 105 A 105 306 104 A A A . n A 1 106 U 106 307 105 U U A . n A 1 107 A 107 308 106 A A A . n A 1 108 C 108 309 107 C C A . n A 1 109 C 109 310 108 C C A . n A 1 110 U 110 311 109 U U A . n A 1 111 G 111 312 110 G G A . n A 1 112 C 112 313 111 C C A . n A 1 113 C 113 314 112 C C A . n A 1 114 U 114 315 113 U U A . n A 1 115 G 115 316 114 G G A . n A 1 116 U 116 317 115 U U A . n A 1 117 U 117 318 116 U U A . n A 1 118 U 118 319 117 U U A . n A 1 119 G 119 320 118 G G A . n A 1 120 A 120 321 119 A A A . n A 1 121 U 121 322 120 U U A . n A 1 122 C 122 323 121 C C A . n A 1 123 A 123 324 122 A A A . n A 1 124 G 124 325 123 G G A . n A 1 125 C 125 326 124 C C A . n A 1 126 A 126 327 125 A A A . n A 1 127 C 127 328 126 C C A . n A 1 128 G 128 329 127 G G A . n A 1 129 A 129 330 128 A A A . n A 1 130 A 130 331 129 A A A . n A 1 131 U 131 332 130 U U A . n A 1 132 U 132 333 131 U U A . n A 1 133 C 133 334 132 C C A . n A 1 134 U 134 335 133 U U A . n A 1 135 G 135 336 134 G G A . n A 1 136 C 136 337 135 C C A . n A 1 137 G 137 338 136 G G A . n A 1 138 A 138 339 137 A A A . n A 1 139 G 139 340 138 G G A . n A 1 140 G 140 341 139 G G A . n A 1 141 A 141 342 140 A A A . n A 1 142 C 142 343 141 C C A . n A 1 143 A 143 344 142 A A A . n A 1 144 G 144 345 143 G G A . n A 1 145 A 145 346 144 A A A . n A 1 146 U 146 347 145 U U A . n A 1 147 G 147 348 146 G G A . n A 1 148 A 148 349 147 A A A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 MG 1 401 202 MG MG A . C 2 MG 1 402 203 MG MG A . D 2 MG 1 403 204 MG MG A . E 2 MG 1 404 205 MG MG A . F 3 NCO 1 405 206 NCO NCO A . G 3 NCO 1 406 207 NCO NCO A . H 3 NCO 1 407 208 NCO NCO A . I 3 NCO 1 408 209 NCO NCO A . J 3 NCO 1 409 210 NCO NCO A . K 3 NCO 1 410 211 NCO NCO A . L 3 NCO 1 411 212 NCO NCO A . M 4 B1Z 1 412 213 B1Z B1Z A . N 2 MG 1 413 215 MG MG A . O 2 MG 1 414 216 MG MG A . P 2 MG 1 415 217 MG MG A . Q 2 MG 1 416 218 MG MG A . R 2 MG 1 417 219 MG MG A . S 2 MG 1 418 220 MG MG A . T 2 MG 1 419 221 MG MG A . U 2 MG 1 420 222 MG MG A . V 5 HOH 1 501 301 HOH HOH A . V 5 HOH 2 502 302 HOH HOH A . V 5 HOH 3 503 303 HOH HOH A . V 5 HOH 4 504 304 HOH HOH A . V 5 HOH 5 505 305 HOH HOH A . V 5 HOH 6 506 306 HOH HOH A . V 5 HOH 7 507 307 HOH HOH A . V 5 HOH 8 508 308 HOH HOH A . V 5 HOH 9 509 309 HOH HOH A . V 5 HOH 10 510 310 HOH HOH A . V 5 HOH 11 511 311 HOH HOH A . V 5 HOH 12 512 312 HOH HOH A . V 5 HOH 13 513 313 HOH HOH A . V 5 HOH 14 514 314 HOH HOH A . V 5 HOH 15 515 315 HOH HOH A . V 5 HOH 16 516 316 HOH HOH A . V 5 HOH 17 517 317 HOH HOH A . V 5 HOH 18 518 318 HOH HOH A . V 5 HOH 19 519 319 HOH HOH A . V 5 HOH 20 520 320 HOH HOH A . V 5 HOH 21 521 321 HOH HOH A . V 5 HOH 22 522 322 HOH HOH A . V 5 HOH 23 523 323 HOH HOH A . V 5 HOH 24 524 324 HOH HOH A . V 5 HOH 25 525 325 HOH HOH A . V 5 HOH 26 526 326 HOH HOH A . V 5 HOH 27 527 327 HOH HOH A . V 5 HOH 28 528 328 HOH HOH A . V 5 HOH 29 529 329 HOH HOH A . V 5 HOH 30 530 330 HOH HOH A . V 5 HOH 31 531 331 HOH HOH A . V 5 HOH 32 532 332 HOH HOH A . V 5 HOH 33 533 333 HOH HOH A . V 5 HOH 34 534 334 HOH HOH A . V 5 HOH 35 535 335 HOH HOH A . V 5 HOH 36 536 336 HOH HOH A . V 5 HOH 37 537 337 HOH HOH A . V 5 HOH 38 538 338 HOH HOH A . V 5 HOH 39 539 339 HOH HOH A . V 5 HOH 40 540 340 HOH HOH A . V 5 HOH 41 541 341 HOH HOH A . V 5 HOH 42 542 342 HOH HOH A . V 5 HOH 43 543 343 HOH HOH A . V 5 HOH 44 544 344 HOH HOH A . V 5 HOH 45 545 345 HOH HOH A . V 5 HOH 46 546 346 HOH HOH A . V 5 HOH 47 547 347 HOH HOH A . V 5 HOH 48 548 348 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? REFMAC ? ? ? 5.8.0258 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? Aimless ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? SHARP ? ? ? . 4 ? 'model building' ? ? ? ? ? ? ? ? ? ? ? Coot ? ? ? . 5 # _cell.entry_id 6VMY _cell.length_a 118.282 _cell.length_b 118.282 _cell.length_c 261.547 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 120.00 _cell.Z_PDB 12 _cell.pdbx_unique_axis ? # _symmetry.entry_id 6VMY _symmetry.space_group_name_H-M 'P 65 2 2' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 179 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 6VMY _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 5.51 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 77.69 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 287 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;Purified RNA was incubated at room temperature for 30 minutes in 25 mM Tris-HCl, pH 8.0, 50 mM potassium chloride, 10 mM magnesium chloride, 0.5 mM adenosylcobalamin prior to crystallization in 50 mM sodium cacodylate, 15% (v/v) PEG 400, 0.2 mM cobalt hexamine, 80 mM magnesium acetate, 1 mM spermine between pH 6.0 to pH 6.5 at 14C by vapor diffusion in a hanging drop format ; _exptl_crystal_grow.pdbx_pH_range '6.0 - 6.5' # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details Mirrors _diffrn_detector.detector CCD _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'RAYONIX MX-225' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2013-06-03 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator 'Kohzu monochromator' _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97872 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 21-ID-F' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97872 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 21-ID-F _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 6VMY _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.253 _reflns.d_resolution_low 39.213 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 15338 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 92.8 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 47 _reflns.pdbx_Rmerge_I_obs 0.16 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 18.2 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.162 _reflns.pdbx_Rpim_I_all 0.025 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.996 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? # _reflns_shell.d_res_high 3.28 _reflns_shell.d_res_low 3.46 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 41046 _reflns_shell.percent_possible_all 43.8 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 4.129 _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 54 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all 4.168 _reflns_shell.pdbx_Rpim_I_all 0.561 _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.598 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? # _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.entry_id 6VMY _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.ls_number_reflns_obs 15338 _refine.ls_number_reflns_all ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 39.21 _refine.ls_d_res_high 3.25 _refine.ls_percent_reflns_obs 86.3 _refine.ls_R_factor_obs ? _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.263 _refine.ls_R_factor_R_free 0.279 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free 5.118 _refine.ls_number_reflns_R_free 785 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc 0.945 _refine.correlation_coeff_Fo_to_Fc_free 0.946 _refine.B_iso_mean 129.1 _refine.aniso_B[1][1] 0.69300 _refine.aniso_B[2][2] 0.69300 _refine.aniso_B[3][3] -2.24800 _refine.aniso_B[1][2] 0.34700 _refine.aniso_B[1][3] 0.00000 _refine.aniso_B[2][3] 0.00000 _refine.solvent_model_details ? _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_solvent_vdw_probe_radii 1.20 _refine.pdbx_solvent_ion_probe_radii 0.80 _refine.pdbx_solvent_shrinkage_radii 0.80 _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.details ;HYDROGENS HAVE BEEN ADDED IN THEIR RIDING POSITIONS ; _refine.pdbx_starting_model ? _refine.pdbx_method_to_determine_struct MIRAS _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_overall_ESU_R 1.731 _refine.pdbx_overall_ESU_R_Free 0.470 _refine.overall_SU_ML ? _refine.pdbx_overall_phase_error ? _refine.overall_SU_B ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 3174 _refine_hist.pdbx_number_atoms_ligand 179 _refine_hist.number_atoms_solvent 48 _refine_hist.number_atoms_total 3401 _refine_hist.d_res_high 3.25 _refine_hist.d_res_low 39.21 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function r_bond_refined_d 0.003 0.011 ? 3776 'X-RAY DIFFRACTION' ? r_bond_other_d 0.001 0.019 ? 1681 'X-RAY DIFFRACTION' ? r_angle_refined_deg 0.807 1.373 ? 5974 'X-RAY DIFFRACTION' ? r_angle_other_deg 2.165 3.000 ? 3993 'X-RAY DIFFRACTION' ? r_dihedral_angle_1_deg 8.013 5.073 ? 1374 'X-RAY DIFFRACTION' ? r_dihedral_angle_2_deg ? ? ? ? 'X-RAY DIFFRACTION' ? r_dihedral_angle_3_deg 1.736 5.000 ? 116 'X-RAY DIFFRACTION' ? r_dihedral_angle_4_deg ? ? ? ? 'X-RAY DIFFRACTION' ? r_chiral_restr 0.074 0.200 ? 611 'X-RAY DIFFRACTION' ? r_gen_planes_refined 0.033 0.034 ? 2509 'X-RAY DIFFRACTION' ? r_gen_planes_other 0.004 0.020 ? 832 'X-RAY DIFFRACTION' ? r_nbd_refined 0.148 0.200 ? 587 'X-RAY DIFFRACTION' ? r_nbd_other 0.220 0.200 ? 75 'X-RAY DIFFRACTION' ? r_nbtor_refined 0.253 0.200 ? 1257 'X-RAY DIFFRACTION' ? r_nbtor_other ? ? ? ? 'X-RAY DIFFRACTION' ? r_xyhbond_nbd_refined 0.208 0.200 ? 60 'X-RAY DIFFRACTION' ? r_xyhbond_nbd_other ? ? ? ? 'X-RAY DIFFRACTION' ? r_metal_ion_refined ? ? ? ? 'X-RAY DIFFRACTION' ? r_metal_ion_other ? ? ? ? 'X-RAY DIFFRACTION' ? r_symmetry_vdw_refined ? ? ? ? 'X-RAY DIFFRACTION' ? r_symmetry_vdw_other ? ? ? ? 'X-RAY DIFFRACTION' ? r_symmetry_hbond_refined ? ? ? ? 'X-RAY DIFFRACTION' ? r_symmetry_hbond_other ? ? ? ? 'X-RAY DIFFRACTION' ? r_symmetry_metal_ion_refined ? ? ? ? 'X-RAY DIFFRACTION' ? r_symmetry_metal_ion_other ? ? ? ? 'X-RAY DIFFRACTION' ? r_mcbond_it ? ? ? ? 'X-RAY DIFFRACTION' ? r_mcbond_other ? ? ? ? 'X-RAY DIFFRACTION' ? r_mcangle_it ? ? ? ? 'X-RAY DIFFRACTION' ? r_mcangle_other ? ? ? ? 'X-RAY DIFFRACTION' ? r_scbond_it 1.847 13.655 ? 3776 'X-RAY DIFFRACTION' ? r_scbond_other 1.847 13.655 ? 3771 'X-RAY DIFFRACTION' ? r_scangle_it 3.117 20.539 ? 5974 'X-RAY DIFFRACTION' ? r_scangle_other 3.118 20.539 ? 5965 'X-RAY DIFFRACTION' ? r_long_range_B_refined ? ? ? ? 'X-RAY DIFFRACTION' ? r_long_range_B_other ? ? ? ? 'X-RAY DIFFRACTION' ? r_rigid_bond_restr ? ? ? ? 'X-RAY DIFFRACTION' ? r_sphericity_free ? ? ? ? 'X-RAY DIFFRACTION' ? r_sphericity_bonded ? ? ? ? 'X-RAY DIFFRACTION' ? # _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.pdbx_total_number_of_bins_used ? _refine_ls_shell.d_res_high 3.25 _refine_ls_shell.d_res_low 3.34 _refine_ls_shell.number_reflns_R_work 124 _refine_ls_shell.R_factor_R_work 0.3760 _refine_ls_shell.percent_reflns_obs 9.99 _refine_ls_shell.R_factor_R_free 0.6120 _refine_ls_shell.R_factor_R_free_error ? _refine_ls_shell.percent_reflns_R_free ? _refine_ls_shell.number_reflns_R_free 4 _refine_ls_shell.number_reflns_all ? _refine_ls_shell.R_factor_all ? _refine_ls_shell.R_factor_obs ? _refine_ls_shell.number_reflns_obs ? # _struct.entry_id 6VMY _struct.title 'Structure of the B. subtilis cobalamin riboswitch' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 6VMY _struct_keywords.text 'RNA, riboswitch, cobalamin, gene regulation' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 2 ? E N N 2 ? F N N 3 ? G N N 3 ? H N N 3 ? I N N 3 ? J N N 3 ? K N N 3 ? L N N 3 ? M N N 4 ? N N N 2 ? O N N 2 ? P N N 2 ? Q N N 2 ? R N N 2 ? S N N 2 ? T N N 2 ? U N N 2 ? V N N 5 ? # _struct_ref.id 1 _struct_ref.db_name GB _struct_ref.db_code CP046047.1 _struct_ref.pdbx_db_accession CP046047.1 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ;GUCAAAUAGGUGCCGGUCCGUGAACAACAGCCGGCUUAAAAGGGAAACCGGUAAAAGCCGGUGCGGUCCCGCCACUGUAA UUGGCCAAGCGCCAAGAGCCAGGAUACCUGCCUGUUUGAUCAGCACGAAUUCUGCGAGGACAGAUGA ; _struct_ref.pdbx_align_begin 832641 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 6VMY _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 2 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 148 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession CP046047.1 _struct_ref_seq.db_align_beg 832641 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 832787 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 203 _struct_ref_seq.pdbx_auth_seq_align_end 349 # _struct_ref_seq_dif.align_id 1 _struct_ref_seq_dif.pdbx_pdb_id_code 6VMY _struct_ref_seq_dif.mon_id GTP _struct_ref_seq_dif.pdbx_pdb_strand_id A _struct_ref_seq_dif.seq_num 1 _struct_ref_seq_dif.pdbx_pdb_ins_code ? _struct_ref_seq_dif.pdbx_seq_db_name GB _struct_ref_seq_dif.pdbx_seq_db_accession_code CP046047.1 _struct_ref_seq_dif.db_mon_id ? _struct_ref_seq_dif.pdbx_seq_db_seq_num ? _struct_ref_seq_dif.details 'cloning artifact' _struct_ref_seq_dif.pdbx_auth_seq_num 202 _struct_ref_seq_dif.pdbx_ordinal 1 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J,K,L,M,N,O,P,Q,R,S,T,U,V # loop_ _pdbx_struct_assembly_auth_evidence.id _pdbx_struct_assembly_auth_evidence.assembly_id _pdbx_struct_assembly_auth_evidence.experimental_support _pdbx_struct_assembly_auth_evidence.details 1 1 'gel filtration' ? 2 1 'light scattering' ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? A GTP 202 A G 203 1_555 ? ? ? ? ? ? ? 1.609 ? ? metalc1 metalc ? ? N MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 413 A HOH 517 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc2 metalc ? ? N MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 413 A HOH 518 1_555 ? ? ? ? ? ? ? 2.179 ? ? metalc3 metalc ? ? N MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 413 A HOH 523 1_555 ? ? ? ? ? ? ? 2.178 ? ? metalc4 metalc ? ? N MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 413 A HOH 527 1_555 ? ? ? ? ? ? ? 2.181 ? ? metalc5 metalc ? ? N MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 413 A HOH 544 1_555 ? ? ? ? ? ? ? 2.179 ? ? metalc6 metalc ? ? N MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 413 A HOH 547 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc7 metalc ? ? O MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 414 A HOH 504 1_555 ? ? ? ? ? ? ? 2.178 ? ? metalc8 metalc ? ? O MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 414 A HOH 505 1_555 ? ? ? ? ? ? ? 2.175 ? ? metalc9 metalc ? ? O MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 414 A HOH 510 1_555 ? ? ? ? ? ? ? 2.175 ? ? metalc10 metalc ? ? O MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 414 A HOH 519 1_555 ? ? ? ? ? ? ? 2.175 ? ? metalc11 metalc ? ? O MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 414 A HOH 529 1_555 ? ? ? ? ? ? ? 2.179 ? ? metalc12 metalc ? ? O MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 414 A HOH 530 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc13 metalc ? ? P MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 415 A HOH 507 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc14 metalc ? ? P MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 415 A HOH 511 1_555 ? ? ? ? ? ? ? 2.179 ? ? metalc15 metalc ? ? P MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 415 A HOH 512 1_555 ? ? ? ? ? ? ? 2.181 ? ? metalc16 metalc ? ? P MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 415 A HOH 515 1_555 ? ? ? ? ? ? ? 2.178 ? ? metalc17 metalc ? ? P MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 415 A HOH 533 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc18 metalc ? ? P MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 415 A HOH 539 1_555 ? ? ? ? ? ? ? 2.182 ? ? metalc19 metalc ? ? Q MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 416 A HOH 501 1_555 ? ? ? ? ? ? ? 2.181 ? ? metalc20 metalc ? ? Q MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 416 A HOH 506 1_555 ? ? ? ? ? ? ? 2.178 ? ? metalc21 metalc ? ? Q MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 416 A HOH 508 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc22 metalc ? ? Q MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 416 A HOH 520 1_555 ? ? ? ? ? ? ? 2.181 ? ? metalc23 metalc ? ? Q MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 416 A HOH 528 1_555 ? ? ? ? ? ? ? 2.181 ? ? metalc24 metalc ? ? Q MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 416 A HOH 534 1_555 ? ? ? ? ? ? ? 2.182 ? ? metalc25 metalc ? ? R MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 417 A HOH 514 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc26 metalc ? ? R MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 417 A HOH 521 1_555 ? ? ? ? ? ? ? 2.181 ? ? metalc27 metalc ? ? R MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 417 A HOH 531 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc28 metalc ? ? R MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 417 A HOH 537 6_564 ? ? ? ? ? ? ? 2.182 ? ? metalc29 metalc ? ? R MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 417 A HOH 538 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc30 metalc ? ? R MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 417 A HOH 545 1_555 ? ? ? ? ? ? ? 2.182 ? ? metalc31 metalc ? ? S MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 418 A HOH 502 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc32 metalc ? ? S MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 418 A HOH 503 1_555 ? ? ? ? ? ? ? 2.177 ? ? metalc33 metalc ? ? S MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 418 A HOH 509 1_555 ? ? ? ? ? ? ? 2.179 ? ? metalc34 metalc ? ? S MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 418 A HOH 513 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc35 metalc ? ? S MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 418 A HOH 532 1_555 ? ? ? ? ? ? ? 2.181 ? ? metalc36 metalc ? ? S MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 418 A HOH 543 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc37 metalc ? ? T MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 419 A HOH 525 1_555 ? ? ? ? ? ? ? 2.179 ? ? metalc38 metalc ? ? T MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 419 A HOH 526 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc39 metalc ? ? T MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 419 A HOH 535 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc40 metalc ? ? T MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 419 A HOH 541 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc41 metalc ? ? T MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 419 A HOH 546 1_555 ? ? ? ? ? ? ? 2.181 ? ? metalc42 metalc ? ? T MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 419 A HOH 548 1_555 ? ? ? ? ? ? ? 2.181 ? ? metalc43 metalc ? ? U MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 420 A HOH 516 1_555 ? ? ? ? ? ? ? 2.179 ? ? metalc44 metalc ? ? U MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 420 A HOH 522 1_555 ? ? ? ? ? ? ? 2.181 ? ? metalc45 metalc ? ? U MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 420 A HOH 524 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc46 metalc ? ? U MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 420 A HOH 536 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc47 metalc ? ? U MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 420 A HOH 540 1_555 ? ? ? ? ? ? ? 2.181 ? ? metalc48 metalc ? ? U MG . MG ? ? ? 1_555 V HOH . O ? ? A MG 420 A HOH 542 1_555 ? ? ? ? ? ? ? 2.181 ? ? hydrog1 hydrog ? ? A GTP 1 N1 ? ? ? 1_555 A C 122 N3 ? ? A GTP 202 A C 323 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A GTP 1 N2 ? ? ? 1_555 A C 122 O2 ? ? A GTP 202 A C 323 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A GTP 1 O6 ? ? ? 1_555 A C 122 N4 ? ? A GTP 202 A C 323 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A U 121 O2 ? ? A G 203 A U 322 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog5 hydrog ? ? A G 2 O6 ? ? ? 1_555 A U 121 N3 ? ? A G 203 A U 322 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog6 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 120 N1 ? ? A U 204 A A 321 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 3 O4 ? ? ? 1_555 A A 120 N6 ? ? A U 204 A A 321 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 119 N1 ? ? A C 205 A G 320 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 119 O6 ? ? A C 205 A G 320 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 119 N2 ? ? A C 205 A G 320 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 118 N3 ? ? A A 206 A U 319 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 118 O4 ? ? A A 206 A U 319 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 6 N1 ? ? ? 1_555 A U 117 N3 ? ? A A 207 A U 318 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 117 O4 ? ? A A 207 A U 318 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 7 N1 ? ? ? 1_555 A U 116 N3 ? ? A A 208 A U 317 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 116 O4 ? ? A A 208 A U 317 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 8 N3 ? ? ? 1_555 A G 115 O6 ? ? A U 209 A G 316 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog18 hydrog ? ? A U 8 O2 ? ? ? 1_555 A G 115 N1 ? ? A U 209 A G 316 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog19 hydrog ? ? A A 9 N1 ? ? ? 1_555 A U 114 N3 ? ? A A 210 A U 315 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A A 9 N6 ? ? ? 1_555 A U 114 O4 ? ? A A 210 A U 315 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 113 N3 ? ? A G 211 A C 314 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 113 O2 ? ? A G 211 A C 314 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 113 N4 ? ? A G 211 A C 314 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 11 N2 ? ? ? 1_555 A A 40 N3 ? ? A G 212 A A 241 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog25 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 112 N3 ? ? A G 212 A C 313 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 112 O2 ? ? A G 212 A C 313 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 112 N4 ? ? A G 212 A C 313 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 12 N3 ? ? ? 1_555 A G 111 O6 ? ? A U 213 A G 312 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog29 hydrog ? ? A U 12 O2 ? ? ? 1_555 A G 111 N1 ? ? A U 213 A G 312 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog30 hydrog ? ? A G 13 N1 ? ? ? 1_555 A C 36 N3 ? ? A G 214 A C 237 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 13 N2 ? ? ? 1_555 A C 36 O2 ? ? A G 214 A C 237 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 13 O6 ? ? ? 1_555 A C 36 N4 ? ? A G 214 A C 237 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 35 N1 ? ? A C 215 A G 236 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 35 O6 ? ? A C 215 A G 236 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 35 N2 ? ? A C 215 A G 236 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 34 N1 ? ? A C 216 A G 235 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 34 O6 ? ? A C 216 A G 235 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 34 N2 ? ? A C 216 A G 235 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 16 N1 ? ? ? 1_555 A C 33 N3 ? ? A G 217 A C 234 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 16 N2 ? ? ? 1_555 A C 33 O2 ? ? A G 217 A C 234 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 16 O6 ? ? ? 1_555 A C 33 N4 ? ? A G 217 A C 234 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 17 N1 ? ? ? 1_555 A C 32 N3 ? ? A G 218 A C 233 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 17 N2 ? ? ? 1_555 A C 32 O2 ? ? A G 218 A C 233 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 17 O6 ? ? ? 1_555 A C 32 N4 ? ? A G 218 A C 233 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A U 18 N3 ? ? ? 1_555 A G 31 O6 ? ? A U 219 A G 232 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog46 hydrog ? ? A U 18 O2 ? ? ? 1_555 A G 31 N1 ? ? A U 219 A G 232 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog47 hydrog ? ? A C 19 N3 ? ? ? 1_555 A A 30 N6 ? ? A C 220 A A 231 1_555 ? ? ? ? ? ? TYPE_25_PAIR ? ? ? hydrog48 hydrog ? ? A C 19 N4 ? ? ? 1_555 A A 30 N7 ? ? A C 220 A A 231 1_555 ? ? ? ? ? ? TYPE_25_PAIR ? ? ? hydrog49 hydrog ? ? A C 20 N3 ? ? ? 1_555 A G 104 N1 ? ? A C 221 A G 305 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 20 N4 ? ? ? 1_555 A G 104 O6 ? ? A C 221 A G 305 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A C 20 O2 ? ? ? 1_555 A G 104 N2 ? ? A C 221 A G 305 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 21 N1 ? ? ? 1_555 A C 29 N3 ? ? A G 222 A C 230 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 21 N2 ? ? ? 1_555 A C 29 O2 ? ? A G 222 A C 230 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 21 O6 ? ? ? 1_555 A C 29 N4 ? ? A G 222 A C 230 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 28 N1 ? ? A U 223 A A 229 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 28 N6 ? ? A U 223 A A 229 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A G 23 N2 ? ? ? 1_555 A A 27 N7 ? ? A G 224 A A 228 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog58 hydrog ? ? A G 23 N3 ? ? ? 1_555 A A 27 N6 ? ? A G 224 A A 228 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog59 hydrog ? ? A U 37 N3 ? ? ? 1_555 A A 41 N7 ? ? A U 238 A A 242 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog60 hydrog ? ? A U 37 O2 ? ? ? 1_555 A A 41 N6 ? ? A U 238 A A 242 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog61 hydrog ? ? A A 42 N1 ? ? ? 1_555 A U 110 N3 ? ? A A 243 A U 311 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A A 42 N6 ? ? ? 1_555 A U 110 O4 ? ? A A 243 A U 311 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 43 N1 ? ? ? 1_555 A C 109 N3 ? ? A G 244 A C 310 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 43 N2 ? ? ? 1_555 A C 109 O2 ? ? A G 244 A C 310 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 43 O6 ? ? ? 1_555 A C 109 N4 ? ? A G 244 A C 310 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 44 N1 ? ? ? 1_555 A C 108 N3 ? ? A G 245 A C 309 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A G 44 N2 ? ? ? 1_555 A C 108 O2 ? ? A G 245 A C 309 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A G 44 O6 ? ? ? 1_555 A C 108 N4 ? ? A G 245 A C 309 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A G 45 N1 ? ? ? 1_555 A A 107 N1 ? ? A G 246 A A 308 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog70 hydrog ? ? A G 45 O6 ? ? ? 1_555 A A 107 N6 ? ? A G 246 A A 308 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog71 hydrog ? ? A A 46 N1 ? ? ? 1_555 A G 66 N2 ? ? A A 247 A G 267 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog72 hydrog ? ? A A 47 N3 ? ? ? 1_555 A G 99 N2 ? ? A A 248 A G 300 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog73 hydrog ? ? A A 48 N1 ? ? ? 1_555 A U 63 N3 ? ? A A 249 A U 264 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog74 hydrog ? ? A C 49 N3 ? ? ? 1_555 A G 62 N1 ? ? A C 250 A G 263 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A C 49 N4 ? ? ? 1_555 A G 62 O6 ? ? A C 250 A G 263 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A C 49 O2 ? ? ? 1_555 A G 62 N2 ? ? A C 250 A G 263 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A C 50 N3 ? ? ? 1_555 A G 61 N1 ? ? A C 251 A G 262 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A C 50 N4 ? ? ? 1_555 A G 61 O6 ? ? A C 251 A G 262 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A C 50 O2 ? ? ? 1_555 A G 61 N2 ? ? A C 251 A G 262 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A G 51 N1 ? ? ? 1_555 A C 60 N3 ? ? A G 252 A C 261 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A G 51 N2 ? ? ? 1_555 A C 60 O2 ? ? A G 252 A C 261 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A G 51 O6 ? ? ? 1_555 A C 60 N4 ? ? A G 252 A C 261 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A G 52 N1 ? ? ? 1_555 A C 59 N3 ? ? A G 253 A C 260 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A G 52 N2 ? ? ? 1_555 A C 59 O2 ? ? A G 253 A C 260 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A G 52 O6 ? ? ? 1_555 A C 59 N4 ? ? A G 253 A C 260 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A U 53 N3 ? ? ? 1_555 A A 56 N7 ? ? A U 254 A A 257 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog87 hydrog ? ? A U 53 O4 ? ? ? 1_555 A A 56 N6 ? ? A U 254 A A 257 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog88 hydrog ? ? A A 54 N1 ? ? ? 1_555 A A 81 N6 ? ? A A 255 A A 282 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog89 hydrog ? ? A A 54 N6 ? ? ? 1_555 A A 81 N1 ? ? A A 255 A A 282 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog90 hydrog ? ? A A 56 N3 ? ? ? 1_555 A G 58 N2 ? ? A A 257 A G 259 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog91 hydrog ? ? A A 57 N3 ? ? ? 1_555 A A 98 N6 ? ? A A 258 A A 299 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog92 hydrog ? ? A G 64 N1 ? ? ? 1_555 A C 100 N3 ? ? A G 265 A C 301 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A G 64 N2 ? ? ? 1_555 A C 100 O2 ? ? A G 265 A C 301 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? A G 64 O6 ? ? ? 1_555 A C 100 N4 ? ? A G 265 A C 301 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A C 65 N3 ? ? ? 1_555 A G 99 N1 ? ? A C 266 A G 300 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A C 65 N4 ? ? ? 1_555 A G 99 O6 ? ? A C 266 A G 300 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? A C 65 O2 ? ? ? 1_555 A G 99 N2 ? ? A C 266 A G 300 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? A G 66 N1 ? ? ? 1_555 A C 74 N3 ? ? A G 267 A C 275 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? A G 66 N2 ? ? ? 1_555 A C 74 O2 ? ? A G 267 A C 275 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? A G 66 O6 ? ? ? 1_555 A C 74 N4 ? ? A G 267 A C 275 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog101 hydrog ? ? A G 67 N1 ? ? ? 1_555 A C 73 N3 ? ? A G 268 A C 274 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog102 hydrog ? ? A G 67 N2 ? ? ? 1_555 A C 73 O2 ? ? A G 268 A C 274 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog103 hydrog ? ? A G 67 O6 ? ? ? 1_555 A C 73 N4 ? ? A G 268 A C 274 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog104 hydrog ? ? A A 75 N6 ? ? ? 1_555 A A 105 N1 ? ? A A 276 A A 306 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog105 hydrog ? ? A C 76 N3 ? ? ? 1_555 A G 103 N1 ? ? A C 277 A G 304 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog106 hydrog ? ? A C 76 N4 ? ? ? 1_555 A G 103 O6 ? ? A C 277 A G 304 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog107 hydrog ? ? A C 76 O2 ? ? ? 1_555 A G 103 N2 ? ? A C 277 A G 304 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog108 hydrog ? ? A U 77 N3 ? ? ? 1_555 A A 102 N1 ? ? A U 278 A A 303 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog109 hydrog ? ? A U 77 O4 ? ? ? 1_555 A A 102 N6 ? ? A U 278 A A 303 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog110 hydrog ? ? A G 78 N1 ? ? ? 1_555 A C 101 N3 ? ? A G 279 A C 302 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog111 hydrog ? ? A G 78 N2 ? ? ? 1_555 A C 101 O2 ? ? A G 279 A C 302 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog112 hydrog ? ? A G 78 O6 ? ? ? 1_555 A C 101 N4 ? ? A G 279 A C 302 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog113 hydrog ? ? A U 79 N3 ? ? ? 1_555 A A 98 N7 ? ? A U 280 A A 299 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog114 hydrog ? ? A U 79 O2 ? ? ? 1_555 A A 98 N6 ? ? A U 280 A A 299 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog115 hydrog ? ? A U 82 N3 ? ? ? 1_555 A A 96 N1 ? ? A U 283 A A 297 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog116 hydrog ? ? A U 82 O4 ? ? ? 1_555 A A 96 N6 ? ? A U 283 A A 297 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog117 hydrog ? ? A U 83 N3 ? ? ? 1_555 A A 95 N1 ? ? A U 284 A A 296 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog118 hydrog ? ? A U 83 O4 ? ? ? 1_555 A A 95 N6 ? ? A U 284 A A 296 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog119 hydrog ? ? A G 84 N1 ? ? ? 1_555 A C 94 N3 ? ? A G 285 A C 295 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog120 hydrog ? ? A G 84 N2 ? ? ? 1_555 A C 94 O2 ? ? A G 285 A C 295 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog121 hydrog ? ? A G 84 O6 ? ? ? 1_555 A C 94 N4 ? ? A G 285 A C 295 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog122 hydrog ? ? A G 85 N1 ? ? ? 1_555 A C 93 N3 ? ? A G 286 A C 294 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog123 hydrog ? ? A G 85 N2 ? ? ? 1_555 A C 93 O2 ? ? A G 286 A C 294 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog124 hydrog ? ? A G 85 O6 ? ? ? 1_555 A C 93 N4 ? ? A G 286 A C 294 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog125 hydrog ? ? A C 86 N3 ? ? ? 1_555 A G 92 N1 ? ? A C 287 A G 293 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog126 hydrog ? ? A C 86 N4 ? ? ? 1_555 A G 92 O6 ? ? A C 287 A G 293 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog127 hydrog ? ? A C 86 O2 ? ? ? 1_555 A G 92 N2 ? ? A C 287 A G 293 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog128 hydrog ? ? A C 87 N4 ? ? ? 1_555 A G 90 O6 ? ? A C 288 A G 291 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog129 hydrog ? ? A G 124 N1 ? ? ? 1_555 A A 148 N1 ? ? A G 325 A A 349 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog130 hydrog ? ? A G 124 O6 ? ? ? 1_555 A A 148 N6 ? ? A G 325 A A 349 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog131 hydrog ? ? A C 125 N3 ? ? ? 1_555 A G 147 N1 ? ? A C 326 A G 348 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog132 hydrog ? ? A C 125 N4 ? ? ? 1_555 A G 147 O6 ? ? A C 326 A G 348 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog133 hydrog ? ? A C 125 O2 ? ? ? 1_555 A G 147 N2 ? ? A C 326 A G 348 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog134 hydrog ? ? A A 126 N6 ? ? ? 1_555 A U 146 O4 ? ? A A 327 A U 347 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog135 hydrog ? ? A C 127 N4 ? ? ? 1_555 A U 146 O4 ? ? A C 328 A U 347 1_555 ? ? ? ? ? ? 'C-U MISPAIR' ? ? ? hydrog136 hydrog ? ? A U 131 N3 ? ? ? 1_555 A A 143 N1 ? ? A U 332 A A 344 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog137 hydrog ? ? A U 132 N3 ? ? ? 1_555 A A 141 N1 ? ? A U 333 A A 342 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog138 hydrog ? ? A U 132 O4 ? ? ? 1_555 A A 141 N6 ? ? A U 333 A A 342 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog139 hydrog ? ? A C 133 N4 ? ? ? 1_555 A G 140 O6 ? ? A C 334 A G 341 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 O ? V HOH . ? A HOH 517 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 518 ? 1_555 89.9 ? 2 O ? V HOH . ? A HOH 517 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 523 ? 1_555 90.0 ? 3 O ? V HOH . ? A HOH 518 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 523 ? 1_555 89.2 ? 4 O ? V HOH . ? A HOH 517 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 527 ? 1_555 89.9 ? 5 O ? V HOH . ? A HOH 518 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 527 ? 1_555 179.6 ? 6 O ? V HOH . ? A HOH 523 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 527 ? 1_555 90.5 ? 7 O ? V HOH . ? A HOH 517 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 544 ? 1_555 179.8 ? 8 O ? V HOH . ? A HOH 518 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 544 ? 1_555 90.3 ? 9 O ? V HOH . ? A HOH 523 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 544 ? 1_555 90.1 ? 10 O ? V HOH . ? A HOH 527 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 544 ? 1_555 89.9 ? 11 O ? V HOH . ? A HOH 517 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 547 ? 1_555 89.9 ? 12 O ? V HOH . ? A HOH 518 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 547 ? 1_555 90.5 ? 13 O ? V HOH . ? A HOH 523 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 547 ? 1_555 179.7 ? 14 O ? V HOH . ? A HOH 527 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 547 ? 1_555 89.8 ? 15 O ? V HOH . ? A HOH 544 ? 1_555 MG ? N MG . ? A MG 413 ? 1_555 O ? V HOH . ? A HOH 547 ? 1_555 89.9 ? 16 O ? V HOH . ? A HOH 504 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 505 ? 1_555 88.5 ? 17 O ? V HOH . ? A HOH 504 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 510 ? 1_555 91.1 ? 18 O ? V HOH . ? A HOH 505 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 510 ? 1_555 90.0 ? 19 O ? V HOH . ? A HOH 504 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 519 ? 1_555 89.7 ? 20 O ? V HOH . ? A HOH 505 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 519 ? 1_555 90.0 ? 21 O ? V HOH . ? A HOH 510 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 519 ? 1_555 179.2 ? 22 O ? V HOH . ? A HOH 504 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 529 ? 1_555 91.5 ? 23 O ? V HOH . ? A HOH 505 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 529 ? 1_555 179.3 ? 24 O ? V HOH . ? A HOH 510 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 529 ? 1_555 89.3 ? 25 O ? V HOH . ? A HOH 519 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 529 ? 1_555 90.7 ? 26 O ? V HOH . ? A HOH 504 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 530 ? 1_555 178.4 ? 27 O ? V HOH . ? A HOH 505 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 530 ? 1_555 90.3 ? 28 O ? V HOH . ? A HOH 510 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 530 ? 1_555 89.9 ? 29 O ? V HOH . ? A HOH 519 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 530 ? 1_555 89.3 ? 30 O ? V HOH . ? A HOH 529 ? 1_555 MG ? O MG . ? A MG 414 ? 1_555 O ? V HOH . ? A HOH 530 ? 1_555 89.7 ? 31 O ? V HOH . ? A HOH 507 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 511 ? 1_555 179.6 ? 32 O ? V HOH . ? A HOH 507 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 512 ? 1_555 90.2 ? 33 O ? V HOH . ? A HOH 511 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 512 ? 1_555 89.9 ? 34 O ? V HOH . ? A HOH 507 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 515 ? 1_555 90.0 ? 35 O ? V HOH . ? A HOH 511 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 515 ? 1_555 90.4 ? 36 O ? V HOH . ? A HOH 512 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 515 ? 1_555 89.4 ? 37 O ? V HOH . ? A HOH 507 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 533 ? 1_555 90.2 ? 38 O ? V HOH . ? A HOH 511 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 533 ? 1_555 89.7 ? 39 O ? V HOH . ? A HOH 512 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 533 ? 1_555 179.4 ? 40 O ? V HOH . ? A HOH 515 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 533 ? 1_555 90.2 ? 41 O ? V HOH . ? A HOH 507 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 539 ? 1_555 89.4 ? 42 O ? V HOH . ? A HOH 511 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 539 ? 1_555 90.3 ? 43 O ? V HOH . ? A HOH 512 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 539 ? 1_555 89.9 ? 44 O ? V HOH . ? A HOH 515 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 539 ? 1_555 179.0 ? 45 O ? V HOH . ? A HOH 533 ? 1_555 MG ? P MG . ? A MG 415 ? 1_555 O ? V HOH . ? A HOH 539 ? 1_555 90.5 ? 46 O ? V HOH . ? A HOH 501 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 506 ? 1_555 88.7 ? 47 O ? V HOH . ? A HOH 501 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 508 ? 1_555 90.1 ? 48 O ? V HOH . ? A HOH 506 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 508 ? 1_555 90.0 ? 49 O ? V HOH . ? A HOH 501 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 520 ? 1_555 90.8 ? 50 O ? V HOH . ? A HOH 506 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 520 ? 1_555 179.5 ? 51 O ? V HOH . ? A HOH 508 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 520 ? 1_555 90.2 ? 52 O ? V HOH . ? A HOH 501 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 528 ? 1_555 179.3 ? 53 O ? V HOH . ? A HOH 506 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 528 ? 1_555 90.6 ? 54 O ? V HOH . ? A HOH 508 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 528 ? 1_555 89.9 ? 55 O ? V HOH . ? A HOH 520 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 528 ? 1_555 89.9 ? 56 O ? V HOH . ? A HOH 501 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 534 ? 1_555 90.2 ? 57 O ? V HOH . ? A HOH 506 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 534 ? 1_555 89.7 ? 58 O ? V HOH . ? A HOH 508 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 534 ? 1_555 179.5 ? 59 O ? V HOH . ? A HOH 520 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 534 ? 1_555 90.1 ? 60 O ? V HOH . ? A HOH 528 ? 1_555 MG ? Q MG . ? A MG 416 ? 1_555 O ? V HOH . ? A HOH 534 ? 1_555 89.8 ? 61 O ? V HOH . ? A HOH 514 ? 1_555 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 521 ? 1_555 89.9 ? 62 O ? V HOH . ? A HOH 514 ? 1_555 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 531 ? 1_555 90.0 ? 63 O ? V HOH . ? A HOH 521 ? 1_555 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 531 ? 1_555 89.7 ? 64 O ? V HOH . ? A HOH 514 ? 1_555 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 537 ? 6_564 179.8 ? 65 O ? V HOH . ? A HOH 521 ? 1_555 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 537 ? 6_564 90.3 ? 66 O ? V HOH . ? A HOH 531 ? 1_555 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 537 ? 6_564 89.9 ? 67 O ? V HOH . ? A HOH 514 ? 1_555 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 538 ? 1_555 90.2 ? 68 O ? V HOH . ? A HOH 521 ? 1_555 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 538 ? 1_555 179.8 ? 69 O ? V HOH . ? A HOH 531 ? 1_555 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 538 ? 1_555 90.1 ? 70 O ? V HOH . ? A HOH 537 ? 6_564 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 538 ? 1_555 89.7 ? 71 O ? V HOH . ? A HOH 514 ? 1_555 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 545 ? 1_555 89.9 ? 72 O ? V HOH . ? A HOH 521 ? 1_555 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 545 ? 1_555 90.3 ? 73 O ? V HOH . ? A HOH 531 ? 1_555 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 545 ? 1_555 179.9 ? 74 O ? V HOH . ? A HOH 537 ? 6_564 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 545 ? 1_555 90.2 ? 75 O ? V HOH . ? A HOH 538 ? 1_555 MG ? R MG . ? A MG 417 ? 1_555 O ? V HOH . ? A HOH 545 ? 1_555 89.8 ? 76 O ? V HOH . ? A HOH 502 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 503 ? 1_555 179.1 ? 77 O ? V HOH . ? A HOH 502 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 509 ? 1_555 89.9 ? 78 O ? V HOH . ? A HOH 503 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 509 ? 1_555 90.6 ? 79 O ? V HOH . ? A HOH 502 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 513 ? 1_555 91.1 ? 80 O ? V HOH . ? A HOH 503 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 513 ? 1_555 89.7 ? 81 O ? V HOH . ? A HOH 509 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 513 ? 1_555 89.6 ? 82 O ? V HOH . ? A HOH 502 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 532 ? 1_555 89.7 ? 83 O ? V HOH . ? A HOH 503 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 532 ? 1_555 89.7 ? 84 O ? V HOH . ? A HOH 509 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 532 ? 1_555 179.5 ? 85 O ? V HOH . ? A HOH 513 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 532 ? 1_555 90.1 ? 86 O ? V HOH . ? A HOH 502 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 543 ? 1_555 89.7 ? 87 O ? V HOH . ? A HOH 503 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 543 ? 1_555 89.6 ? 88 O ? V HOH . ? A HOH 509 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 543 ? 1_555 90.1 ? 89 O ? V HOH . ? A HOH 513 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 543 ? 1_555 179.2 ? 90 O ? V HOH . ? A HOH 532 ? 1_555 MG ? S MG . ? A MG 418 ? 1_555 O ? V HOH . ? A HOH 543 ? 1_555 90.2 ? 91 O ? V HOH . ? A HOH 525 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 526 ? 1_555 89.6 ? 92 O ? V HOH . ? A HOH 525 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 535 ? 1_555 90.0 ? 93 O ? V HOH . ? A HOH 526 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 535 ? 1_555 90.0 ? 94 O ? V HOH . ? A HOH 525 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 541 ? 1_555 89.6 ? 95 O ? V HOH . ? A HOH 526 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 541 ? 1_555 90.0 ? 96 O ? V HOH . ? A HOH 535 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 541 ? 1_555 179.6 ? 97 O ? V HOH . ? A HOH 525 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 546 ? 1_555 179.4 ? 98 O ? V HOH . ? A HOH 526 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 546 ? 1_555 89.9 ? 99 O ? V HOH . ? A HOH 535 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 546 ? 1_555 89.8 ? 100 O ? V HOH . ? A HOH 541 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 546 ? 1_555 90.6 ? 101 O ? V HOH . ? A HOH 525 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 548 ? 1_555 90.2 ? 102 O ? V HOH . ? A HOH 526 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 548 ? 1_555 179.8 ? 103 O ? V HOH . ? A HOH 535 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 548 ? 1_555 90.0 ? 104 O ? V HOH . ? A HOH 541 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 548 ? 1_555 90.0 ? 105 O ? V HOH . ? A HOH 546 ? 1_555 MG ? T MG . ? A MG 419 ? 1_555 O ? V HOH . ? A HOH 548 ? 1_555 90.3 ? 106 O ? V HOH . ? A HOH 516 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 522 ? 1_555 90.1 ? 107 O ? V HOH . ? A HOH 516 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 524 ? 1_555 179.7 ? 108 O ? V HOH . ? A HOH 522 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 524 ? 1_555 89.9 ? 109 O ? V HOH . ? A HOH 516 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 536 ? 1_555 90.0 ? 110 O ? V HOH . ? A HOH 522 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 536 ? 1_555 89.9 ? 111 O ? V HOH . ? A HOH 524 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 536 ? 1_555 90.3 ? 112 O ? V HOH . ? A HOH 516 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 540 ? 1_555 89.8 ? 113 O ? V HOH . ? A HOH 522 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 540 ? 1_555 179.8 ? 114 O ? V HOH . ? A HOH 524 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 540 ? 1_555 90.1 ? 115 O ? V HOH . ? A HOH 536 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 540 ? 1_555 89.9 ? 116 O ? V HOH . ? A HOH 516 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 542 ? 1_555 89.9 ? 117 O ? V HOH . ? A HOH 522 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 542 ? 1_555 90.3 ? 118 O ? V HOH . ? A HOH 524 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 542 ? 1_555 89.8 ? 119 O ? V HOH . ? A HOH 536 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 542 ? 1_555 179.8 ? 120 O ? V HOH . ? A HOH 540 ? 1_555 MG ? U MG . ? A MG 420 ? 1_555 O ? V HOH . ? A HOH 542 ? 1_555 89.9 ? # loop_ _struct_site.id _struct_site.pdbx_evidence_code _struct_site.pdbx_auth_asym_id _struct_site.pdbx_auth_comp_id _struct_site.pdbx_auth_seq_id _struct_site.pdbx_auth_ins_code _struct_site.pdbx_num_residues _struct_site.details AC1 Software A MG 401 ? 1 'binding site for residue MG A 401' AC2 Software A MG 403 ? 1 'binding site for residue MG A 403' AC3 Software A NCO 405 ? 4 'binding site for residue NCO A 405' AC4 Software A NCO 406 ? 6 'binding site for residue NCO A 406' AC5 Software A NCO 407 ? 3 'binding site for residue NCO A 407' AC6 Software A NCO 408 ? 3 'binding site for residue NCO A 408' AC7 Software A NCO 409 ? 4 'binding site for residue NCO A 409' AC8 Software A NCO 410 ? 2 'binding site for residue NCO A 410' AC9 Software A NCO 411 ? 6 'binding site for residue NCO A 411' AD1 Software A B1Z 412 ? 14 'binding site for residue B1Z A 412' AD2 Software A MG 413 ? 6 'binding site for residue MG A 413' AD3 Software A MG 414 ? 7 'binding site for residue MG A 414' AD4 Software A MG 415 ? 7 'binding site for residue MG A 415' AD5 Software A MG 416 ? 7 'binding site for residue MG A 416' AD6 Software A MG 417 ? 6 'binding site for residue MG A 417' AD7 Software A MG 418 ? 7 'binding site for residue MG A 418' AD8 Software A MG 419 ? 6 'binding site for residue MG A 419' AD9 Software A MG 420 ? 6 'binding site for residue MG A 420' # loop_ _struct_site_gen.id _struct_site_gen.site_id _struct_site_gen.pdbx_num_res _struct_site_gen.label_comp_id _struct_site_gen.label_asym_id _struct_site_gen.label_seq_id _struct_site_gen.pdbx_auth_ins_code _struct_site_gen.auth_comp_id _struct_site_gen.auth_asym_id _struct_site_gen.auth_seq_id _struct_site_gen.label_atom_id _struct_site_gen.label_alt_id _struct_site_gen.symmetry _struct_site_gen.details 1 AC1 1 G A 43 ? G A 244 . ? 1_555 ? 2 AC2 1 C A 142 ? C A 343 . ? 1_555 ? 3 AC3 4 G A 11 ? G A 212 . ? 1_555 ? 4 AC3 4 U A 12 ? U A 213 . ? 1_555 ? 5 AC3 4 U A 110 ? U A 311 . ? 1_555 ? 6 AC3 4 C A 112 ? C A 313 . ? 1_555 ? 7 AC4 6 G A 67 ? G A 268 . ? 1_555 ? 8 AC4 6 C A 70 ? C A 271 . ? 1_555 ? 9 AC4 6 C A 71 ? C A 272 . ? 1_555 ? 10 AC4 6 G A 72 ? G A 273 . ? 1_555 ? 11 AC4 6 C A 73 ? C A 274 . ? 1_555 ? 12 AC4 6 NCO I . ? NCO A 408 . ? 1_555 ? 13 AC5 3 G A 21 ? G A 222 . ? 1_555 ? 14 AC5 3 U A 22 ? U A 223 . ? 1_555 ? 15 AC5 3 G A 23 ? G A 224 . ? 1_555 ? 16 AC6 3 G A 66 ? G A 267 . ? 1_555 ? 17 AC6 3 C A 69 ? C A 270 . ? 1_555 ? 18 AC6 3 NCO G . ? NCO A 406 . ? 1_555 ? 19 AC7 4 G A 16 ? G A 217 . ? 1_555 ? 20 AC7 4 G A 17 ? G A 218 . ? 1_555 ? 21 AC7 4 U A 18 ? U A 219 . ? 1_555 ? 22 AC7 4 C A 29 ? C A 230 . ? 1_555 ? 23 AC8 2 G A 128 ? G A 329 . ? 6_564 ? 24 AC8 2 A A 129 ? A A 330 . ? 6_564 ? 25 AC9 6 A A 30 ? A A 231 . ? 1_555 ? 26 AC9 6 G A 104 ? G A 305 . ? 1_555 ? 27 AC9 6 A A 105 ? A A 306 . ? 1_555 ? 28 AC9 6 U A 106 ? U A 307 . ? 1_555 ? 29 AC9 6 A A 107 ? A A 308 . ? 1_555 ? 30 AC9 6 B1Z M . ? B1Z A 412 . ? 1_555 ? 31 AD1 14 G A 44 ? G A 245 . ? 1_555 ? 32 AD1 14 G A 45 ? G A 246 . ? 1_555 ? 33 AD1 14 A A 46 ? A A 247 . ? 1_555 ? 34 AD1 14 G A 67 ? G A 268 . ? 1_555 ? 35 AD1 14 U A 68 ? U A 269 . ? 1_555 ? 36 AD1 14 A A 75 ? A A 276 . ? 1_555 ? 37 AD1 14 G A 104 ? G A 305 . ? 1_555 ? 38 AD1 14 A A 105 ? A A 306 . ? 1_555 ? 39 AD1 14 A A 107 ? A A 308 . ? 1_555 ? 40 AD1 14 C A 109 ? C A 310 . ? 1_555 ? 41 AD1 14 C A 133 ? C A 334 . ? 12_554 ? 42 AD1 14 U A 134 ? U A 335 . ? 12_554 ? 43 AD1 14 G A 135 ? G A 336 . ? 12_554 ? 44 AD1 14 NCO L . ? NCO A 411 . ? 1_555 ? 45 AD2 6 HOH V . ? HOH A 517 . ? 1_555 ? 46 AD2 6 HOH V . ? HOH A 518 . ? 1_555 ? 47 AD2 6 HOH V . ? HOH A 523 . ? 1_555 ? 48 AD2 6 HOH V . ? HOH A 527 . ? 1_555 ? 49 AD2 6 HOH V . ? HOH A 544 . ? 1_555 ? 50 AD2 6 HOH V . ? HOH A 547 . ? 1_555 ? 51 AD3 7 A A 57 ? A A 258 . ? 1_555 ? 52 AD3 7 HOH V . ? HOH A 504 . ? 1_555 ? 53 AD3 7 HOH V . ? HOH A 505 . ? 1_555 ? 54 AD3 7 HOH V . ? HOH A 510 . ? 1_555 ? 55 AD3 7 HOH V . ? HOH A 519 . ? 1_555 ? 56 AD3 7 HOH V . ? HOH A 529 . ? 1_555 ? 57 AD3 7 HOH V . ? HOH A 530 . ? 1_555 ? 58 AD4 7 G A 51 ? G A 252 . ? 1_555 ? 59 AD4 7 HOH V . ? HOH A 507 . ? 1_555 ? 60 AD4 7 HOH V . ? HOH A 511 . ? 1_555 ? 61 AD4 7 HOH V . ? HOH A 512 . ? 1_555 ? 62 AD4 7 HOH V . ? HOH A 515 . ? 1_555 ? 63 AD4 7 HOH V . ? HOH A 533 . ? 1_555 ? 64 AD4 7 HOH V . ? HOH A 539 . ? 1_555 ? 65 AD5 7 A A 102 ? A A 303 . ? 1_555 ? 66 AD5 7 HOH V . ? HOH A 501 . ? 1_555 ? 67 AD5 7 HOH V . ? HOH A 506 . ? 1_555 ? 68 AD5 7 HOH V . ? HOH A 508 . ? 1_555 ? 69 AD5 7 HOH V . ? HOH A 520 . ? 1_555 ? 70 AD5 7 HOH V . ? HOH A 528 . ? 1_555 ? 71 AD5 7 HOH V . ? HOH A 534 . ? 1_555 ? 72 AD6 6 HOH V . ? HOH A 514 . ? 1_555 ? 73 AD6 6 HOH V . ? HOH A 521 . ? 1_555 ? 74 AD6 6 HOH V . ? HOH A 531 . ? 1_555 ? 75 AD6 6 HOH V . ? HOH A 537 . ? 6_564 ? 76 AD6 6 HOH V . ? HOH A 538 . ? 1_555 ? 77 AD6 6 HOH V . ? HOH A 545 . ? 1_555 ? 78 AD7 7 U A 134 ? U A 335 . ? 1_555 ? 79 AD7 7 HOH V . ? HOH A 502 . ? 1_555 ? 80 AD7 7 HOH V . ? HOH A 503 . ? 1_555 ? 81 AD7 7 HOH V . ? HOH A 509 . ? 1_555 ? 82 AD7 7 HOH V . ? HOH A 513 . ? 1_555 ? 83 AD7 7 HOH V . ? HOH A 532 . ? 1_555 ? 84 AD7 7 HOH V . ? HOH A 543 . ? 1_555 ? 85 AD8 6 HOH V . ? HOH A 525 . ? 1_555 ? 86 AD8 6 HOH V . ? HOH A 526 . ? 1_555 ? 87 AD8 6 HOH V . ? HOH A 535 . ? 1_555 ? 88 AD8 6 HOH V . ? HOH A 541 . ? 1_555 ? 89 AD8 6 HOH V . ? HOH A 546 . ? 1_555 ? 90 AD8 6 HOH V . ? HOH A 548 . ? 1_555 ? 91 AD9 6 HOH V . ? HOH A 516 . ? 1_555 ? 92 AD9 6 HOH V . ? HOH A 522 . ? 1_555 ? 93 AD9 6 HOH V . ? HOH A 524 . ? 1_555 ? 94 AD9 6 HOH V . ? HOH A 536 . ? 1_555 ? 95 AD9 6 HOH V . ? HOH A 540 . ? 1_555 ? 96 AD9 6 HOH V . ? HOH A 542 . ? 1_555 ? # _pdbx_entry_details.entry_id 6VMY _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.has_protein_modification N # _pdbx_validate_chiral.id 1 _pdbx_validate_chiral.PDB_model_num 1 _pdbx_validate_chiral.auth_atom_id N21 _pdbx_validate_chiral.label_alt_id ? _pdbx_validate_chiral.auth_asym_id A _pdbx_validate_chiral.auth_comp_id B1Z _pdbx_validate_chiral.auth_seq_id 412 _pdbx_validate_chiral.PDB_ins_code ? _pdbx_validate_chiral.details PLANAR _pdbx_validate_chiral.omega . # loop_ _pdbx_nonpoly_atom_coordination.geometry_id _pdbx_nonpoly_atom_coordination.label_asym_id _pdbx_nonpoly_atom_coordination.label_seq_id _pdbx_nonpoly_atom_coordination.label_comp_id _pdbx_nonpoly_atom_coordination.label_atom_id _pdbx_nonpoly_atom_coordination.label_alt_id _pdbx_nonpoly_atom_coordination.auth_asym_id _pdbx_nonpoly_atom_coordination.auth_seq_id _pdbx_nonpoly_atom_coordination.auth_comp_id _pdbx_nonpoly_atom_coordination.auth_atom_id _pdbx_nonpoly_atom_coordination.PDB_ins_code _pdbx_nonpoly_atom_coordination.number _pdbx_nonpoly_atom_coordination.geometry_calculated _pdbx_nonpoly_atom_coordination.remark _pdbx_nonpoly_atom_coordination.geometry_generic _pdbx_nonpoly_atom_coordination.geometry_abbr _pdbx_nonpoly_atom_coordination.provenance _pdbx_nonpoly_atom_coordination.assessment 1 F . NCO CO ? A 405 NCO CO ? 6 octahedron regular octahedral OCT FindGeo Expected 1 F . NCO CO ? A 405 NCO CO ? 6 octahedral regular octahedral OCT MetalCoord Expected 2 G . NCO CO ? A 406 NCO CO ? 6 octahedron regular octahedral OCT FindGeo Expected 2 G . NCO CO ? A 406 NCO CO ? 6 octahedral regular octahedral OCT MetalCoord Expected 3 H . NCO CO ? A 407 NCO CO ? 6 octahedron regular octahedral OCT FindGeo Expected 3 H . NCO CO ? A 407 NCO CO ? 6 octahedral regular octahedral OCT MetalCoord Expected 4 I . NCO CO ? A 408 NCO CO ? 6 octahedron regular octahedral OCT FindGeo Expected 4 I . NCO CO ? A 408 NCO CO ? 6 octahedral regular octahedral OCT MetalCoord Expected 5 J . NCO CO ? A 409 NCO CO ? 6 octahedron regular octahedral OCT FindGeo Expected 5 J . NCO CO ? A 409 NCO CO ? 6 octahedral regular octahedral OCT MetalCoord Expected 6 K . NCO CO ? A 410 NCO CO ? 6 octahedron regular octahedral OCT FindGeo Expected 6 K . NCO CO ? A 410 NCO CO ? 6 octahedral regular octahedral OCT MetalCoord Expected 7 L . NCO CO ? A 411 NCO CO ? 6 octahedron regular octahedral OCT FindGeo Expected 7 L . NCO CO ? A 411 NCO CO ? 6 octahedral regular octahedral OCT MetalCoord Expected 8 M . B1Z CO ? A 412 B1Z CO ? 6 octahedron regular octahedral OCT FindGeo Expected 8 M . B1Z CO ? A 412 B1Z CO ? 6 octahedral regular octahedral OCT MetalCoord Expected # loop_ _pdbx_nonpoly_atom_coordination_sphere.id _pdbx_nonpoly_atom_coordination_sphere.geometry_id _pdbx_nonpoly_atom_coordination_sphere.label_asym_id _pdbx_nonpoly_atom_coordination_sphere.label_seq_id _pdbx_nonpoly_atom_coordination_sphere.label_comp_id _pdbx_nonpoly_atom_coordination_sphere.label_atom_id _pdbx_nonpoly_atom_coordination_sphere.label_alt_id _pdbx_nonpoly_atom_coordination_sphere.auth_asym_id _pdbx_nonpoly_atom_coordination_sphere.auth_seq_id _pdbx_nonpoly_atom_coordination_sphere.auth_comp_id _pdbx_nonpoly_atom_coordination_sphere.auth_atom_id _pdbx_nonpoly_atom_coordination_sphere.PDB_ins_code _pdbx_nonpoly_atom_coordination_sphere.descriptor _pdbx_nonpoly_atom_coordination_sphere.provenance 1 1 F . NCO CO ? A 405 NCO CO ? '@OCT{Co,N,N,N,N,N,N}' MetalCoord 2 2 G . NCO CO ? A 406 NCO CO ? '@OCT{Co,N,N,N,N,N,N}' MetalCoord 3 3 H . NCO CO ? A 407 NCO CO ? '@OCT{Co,N,N,N,N,N,N}' MetalCoord 4 4 I . NCO CO ? A 408 NCO CO ? '@OCT{Co,N,N,N,N,N,N}' MetalCoord 5 5 J . NCO CO ? A 409 NCO CO ? '@OCT{Co,N,N,N,N,N,N}' MetalCoord 6 6 K . NCO CO ? A 410 NCO CO ? '@OCT{Co,N,N,N,N,N,N}' MetalCoord 7 7 L . NCO CO ? A 411 NCO CO ? '@OCT{Co,N,N,N,N,N,N}' MetalCoord 8 8 M . B1Z CO ? A 412 B1Z CO ? '@OCT{Co,C,N,N,N,N,N}' MetalCoord # loop_ _pdbx_nonpoly_atom_coordination_sphere_order.sphere_id _pdbx_nonpoly_atom_coordination_sphere_order.label_asym_id _pdbx_nonpoly_atom_coordination_sphere_order.label_seq_id _pdbx_nonpoly_atom_coordination_sphere_order.label_comp_id _pdbx_nonpoly_atom_coordination_sphere_order.label_atom_id _pdbx_nonpoly_atom_coordination_sphere_order.label_alt_id _pdbx_nonpoly_atom_coordination_sphere_order.auth_asym_id _pdbx_nonpoly_atom_coordination_sphere_order.auth_seq_id _pdbx_nonpoly_atom_coordination_sphere_order.auth_comp_id _pdbx_nonpoly_atom_coordination_sphere_order.auth_atom_id _pdbx_nonpoly_atom_coordination_sphere_order.PDB_ins_code _pdbx_nonpoly_atom_coordination_sphere_order.symmetry_operation _pdbx_nonpoly_atom_coordination_sphere_order.atom_place 1 F . NCO N1 ? A 405 NCO N1 ? x,y,z 1 1 F . NCO N3 ? A 405 NCO N3 ? x,y,z 2 1 F . NCO N2 ? A 405 NCO N2 ? x,y,z 3 1 F . NCO N4 ? A 405 NCO N4 ? x,y,z 4 1 F . NCO N5 ? A 405 NCO N5 ? x,y,z 5 1 F . NCO N6 ? A 405 NCO N6 ? x,y,z 6 2 G . NCO N1 ? A 406 NCO N1 ? x,y,z 1 2 G . NCO N3 ? A 406 NCO N3 ? x,y,z 2 2 G . NCO N2 ? A 406 NCO N2 ? x,y,z 3 2 G . NCO N4 ? A 406 NCO N4 ? x,y,z 4 2 G . NCO N5 ? A 406 NCO N5 ? x,y,z 5 2 G . NCO N6 ? A 406 NCO N6 ? x,y,z 6 3 H . NCO N1 ? A 407 NCO N1 ? x,y,z 1 3 H . NCO N3 ? A 407 NCO N3 ? x,y,z 2 3 H . NCO N2 ? A 407 NCO N2 ? x,y,z 3 3 H . NCO N4 ? A 407 NCO N4 ? x,y,z 4 3 H . NCO N5 ? A 407 NCO N5 ? x,y,z 5 3 H . NCO N6 ? A 407 NCO N6 ? x,y,z 6 4 I . NCO N1 ? A 408 NCO N1 ? x,y,z 1 4 I . NCO N3 ? A 408 NCO N3 ? x,y,z 2 4 I . NCO N2 ? A 408 NCO N2 ? x,y,z 3 4 I . NCO N4 ? A 408 NCO N4 ? x,y,z 4 4 I . NCO N5 ? A 408 NCO N5 ? x,y,z 5 4 I . NCO N6 ? A 408 NCO N6 ? x,y,z 6 5 J . NCO N1 ? A 409 NCO N1 ? x,y,z 1 5 J . NCO N3 ? A 409 NCO N3 ? x,y,z 2 5 J . NCO N2 ? A 409 NCO N2 ? x,y,z 3 5 J . NCO N4 ? A 409 NCO N4 ? x,y,z 4 5 J . NCO N5 ? A 409 NCO N5 ? x,y,z 5 5 J . NCO N6 ? A 409 NCO N6 ? x,y,z 6 6 K . NCO N1 ? A 410 NCO N1 ? x,y,z 1 6 K . NCO N3 ? A 410 NCO N3 ? x,y,z 2 6 K . NCO N2 ? A 410 NCO N2 ? x,y,z 3 6 K . NCO N4 ? A 410 NCO N4 ? x,y,z 4 6 K . NCO N5 ? A 410 NCO N5 ? x,y,z 5 6 K . NCO N6 ? A 410 NCO N6 ? x,y,z 6 7 L . NCO N1 ? A 411 NCO N1 ? x,y,z 1 7 L . NCO N3 ? A 411 NCO N3 ? x,y,z 2 7 L . NCO N2 ? A 411 NCO N2 ? x,y,z 3 7 L . NCO N4 ? A 411 NCO N4 ? x,y,z 4 7 L . NCO N5 ? A 411 NCO N5 ? x,y,z 5 7 L . NCO N6 ? A 411 NCO N6 ? x,y,z 6 8 M . B1Z C5A ? A 412 B1Z C5A ? x,y,z 1 8 M . B1Z N21 ? A 412 B1Z N21 ? x,y,z 2 8 M . B1Z N3B ? A 412 B1Z N3B ? x,y,z 3 8 M . B1Z N23 ? A 412 B1Z N23 ? x,y,z 4 8 M . B1Z N22 ? A 412 B1Z N22 ? x,y,z 5 8 M . B1Z N24 ? A 412 B1Z N24 ? x,y,z 6 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 B1Z P P N N 38 B1Z CO CO N N 39 B1Z C1 C N R 40 B1Z C2 C N S 41 B1Z C3 C N S 42 B1Z C4 C N N 43 B1Z C5 C N N 44 B1Z C6 C N N 45 B1Z C7 C N S 46 B1Z C8 C N S 47 B1Z C9 C N N 48 B1Z N0A N N N 49 B1Z C0B C N N 50 B1Z C10 C N N 51 B1Z C11 C N N 52 B1Z C12 C N N 53 B1Z C13 C N S 54 B1Z C14 C N N 55 B1Z C15 C N N 56 B1Z C16 C N N 57 B1Z C17 C N R 58 B1Z C18 C N R 59 B1Z C19 C N R 60 B1Z C1A C N R 61 B1Z N1A N Y N 62 B1Z C1B C N N 63 B1Z N1B N Y N 64 B1Z C1P C N N 65 B1Z C1R C N S 66 B1Z C20 C N N 67 B1Z N21 N N S 68 B1Z N22 N N N 69 B1Z N23 N N N 70 B1Z N24 N N N 71 B1Z C25 C N N 72 B1Z C26 C N N 73 B1Z C27 C N N 74 B1Z O28 O N N 75 B1Z N29 N N N 76 B1Z C2A C N R 77 B1Z C2B C Y N 78 B1Z C2C C Y N 79 B1Z C2P C N R 80 B1Z O2P O N N 81 B1Z C2R C N R 82 B1Z C30 C N N 83 B1Z C31 C N N 84 B1Z C32 C N N 85 B1Z O33 O N N 86 B1Z N34 N N N 87 B1Z C35 C N N 88 B1Z C36 C N N 89 B1Z C37 C N N 90 B1Z C38 C N N 91 B1Z O39 O N N 92 B1Z C3A C N S 93 B1Z N3A N Y N 94 B1Z N3B N Y N 95 B1Z C3P C N N 96 B1Z O3P O N N 97 B1Z C3R C N S 98 B1Z N40 N N N 99 B1Z C41 C N N 100 B1Z C42 C N N 101 B1Z C43 C N N 102 B1Z O44 O N N 103 B1Z N45 N N N 104 B1Z C46 C N N 105 B1Z C47 C N N 106 B1Z C48 C N N 107 B1Z C49 C N N 108 B1Z C4A C N S 109 B1Z C4B C Y N 110 B1Z C4D C Y N 111 B1Z O4P O N N 112 B1Z C4R C N R 113 B1Z C50 C N N 114 B1Z O51 O N N 115 B1Z N52 N N N 116 B1Z C53 C N N 117 B1Z C54 C N N 118 B1Z C55 C N N 119 B1Z C56 C N N 120 B1Z C57 C N N 121 B1Z O58 O N N 122 B1Z N59 N N N 123 B1Z C5A C N N 124 B1Z C5B C Y N 125 B1Z C5E C Y N 126 B1Z O5P O N N 127 B1Z C5R C N N 128 B1Z C60 C N N 129 B1Z C61 C N N 130 B1Z O62 O N N 131 B1Z N63 N N N 132 B1Z C6A C Y N 133 B1Z O6A O N N 134 B1Z C6B C Y N 135 B1Z O6R O N N 136 B1Z N7A N Y N 137 B1Z O7A O N N 138 B1Z C7B C Y N 139 B1Z O7R O N N 140 B1Z C8A C Y N 141 B1Z O8A O N N 142 B1Z C8B C Y N 143 B1Z O8R O N N 144 B1Z N9A N Y N 145 B1Z C9B C Y N 146 B1Z H3 H N N 147 B1Z H8 H N N 148 B1Z HN0A H N N 149 B1Z HN0B H N N 150 B1Z H0B H N N 151 B1Z H0BA H N N 152 B1Z H0BB H N N 153 B1Z H10 H N N 154 B1Z H13 H N N 155 B1Z H18 H N N 156 B1Z H1A H N N 157 B1Z H1B H N N 158 B1Z H1BA H N N 159 B1Z H1BB H N N 160 B1Z H1P H N N 161 B1Z H1PA H N N 162 B1Z H1R H N N 163 B1Z H20 H N N 164 B1Z H20A H N N 165 B1Z H20B H N N 166 B1Z H25 H N N 167 B1Z H25A H N N 168 B1Z H25B H N N 169 B1Z H26 H N N 170 B1Z H26A H N N 171 B1Z HN29 H N N 172 B1Z HN2A H N N 173 B1Z H2A H N N 174 B1Z H2B H N N 175 B1Z H2C H N N 176 B1Z H2P H N N 177 B1Z H2R H N N 178 B1Z H30 H N N 179 B1Z H30A H N N 180 B1Z H31 H N N 181 B1Z H31A H N N 182 B1Z HN34 H N N 183 B1Z HN3A H N N 184 B1Z H35 H N N 185 B1Z H35A H N N 186 B1Z H35B H N N 187 B1Z H36 H N N 188 B1Z H36A H N N 189 B1Z H36B H N N 190 B1Z H37 H N N 191 B1Z H37A H N N 192 B1Z H3A H N N 193 B1Z H3P H N N 194 B1Z H3PA H N N 195 B1Z H3PB H N N 196 B1Z H3R H N N 197 B1Z HN40 H N N 198 B1Z HN4A H N N 199 B1Z H41 H N N 200 B1Z H41A H N N 201 B1Z H42 H N N 202 B1Z H42A H N N 203 B1Z HN45 H N N 204 B1Z HN4B H N N 205 B1Z H46 H N N 206 B1Z H46A H N N 207 B1Z H46B H N N 208 B1Z H47 H N N 209 B1Z H47A H N N 210 B1Z H47B H N N 211 B1Z H48 H N N 212 B1Z H48A H N N 213 B1Z H49 H N N 214 B1Z H49A H N N 215 B1Z H4A H N N 216 B1Z H4B H N N 217 B1Z H4R H N N 218 B1Z HN52 H N N 219 B1Z HN5A H N N 220 B1Z H53 H N N 221 B1Z H53A H N N 222 B1Z H53B H N N 223 B1Z H54 H N N 224 B1Z H54A H N N 225 B1Z H54B H N N 226 B1Z H55 H N N 227 B1Z H55A H N N 228 B1Z H56 H N N 229 B1Z H56A H N N 230 B1Z HN59 H N N 231 B1Z H5AA H N N 232 B1Z H5AB H N N 233 B1Z H5R H N N 234 B1Z H5RA H N N 235 B1Z H60 H N N 236 B1Z H60A H N N 237 B1Z HN63 H N N 238 B1Z HN6A H N N 239 B1Z HO7A H N N 240 B1Z H7B H N N 241 B1Z HO7R H N N 242 B1Z H8A H N N 243 B1Z HO8A H N N 244 B1Z HO8R H N N 245 B1Z H102 H N N 246 B1Z H101 H N N 247 C OP3 O N N 248 C P P N N 249 C OP1 O N N 250 C OP2 O N N 251 C "O5'" O N N 252 C "C5'" C N N 253 C "C4'" C N R 254 C "O4'" O N N 255 C "C3'" C N S 256 C "O3'" O N N 257 C "C2'" C N R 258 C "O2'" O N N 259 C "C1'" C N R 260 C N1 N N N 261 C C2 C N N 262 C O2 O N N 263 C N3 N N N 264 C C4 C N N 265 C N4 N N N 266 C C5 C N N 267 C C6 C N N 268 C HOP3 H N N 269 C HOP2 H N N 270 C "H5'" H N N 271 C "H5''" H N N 272 C "H4'" H N N 273 C "H3'" H N N 274 C "HO3'" H N N 275 C "H2'" H N N 276 C "HO2'" H N N 277 C "H1'" H N N 278 C H41 H N N 279 C H42 H N N 280 C H5 H N N 281 C H6 H N N 282 G OP3 O N N 283 G P P N N 284 G OP1 O N N 285 G OP2 O N N 286 G "O5'" O N N 287 G "C5'" C N N 288 G "C4'" C N R 289 G "O4'" O N N 290 G "C3'" C N S 291 G "O3'" O N N 292 G "C2'" C N R 293 G "O2'" O N N 294 G "C1'" C N R 295 G N9 N Y N 296 G C8 C Y N 297 G N7 N Y N 298 G C5 C Y N 299 G C6 C N N 300 G O6 O N N 301 G N1 N N N 302 G C2 C N N 303 G N2 N N N 304 G N3 N N N 305 G C4 C Y N 306 G HOP3 H N N 307 G HOP2 H N N 308 G "H5'" H N N 309 G "H5''" H N N 310 G "H4'" H N N 311 G "H3'" H N N 312 G "HO3'" H N N 313 G "H2'" H N N 314 G "HO2'" H N N 315 G "H1'" H N N 316 G H8 H N N 317 G H1 H N N 318 G H21 H N N 319 G H22 H N N 320 GTP PG P N N 321 GTP O1G O N N 322 GTP O2G O N N 323 GTP O3G O N N 324 GTP O3B O N N 325 GTP PB P N N 326 GTP O1B O N N 327 GTP O2B O N N 328 GTP O3A O N N 329 GTP PA P N N 330 GTP O1A O N N 331 GTP O2A O N N 332 GTP "O5'" O N N 333 GTP "C5'" C N N 334 GTP "C4'" C N R 335 GTP "O4'" O N N 336 GTP "C3'" C N S 337 GTP "O3'" O N N 338 GTP "C2'" C N R 339 GTP "O2'" O N N 340 GTP "C1'" C N R 341 GTP N9 N Y N 342 GTP C8 C Y N 343 GTP N7 N Y N 344 GTP C5 C Y N 345 GTP C6 C N N 346 GTP O6 O N N 347 GTP N1 N N N 348 GTP C2 C N N 349 GTP N2 N N N 350 GTP N3 N N N 351 GTP C4 C Y N 352 GTP HOG2 H N N 353 GTP HOG3 H N N 354 GTP HOB2 H N N 355 GTP HOA2 H N N 356 GTP "H5'" H N N 357 GTP "H5''" H N N 358 GTP "H4'" H N N 359 GTP "H3'" H N N 360 GTP "HO3'" H N N 361 GTP "H2'" H N N 362 GTP "HO2'" H N N 363 GTP "H1'" H N N 364 GTP H8 H N N 365 GTP HN1 H N N 366 GTP HN21 H N N 367 GTP HN22 H N N 368 HOH O O N N 369 HOH H1 H N N 370 HOH H2 H N N 371 MG MG MG N N 372 NCO CO CO N N 373 NCO N1 N N N 374 NCO N2 N N N 375 NCO N3 N N N 376 NCO N4 N N N 377 NCO N5 N N N 378 NCO N6 N N N 379 NCO HN11 H N N 380 NCO HN12 H N N 381 NCO HN13 H N N 382 NCO HN21 H N N 383 NCO HN22 H N N 384 NCO HN23 H N N 385 NCO HN31 H N N 386 NCO HN32 H N N 387 NCO HN33 H N N 388 NCO HN41 H N N 389 NCO HN42 H N N 390 NCO HN43 H N N 391 NCO HN51 H N N 392 NCO HN52 H N N 393 NCO HN53 H N N 394 NCO HN61 H N N 395 NCO HN62 H N N 396 NCO HN63 H N N 397 U OP3 O N N 398 U P P N N 399 U OP1 O N N 400 U OP2 O N N 401 U "O5'" O N N 402 U "C5'" C N N 403 U "C4'" C N R 404 U "O4'" O N N 405 U "C3'" C N S 406 U "O3'" O N N 407 U "C2'" C N R 408 U "O2'" O N N 409 U "C1'" C N R 410 U N1 N N N 411 U C2 C N N 412 U O2 O N N 413 U N3 N N N 414 U C4 C N N 415 U O4 O N N 416 U C5 C N N 417 U C6 C N N 418 U HOP3 H N N 419 U HOP2 H N N 420 U "H5'" H N N 421 U "H5''" H N N 422 U "H4'" H N N 423 U "H3'" H N N 424 U "HO3'" H N N 425 U "H2'" H N N 426 U "HO2'" H N N 427 U "H1'" H N N 428 U H3 H N N 429 U H5 H N N 430 U H6 H N N 431 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 B1Z P O2P sing N N 40 B1Z P O3P sing N N 41 B1Z P O4P sing N N 42 B1Z P O5P doub N N 43 B1Z CO N21 sing N N 44 B1Z CO N22 sing N N 45 B1Z CO N24 sing N N 46 B1Z CO N3B sing N N 47 B1Z C1 C2 sing N N 48 B1Z C1 C19 sing N N 49 B1Z C1 C20 sing N N 50 B1Z C1 N21 sing N N 51 B1Z C2 C3 sing N N 52 B1Z C2 C25 sing N N 53 B1Z C2 C26 sing N N 54 B1Z C3 C4 sing N N 55 B1Z C3 C30 sing N N 56 B1Z C3 H3 sing N N 57 B1Z C4 C5 doub N N 58 B1Z C4 N21 sing N N 59 B1Z C5 C6 sing N N 60 B1Z C5 C35 sing N N 61 B1Z C6 C7 sing N N 62 B1Z C6 N22 doub N N 63 B1Z C7 C8 sing N N 64 B1Z C7 C36 sing N N 65 B1Z C7 C37 sing N N 66 B1Z C8 C9 sing N N 67 B1Z C8 C41 sing N N 68 B1Z C8 H8 sing N N 69 B1Z C9 C10 doub N N 70 B1Z C9 N22 sing N N 71 B1Z N0A C6A sing N N 72 B1Z N0A HN0A sing N N 73 B1Z N0A HN0B sing N N 74 B1Z C0B C5B sing N N 75 B1Z C0B H0B sing N N 76 B1Z C0B H0BA sing N N 77 B1Z C0B H0BB sing N N 78 B1Z C10 C11 sing N N 79 B1Z C10 H10 sing N N 80 B1Z C11 C12 sing N N 81 B1Z C11 N23 doub N N 82 B1Z C12 C13 sing N N 83 B1Z C12 C46 sing N N 84 B1Z C12 C47 sing N N 85 B1Z C13 C14 sing N N 86 B1Z C13 C48 sing N N 87 B1Z C13 H13 sing N N 88 B1Z C14 C15 doub N N 89 B1Z C14 N23 sing N N 90 B1Z C15 C16 sing N N 91 B1Z C15 C53 sing N N 92 B1Z C16 C17 sing N N 93 B1Z C16 N24 doub N N 94 B1Z C17 C18 sing N N 95 B1Z C17 C54 sing N N 96 B1Z C17 C55 sing N N 97 B1Z C18 C19 sing N N 98 B1Z C18 C60 sing N N 99 B1Z C18 H18 sing N N 100 B1Z C19 N24 sing N N 101 B1Z C1A C2A sing N N 102 B1Z C1A O6A sing N N 103 B1Z C1A N9A sing N N 104 B1Z C1A H1A sing N N 105 B1Z N1A C2C doub Y N 106 B1Z N1A C6A sing Y N 107 B1Z C1B C6B sing N N 108 B1Z C1B H1B sing N N 109 B1Z C1B H1BA sing N N 110 B1Z C1B H1BB sing N N 111 B1Z N1B C1R sing N N 112 B1Z N1B C2B sing Y N 113 B1Z N1B C8B sing Y N 114 B1Z C1P C2P sing N N 115 B1Z C1P N59 sing N N 116 B1Z C1P H1P sing N N 117 B1Z C1P H1PA sing N N 118 B1Z C1R C2R sing N N 119 B1Z C1R O6R sing N N 120 B1Z C1R H1R sing N N 121 B1Z C20 H20 sing N N 122 B1Z C20 H20A sing N N 123 B1Z C20 H20B sing N N 124 B1Z N23 CO sing N N 125 B1Z C25 H25 sing N N 126 B1Z C25 H25A sing N N 127 B1Z C25 H25B sing N N 128 B1Z C26 C27 sing N N 129 B1Z C26 H26 sing N N 130 B1Z C26 H26A sing N N 131 B1Z C27 O28 doub N N 132 B1Z C27 N29 sing N N 133 B1Z N29 HN29 sing N N 134 B1Z N29 HN2A sing N N 135 B1Z C2A C3A sing N N 136 B1Z C2A O7A sing N N 137 B1Z C2A H2A sing N N 138 B1Z C2B N3B doub Y N 139 B1Z C2B H2B sing N N 140 B1Z C2C N3A sing Y N 141 B1Z C2C H2C sing N N 142 B1Z C2P C3P sing N N 143 B1Z C2P O3P sing N N 144 B1Z C2P H2P sing N N 145 B1Z O2P C3R sing N N 146 B1Z C2R C3R sing N N 147 B1Z C2R O7R sing N N 148 B1Z C2R H2R sing N N 149 B1Z C30 C31 sing N N 150 B1Z C30 H30 sing N N 151 B1Z C30 H30A sing N N 152 B1Z C31 C32 sing N N 153 B1Z C31 H31 sing N N 154 B1Z C31 H31A sing N N 155 B1Z C32 O33 doub N N 156 B1Z C32 N34 sing N N 157 B1Z N34 HN34 sing N N 158 B1Z N34 HN3A sing N N 159 B1Z C35 H35 sing N N 160 B1Z C35 H35A sing N N 161 B1Z C35 H35B sing N N 162 B1Z C36 H36 sing N N 163 B1Z C36 H36A sing N N 164 B1Z C36 H36B sing N N 165 B1Z C37 C38 sing N N 166 B1Z C37 H37 sing N N 167 B1Z C37 H37A sing N N 168 B1Z C38 O39 doub N N 169 B1Z C38 N40 sing N N 170 B1Z C3A C4A sing N N 171 B1Z C3A O8A sing N N 172 B1Z C3A H3A sing N N 173 B1Z N3A C4D doub Y N 174 B1Z N3B C9B sing Y N 175 B1Z C3P H3P sing N N 176 B1Z C3P H3PA sing N N 177 B1Z C3P H3PB sing N N 178 B1Z C3R C4R sing N N 179 B1Z C3R H3R sing N N 180 B1Z N40 HN40 sing N N 181 B1Z N40 HN4A sing N N 182 B1Z C41 C42 sing N N 183 B1Z C41 H41 sing N N 184 B1Z C41 H41A sing N N 185 B1Z C42 C43 sing N N 186 B1Z C42 H42 sing N N 187 B1Z C42 H42A sing N N 188 B1Z C43 O44 doub N N 189 B1Z C43 N45 sing N N 190 B1Z N45 HN45 sing N N 191 B1Z N45 HN4B sing N N 192 B1Z C46 H46 sing N N 193 B1Z C46 H46A sing N N 194 B1Z C46 H46B sing N N 195 B1Z C47 H47 sing N N 196 B1Z C47 H47A sing N N 197 B1Z C47 H47B sing N N 198 B1Z C48 C49 sing N N 199 B1Z C48 H48 sing N N 200 B1Z C48 H48A sing N N 201 B1Z C49 C50 sing N N 202 B1Z C49 H49 sing N N 203 B1Z C49 H49A sing N N 204 B1Z C4A C5A sing N N 205 B1Z C4A O6A sing N N 206 B1Z C4A H4A sing N N 207 B1Z C4B C5B doub Y N 208 B1Z C4B C9B sing Y N 209 B1Z C4B H4B sing N N 210 B1Z C4D C5E sing Y N 211 B1Z C4D N9A sing Y N 212 B1Z O4P H102 sing N N 213 B1Z C4R C5R sing N N 214 B1Z C4R O6R sing N N 215 B1Z C4R H4R sing N N 216 B1Z C50 O51 doub N N 217 B1Z C50 N52 sing N N 218 B1Z N52 HN52 sing N N 219 B1Z N52 HN5A sing N N 220 B1Z C53 H53 sing N N 221 B1Z C53 H53A sing N N 222 B1Z C53 H53B sing N N 223 B1Z C54 H54 sing N N 224 B1Z C54 H54A sing N N 225 B1Z C54 H54B sing N N 226 B1Z C55 C56 sing N N 227 B1Z C55 H55 sing N N 228 B1Z C55 H55A sing N N 229 B1Z C56 C57 sing N N 230 B1Z C56 H56 sing N N 231 B1Z C56 H56A sing N N 232 B1Z C57 O58 doub N N 233 B1Z C57 N59 sing N N 234 B1Z N59 HN59 sing N N 235 B1Z C5A CO sing N N 236 B1Z C5A H5AA sing N N 237 B1Z C5A H5AB sing N N 238 B1Z C5B C6B sing Y N 239 B1Z C5E C6A doub Y N 240 B1Z C5E N7A sing Y N 241 B1Z C5R O8R sing N N 242 B1Z C5R H5R sing N N 243 B1Z C5R H5RA sing N N 244 B1Z C60 C61 sing N N 245 B1Z C60 H60 sing N N 246 B1Z C60 H60A sing N N 247 B1Z C61 O62 doub N N 248 B1Z C61 N63 sing N N 249 B1Z N63 HN63 sing N N 250 B1Z N63 HN6A sing N N 251 B1Z C6B C7B doub Y N 252 B1Z N7A C8A doub Y N 253 B1Z O7A HO7A sing N N 254 B1Z C7B C8B sing Y N 255 B1Z C7B H7B sing N N 256 B1Z O7R HO7R sing N N 257 B1Z C8A N9A sing Y N 258 B1Z C8A H8A sing N N 259 B1Z O8A HO8A sing N N 260 B1Z C8B C9B doub Y N 261 B1Z O8R HO8R sing N N 262 B1Z C19 H101 sing N N 263 C OP3 P sing N N 264 C OP3 HOP3 sing N N 265 C P OP1 doub N N 266 C P OP2 sing N N 267 C P "O5'" sing N N 268 C OP2 HOP2 sing N N 269 C "O5'" "C5'" sing N N 270 C "C5'" "C4'" sing N N 271 C "C5'" "H5'" sing N N 272 C "C5'" "H5''" sing N N 273 C "C4'" "O4'" sing N N 274 C "C4'" "C3'" sing N N 275 C "C4'" "H4'" sing N N 276 C "O4'" "C1'" sing N N 277 C "C3'" "O3'" sing N N 278 C "C3'" "C2'" sing N N 279 C "C3'" "H3'" sing N N 280 C "O3'" "HO3'" sing N N 281 C "C2'" "O2'" sing N N 282 C "C2'" "C1'" sing N N 283 C "C2'" "H2'" sing N N 284 C "O2'" "HO2'" sing N N 285 C "C1'" N1 sing N N 286 C "C1'" "H1'" sing N N 287 C N1 C2 sing N N 288 C N1 C6 sing N N 289 C C2 O2 doub N N 290 C C2 N3 sing N N 291 C N3 C4 doub N N 292 C C4 N4 sing N N 293 C C4 C5 sing N N 294 C N4 H41 sing N N 295 C N4 H42 sing N N 296 C C5 C6 doub N N 297 C C5 H5 sing N N 298 C C6 H6 sing N N 299 G OP3 P sing N N 300 G OP3 HOP3 sing N N 301 G P OP1 doub N N 302 G P OP2 sing N N 303 G P "O5'" sing N N 304 G OP2 HOP2 sing N N 305 G "O5'" "C5'" sing N N 306 G "C5'" "C4'" sing N N 307 G "C5'" "H5'" sing N N 308 G "C5'" "H5''" sing N N 309 G "C4'" "O4'" sing N N 310 G "C4'" "C3'" sing N N 311 G "C4'" "H4'" sing N N 312 G "O4'" "C1'" sing N N 313 G "C3'" "O3'" sing N N 314 G "C3'" "C2'" sing N N 315 G "C3'" "H3'" sing N N 316 G "O3'" "HO3'" sing N N 317 G "C2'" "O2'" sing N N 318 G "C2'" "C1'" sing N N 319 G "C2'" "H2'" sing N N 320 G "O2'" "HO2'" sing N N 321 G "C1'" N9 sing N N 322 G "C1'" "H1'" sing N N 323 G N9 C8 sing Y N 324 G N9 C4 sing Y N 325 G C8 N7 doub Y N 326 G C8 H8 sing N N 327 G N7 C5 sing Y N 328 G C5 C6 sing N N 329 G C5 C4 doub Y N 330 G C6 O6 doub N N 331 G C6 N1 sing N N 332 G N1 C2 sing N N 333 G N1 H1 sing N N 334 G C2 N2 sing N N 335 G C2 N3 doub N N 336 G N2 H21 sing N N 337 G N2 H22 sing N N 338 G N3 C4 sing N N 339 GTP PG O1G doub N N 340 GTP PG O2G sing N N 341 GTP PG O3G sing N N 342 GTP PG O3B sing N N 343 GTP O2G HOG2 sing N N 344 GTP O3G HOG3 sing N N 345 GTP O3B PB sing N N 346 GTP PB O1B doub N N 347 GTP PB O2B sing N N 348 GTP PB O3A sing N N 349 GTP O2B HOB2 sing N N 350 GTP O3A PA sing N N 351 GTP PA O1A doub N N 352 GTP PA O2A sing N N 353 GTP PA "O5'" sing N N 354 GTP O2A HOA2 sing N N 355 GTP "O5'" "C5'" sing N N 356 GTP "C5'" "C4'" sing N N 357 GTP "C5'" "H5'" sing N N 358 GTP "C5'" "H5''" sing N N 359 GTP "C4'" "O4'" sing N N 360 GTP "C4'" "C3'" sing N N 361 GTP "C4'" "H4'" sing N N 362 GTP "O4'" "C1'" sing N N 363 GTP "C3'" "O3'" sing N N 364 GTP "C3'" "C2'" sing N N 365 GTP "C3'" "H3'" sing N N 366 GTP "O3'" "HO3'" sing N N 367 GTP "C2'" "O2'" sing N N 368 GTP "C2'" "C1'" sing N N 369 GTP "C2'" "H2'" sing N N 370 GTP "O2'" "HO2'" sing N N 371 GTP "C1'" N9 sing N N 372 GTP "C1'" "H1'" sing N N 373 GTP N9 C8 sing Y N 374 GTP N9 C4 sing Y N 375 GTP C8 N7 doub Y N 376 GTP C8 H8 sing N N 377 GTP N7 C5 sing Y N 378 GTP C5 C6 sing N N 379 GTP C5 C4 doub Y N 380 GTP C6 O6 doub N N 381 GTP C6 N1 sing N N 382 GTP N1 C2 sing N N 383 GTP N1 HN1 sing N N 384 GTP C2 N2 sing N N 385 GTP C2 N3 doub N N 386 GTP N2 HN21 sing N N 387 GTP N2 HN22 sing N N 388 GTP N3 C4 sing N N 389 HOH O H1 sing N N 390 HOH O H2 sing N N 391 NCO CO N1 sing N N 392 NCO CO N2 sing N N 393 NCO CO N3 sing N N 394 NCO CO N4 sing N N 395 NCO CO N5 sing N N 396 NCO CO N6 sing N N 397 NCO N1 HN11 sing N N 398 NCO N1 HN12 sing N N 399 NCO N1 HN13 sing N N 400 NCO N2 HN21 sing N N 401 NCO N2 HN22 sing N N 402 NCO N2 HN23 sing N N 403 NCO N3 HN31 sing N N 404 NCO N3 HN32 sing N N 405 NCO N3 HN33 sing N N 406 NCO N4 HN41 sing N N 407 NCO N4 HN42 sing N N 408 NCO N4 HN43 sing N N 409 NCO N5 HN51 sing N N 410 NCO N5 HN52 sing N N 411 NCO N5 HN53 sing N N 412 NCO N6 HN61 sing N N 413 NCO N6 HN62 sing N N 414 NCO N6 HN63 sing N N 415 U OP3 P sing N N 416 U OP3 HOP3 sing N N 417 U P OP1 doub N N 418 U P OP2 sing N N 419 U P "O5'" sing N N 420 U OP2 HOP2 sing N N 421 U "O5'" "C5'" sing N N 422 U "C5'" "C4'" sing N N 423 U "C5'" "H5'" sing N N 424 U "C5'" "H5''" sing N N 425 U "C4'" "O4'" sing N N 426 U "C4'" "C3'" sing N N 427 U "C4'" "H4'" sing N N 428 U "O4'" "C1'" sing N N 429 U "C3'" "O3'" sing N N 430 U "C3'" "C2'" sing N N 431 U "C3'" "H3'" sing N N 432 U "O3'" "HO3'" sing N N 433 U "C2'" "O2'" sing N N 434 U "C2'" "C1'" sing N N 435 U "C2'" "H2'" sing N N 436 U "O2'" "HO2'" sing N N 437 U "C1'" N1 sing N N 438 U "C1'" "H1'" sing N N 439 U N1 C2 sing N N 440 U N1 C6 sing N N 441 U C2 O2 doub N N 442 U C2 N3 sing N N 443 U N3 C4 sing N N 444 U N3 H3 sing N N 445 U C4 O4 doub N N 446 U C4 C5 sing N N 447 U C5 C6 doub N N 448 U C5 H5 sing N N 449 U C6 H6 sing N N 450 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 6VMY 'double helix' 6VMY 'a-form double helix' 6VMY 'hairpin loop' 6VMY 'bulge loop' 6VMY 'mismatched base pair' 6VMY 'internal loop' 6VMY 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A GTP 1 1_555 A C 122 1_555 -0.142 -0.081 -0.028 -0.428 1.697 -1.098 1 A_GTP202:C323_A A 202 ? A 323 ? 19 1 1 A G 2 1_555 A U 121 1_555 -2.818 -0.797 -0.166 1.727 -1.916 -8.626 2 A_G203:U322_A A 203 ? A 322 ? 28 1 1 A U 3 1_555 A A 120 1_555 -0.113 0.018 -0.022 0.310 -4.708 -2.941 3 A_U204:A321_A A 204 ? A 321 ? 20 1 1 A C 4 1_555 A G 119 1_555 0.144 -0.084 0.091 3.333 -4.315 -1.214 4 A_C205:G320_A A 205 ? A 320 ? 19 1 1 A A 5 1_555 A U 118 1_555 0.445 0.373 -0.280 -8.770 -12.380 -13.511 5 A_A206:U319_A A 206 ? A 319 ? 20 1 1 A A 6 1_555 A U 117 1_555 0.292 0.185 -0.061 0.904 -4.963 -7.952 6 A_A207:U318_A A 207 ? A 318 ? 20 1 1 A A 7 1_555 A U 116 1_555 0.034 -0.049 0.105 -1.743 -15.814 -3.004 7 A_A208:U317_A A 208 ? A 317 ? 20 1 1 A U 8 1_555 A G 115 1_555 1.914 0.040 0.129 -0.958 -8.757 3.385 8 A_U209:G316_A A 209 ? A 316 ? 28 1 1 A A 9 1_555 A U 114 1_555 0.175 0.101 -0.201 -4.643 -11.667 -5.588 9 A_A210:U315_A A 210 ? A 315 ? 20 1 1 A G 10 1_555 A C 113 1_555 -0.163 -0.096 0.090 -2.253 -10.255 -1.206 10 A_G211:C314_A A 211 ? A 314 ? 19 1 1 A G 11 1_555 A C 112 1_555 -0.192 -0.097 -0.037 -6.271 -12.627 -0.892 11 A_G212:C313_A A 212 ? A 313 ? 19 1 1 A U 12 1_555 A G 111 1_555 3.061 -0.758 0.176 -11.553 -7.823 -10.412 12 A_U213:G312_A A 213 ? A 312 ? 28 1 1 A A 42 1_555 A U 110 1_555 0.666 0.086 -0.701 -16.038 -9.670 -4.451 13 A_A243:U311_A A 243 ? A 311 ? 20 1 1 A G 43 1_555 A C 109 1_555 -0.173 -0.083 -0.039 -9.096 -9.330 -1.131 14 A_G244:C310_A A 244 ? A 310 ? 19 1 1 A G 44 1_555 A C 108 1_555 -0.168 -0.084 0.050 -8.997 -10.629 -1.224 15 A_G245:C309_A A 245 ? A 309 ? 19 1 1 A G 45 1_555 A A 107 1_555 0.014 1.514 -0.217 9.072 -11.661 -18.213 16 A_G246:A308_A A 246 ? A 308 ? 8 1 1 A A 27 1_555 A G 23 1_555 -6.640 -3.900 1.284 -35.687 7.572 -0.124 17 A_A228:G224_A A 228 ? A 224 ? 11 9 1 A A 28 1_555 A U 22 1_555 0.173 0.078 -0.029 -6.524 -0.469 -4.527 18 A_A229:U223_A A 229 ? A 223 ? 20 1 1 A C 29 1_555 A G 21 1_555 0.188 -0.050 -0.232 17.997 -10.011 -1.050 19 A_C230:G222_A A 230 ? A 222 ? 19 1 1 A G 104 1_555 A C 20 1_555 -0.972 -0.391 0.377 -1.934 -7.858 -2.012 20 A_G305:C221_A A 305 ? A 221 ? 19 1 1 A A 30 1_555 A C 19 1_555 -3.098 -0.266 -0.334 13.492 -4.895 -76.920 21 A_A231:C220_A A 231 ? A 220 ? 25 4 1 A G 31 1_555 A U 18 1_555 -2.691 -0.721 -0.165 -2.156 -6.718 -3.246 22 A_G232:U219_A A 232 ? A 219 ? 28 1 1 A C 32 1_555 A G 17 1_555 0.165 -0.092 -0.009 1.194 -8.730 -0.932 23 A_C233:G218_A A 233 ? A 218 ? 19 1 1 A C 33 1_555 A G 16 1_555 0.169 -0.093 -0.063 1.390 -9.364 -0.691 24 A_C234:G217_A A 234 ? A 217 ? 19 1 1 A G 34 1_555 A C 15 1_555 -0.153 -0.083 -0.062 -3.015 -6.570 -0.969 25 A_G235:C216_A A 235 ? A 216 ? 19 1 1 A G 35 1_555 A C 14 1_555 -0.160 -0.095 0.116 -1.499 -9.138 -1.355 26 A_G236:C215_A A 236 ? A 215 ? 19 1 1 A C 36 1_555 A G 13 1_555 0.149 -0.086 0.067 0.218 -5.107 -1.122 27 A_C237:G214_A A 237 ? A 214 ? 19 1 1 A U 37 1_555 A A 41 1_555 4.270 -1.845 -0.451 -2.427 -5.540 -89.091 28 A_U238:A242_A A 238 ? A 242 ? 24 4 1 A C 73 1_555 A G 67 1_555 0.138 -0.092 -0.229 -7.973 5.028 -1.370 29 A_C274:G268_A A 274 ? A 268 ? 19 1 1 A C 74 1_555 A G 66 1_555 0.163 -0.085 -0.207 4.151 -6.779 -0.490 30 A_C275:G267_A A 275 ? A 267 ? 19 1 1 A G 99 1_555 A C 65 1_555 -0.154 -0.086 -0.115 -0.448 -5.174 -0.698 31 A_G300:C266_A A 300 ? A 266 ? 19 1 1 A C 100 1_555 A G 64 1_555 0.155 -0.098 -0.285 0.363 -4.667 -0.499 32 A_C301:G265_A A 301 ? A 265 ? 19 1 1 A A 48 1_555 A U 63 1_555 0.533 0.388 -0.020 -2.748 -12.079 21.180 33 A_A249:U264_A A 249 ? A 264 ? ? 1 1 A C 49 1_555 A G 62 1_555 0.194 -0.088 -0.061 9.962 -13.188 -1.025 34 A_C250:G263_A A 250 ? A 263 ? 19 1 1 A C 50 1_555 A G 61 1_555 0.164 -0.092 -0.062 0.803 -9.378 -0.698 35 A_C251:G262_A A 251 ? A 262 ? 19 1 1 A G 51 1_555 A C 60 1_555 -0.177 -0.096 0.088 -8.925 -12.179 -1.577 36 A_G252:C261_A A 252 ? A 261 ? 19 1 1 A G 52 1_555 A C 59 1_555 -0.122 -0.129 0.551 6.681 -9.278 -2.671 37 A_G253:C260_A A 253 ? A 260 ? 19 1 1 A U 53 1_555 A A 56 1_555 -0.194 3.490 0.576 -22.424 17.785 -79.125 38 A_U254:A257_A A 254 ? A 257 ? 23 3 1 A A 54 1_555 A A 81 1_555 -1.823 -0.887 -1.007 -7.475 -36.546 159.467 39 A_A255:A282_A A 255 ? A 282 ? 1 2 1 A A 75 1_555 A A 105 1_555 -2.731 1.406 -0.072 13.270 -6.326 4.227 40 A_A276:A306_A A 276 ? A 306 ? ? 1 1 A C 76 1_555 A G 103 1_555 0.160 -0.144 0.459 -2.217 -13.519 -2.775 41 A_C277:G304_A A 277 ? A 304 ? 19 1 1 A U 77 1_555 A A 102 1_555 0.108 -0.182 0.052 3.062 -13.939 1.734 42 A_U278:A303_A A 278 ? A 303 ? 20 1 1 A G 78 1_555 A C 101 1_555 -0.158 -0.095 0.165 -1.116 -7.921 -1.238 43 A_G279:C302_A A 279 ? A 302 ? 19 1 1 A U 79 1_555 A A 98 1_555 4.711 -2.849 -0.092 0.790 -1.150 -85.209 44 A_U280:A299_A A 280 ? A 299 ? 24 4 1 A U 82 1_555 A A 96 1_555 0.182 0.347 -0.006 -4.191 -4.850 -0.912 45 A_U283:A297_A A 283 ? A 297 ? 20 1 1 A U 83 1_555 A A 95 1_555 -0.157 0.059 -0.087 -0.113 -2.467 -4.080 46 A_U284:A296_A A 284 ? A 296 ? 20 1 1 A G 84 1_555 A C 94 1_555 -0.146 -0.083 -0.035 0.595 -4.199 -0.908 47 A_G285:C295_A A 285 ? A 295 ? 19 1 1 A G 85 1_555 A C 93 1_555 -0.177 -0.074 -0.123 -11.001 -9.529 -0.917 48 A_G286:C294_A A 286 ? A 294 ? 19 1 1 A C 86 1_555 A G 92 1_555 0.155 -0.080 -0.047 4.802 -6.304 -0.992 49 A_C287:G293_A A 287 ? A 293 ? 19 1 1 A C 87 1_555 A G 90 1_555 1.144 1.706 -1.030 24.426 -32.206 -88.521 50 A_C288:G291_A A 288 ? A 291 ? ? ? 1 A G 124 1_555 A A 148 1_555 -0.418 1.412 -0.618 -5.812 7.838 -21.632 51 A_G325:A349_A A 325 ? A 349 ? 8 1 1 A C 125 1_555 A G 147 1_555 0.147 -0.085 0.055 0.500 -6.644 -1.175 52 A_C326:G348_A A 326 ? A 348 ? 19 1 1 A C 127 1_555 A U 146 1_555 1.569 -0.873 0.273 29.962 -32.019 -25.743 53 A_C328:U347_A A 328 ? A 347 ? ? ? 1 A U 131 1_555 A A 143 1_555 0.054 0.061 -0.243 -5.465 -22.445 30.490 54 A_U332:A344_A A 332 ? A 344 ? ? 1 1 A U 132 1_555 A A 141 1_555 -0.139 0.017 -0.514 1.966 -6.224 -3.236 55 A_U333:A342_A A 333 ? A 342 ? 20 1 1 A C 133 1_555 A G 140 1_555 0.300 1.704 -0.566 1.135 -8.896 -118.805 56 A_C334:G341_A A 334 ? A 341 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A GTP 1 1_555 A C 122 1_555 A G 2 1_555 A U 121 1_555 -0.777 -1.905 3.620 -9.253 2.371 30.827 -3.903 -0.448 3.546 4.331 16.904 32.238 1 AA_GTP202G203:U322C323_AA A 202 ? A 323 ? A 203 ? A 322 ? 1 A G 2 1_555 A U 121 1_555 A U 3 1_555 A A 120 1_555 0.222 -1.780 3.414 -3.822 1.782 48.242 -2.313 -0.576 3.325 2.175 4.665 48.415 2 AA_G203U204:A321U322_AA A 203 ? A 322 ? A 204 ? A 321 ? 1 A U 3 1_555 A A 120 1_555 A C 4 1_555 A G 119 1_555 0.168 -1.791 3.265 -0.999 5.889 33.214 -3.995 -0.444 2.908 10.199 1.731 33.732 3 AA_U204C205:G320A321_AA A 204 ? A 321 ? A 205 ? A 320 ? 1 A C 4 1_555 A G 119 1_555 A A 5 1_555 A U 118 1_555 -0.780 -1.743 3.705 4.619 12.765 35.768 -4.329 1.795 2.824 19.921 -7.209 38.179 4 AA_C205A206:U319G320_AA A 205 ? A 320 ? A 206 ? A 319 ? 1 A A 5 1_555 A U 118 1_555 A A 6 1_555 A U 117 1_555 -0.056 -1.280 3.208 -2.195 7.640 29.923 -3.780 -0.292 2.800 14.477 4.158 30.938 5 AA_A206A207:U318U319_AA A 206 ? A 319 ? A 207 ? A 318 ? 1 A A 6 1_555 A U 117 1_555 A A 7 1_555 A U 116 1_555 0.463 -1.698 3.211 -0.762 14.789 35.266 -4.248 -0.794 2.330 23.188 1.195 38.158 6 AA_A207A208:U317U318_AA A 207 ? A 318 ? A 208 ? A 317 ? 1 A A 7 1_555 A U 116 1_555 A U 8 1_555 A G 115 1_555 0.338 -1.428 3.288 2.077 4.760 37.388 -2.811 -0.259 3.103 7.382 -3.221 37.734 7 AA_A208U209:G316U317_AA A 208 ? A 317 ? A 209 ? A 316 ? 1 A U 8 1_555 A G 115 1_555 A A 9 1_555 A U 114 1_555 -1.082 -1.540 3.094 3.677 13.312 27.439 -5.073 2.643 1.993 26.073 -7.203 30.659 8 AA_U209A210:U315G316_AA A 209 ? A 316 ? A 210 ? A 315 ? 1 A A 9 1_555 A U 114 1_555 A G 10 1_555 A C 113 1_555 0.235 -1.495 3.074 -2.991 9.090 28.728 -4.465 -0.977 2.460 17.710 5.827 30.248 9 AA_A210G211:C314U315_AA A 210 ? A 315 ? A 211 ? A 314 ? 1 A G 10 1_555 A C 113 1_555 A G 11 1_555 A C 112 1_555 0.229 -1.715 3.293 -0.646 5.665 33.133 -3.859 -0.498 2.963 9.844 1.122 33.607 10 AA_G211G212:C313C314_AA A 211 ? A 314 ? A 212 ? A 313 ? 1 A G 11 1_555 A C 112 1_555 A U 12 1_555 A G 111 1_555 -0.387 -1.625 3.360 2.080 2.651 48.033 -2.202 0.640 3.253 3.252 -2.552 48.144 11 AA_G212U213:G312C313_AA A 212 ? A 313 ? A 213 ? A 312 ? 1 A U 12 1_555 A G 111 1_555 A A 42 1_555 A U 110 1_555 -3.118 -1.082 3.300 14.510 4.559 58.736 -1.272 3.727 2.457 4.565 -14.529 60.503 12 AA_U213A243:U311G312_AA A 213 ? A 312 ? A 243 ? A 311 ? 1 A A 42 1_555 A U 110 1_555 A G 43 1_555 A C 109 1_555 0.291 -2.110 3.131 -1.279 3.365 19.725 -7.466 -1.370 2.712 9.718 3.693 20.048 13 AA_A243G244:C310U311_AA A 243 ? A 311 ? A 244 ? A 310 ? 1 A G 43 1_555 A C 109 1_555 A G 44 1_555 A C 108 1_555 0.400 -1.945 3.262 3.217 6.328 34.378 -4.129 -0.205 2.894 10.566 -5.371 35.082 14 AA_G244G245:C309C310_AA A 244 ? A 310 ? A 245 ? A 309 ? 1 A G 44 1_555 A C 108 1_555 A G 45 1_555 A A 107 1_555 -1.456 -1.166 2.994 7.149 0.969 32.960 -2.147 3.514 2.596 1.683 -12.415 33.719 15 AA_G245G246:A308C309_AA A 245 ? A 309 ? A 246 ? A 308 ? 1 A A 27 1_555 A G 23 1_555 A A 28 1_555 A U 22 1_555 -0.722 -0.648 2.936 6.664 11.969 55.591 -1.249 1.073 2.661 12.621 -7.026 57.123 16 AA_A228A229:U223G224_AA A 228 ? A 224 ? A 229 ? A 223 ? 1 A A 28 1_555 A U 22 1_555 A C 29 1_555 A G 21 1_555 0.668 -0.517 3.033 3.833 8.929 23.478 -3.538 -0.507 2.728 20.837 -8.945 25.383 17 AA_A229C230:G222U223_AA A 229 ? A 223 ? A 230 ? A 222 ? 1 A C 29 1_555 A G 21 1_555 A G 104 1_555 A C 20 1_555 -1.687 -0.961 3.466 -17.414 7.486 39.009 -2.147 0.332 3.637 10.491 24.406 43.208 18 AA_C230G305:C221G222_AA A 230 ? A 222 ? A 305 ? A 221 ? 1 A G 104 1_555 A C 20 1_555 A A 30 1_555 A C 19 1_555 -1.512 -1.395 3.120 1.956 8.038 3.381 -20.326 12.471 -0.403 65.887 -16.031 8.936 19 AA_G305A231:C220C221_AA A 305 ? A 221 ? A 231 ? A 220 ? 1 A A 30 1_555 A C 19 1_555 A G 31 1_555 A U 18 1_555 6.137 -1.997 3.773 -1.546 26.742 36.423 -4.890 -8.160 1.734 37.242 2.153 44.941 20 AA_A231G232:U219C220_AA A 231 ? A 220 ? A 232 ? A 219 ? 1 A G 31 1_555 A U 18 1_555 A C 32 1_555 A G 17 1_555 -0.330 -1.273 3.189 -3.444 5.568 46.123 -2.058 0.140 3.040 7.065 4.370 46.561 21 AA_G232C233:G218U219_AA A 232 ? A 219 ? A 233 ? A 218 ? 1 A C 32 1_555 A G 17 1_555 A C 33 1_555 A G 16 1_555 -0.108 -1.701 3.171 2.173 6.429 33.259 -3.866 0.506 2.790 11.089 -3.747 33.926 22 AA_C233C234:G217G218_AA A 233 ? A 218 ? A 234 ? A 217 ? 1 A C 33 1_555 A G 16 1_555 A G 34 1_555 A C 15 1_555 0.082 -1.666 3.234 1.789 14.819 30.611 -4.938 0.112 2.217 26.204 -3.164 33.978 23 AA_C234G235:C216G217_AA A 234 ? A 217 ? A 235 ? A 216 ? 1 A G 34 1_555 A C 15 1_555 A G 35 1_555 A C 14 1_555 0.421 -1.802 3.273 -0.730 1.942 27.886 -4.182 -1.040 3.131 4.023 1.512 27.961 24 AA_G235G236:C215C216_AA A 235 ? A 216 ? A 236 ? A 215 ? 1 A G 35 1_555 A C 14 1_555 A C 36 1_555 A G 13 1_555 -0.542 -1.599 3.284 -0.819 5.705 37.273 -3.191 0.737 3.026 8.860 1.271 37.700 25 AA_G236C237:G214C215_AA A 236 ? A 215 ? A 237 ? A 214 ? 1 A C 36 1_555 A G 13 1_555 A U 37 1_555 A A 41 1_555 -2.392 -2.412 3.231 6.296 1.704 68.685 -2.190 2.332 2.976 1.507 -5.567 68.956 26 AA_C237U238:A242G214_AA A 237 ? A 214 ? A 238 ? A 242 ? 1 A C 73 1_555 A G 67 1_555 A C 74 1_555 A G 66 1_555 0.204 -1.268 3.283 0.822 7.357 27.210 -4.247 -0.236 2.853 15.283 -1.707 28.181 27 AA_C274C275:G267G268_AA A 274 ? A 268 ? A 275 ? A 267 ? 1 A C 74 1_555 A G 66 1_555 A G 99 1_555 A C 65 1_555 1.584 -2.833 3.444 -0.197 7.080 19.031 -10.915 -4.574 2.238 20.516 0.571 20.295 28 AA_C275G300:C266G267_AA A 275 ? A 267 ? A 300 ? A 266 ? 1 A G 99 1_555 A C 65 1_555 A C 100 1_555 A G 64 1_555 -0.375 -2.315 3.363 0.130 -5.117 35.342 -2.979 0.632 3.650 -8.373 -0.213 35.699 29 AA_G300C301:G265C266_AA A 300 ? A 266 ? A 301 ? A 265 ? 1 A C 100 1_555 A G 64 1_555 A A 48 1_555 A U 63 1_555 -0.361 -2.179 3.734 0.954 0.046 30.951 -4.091 0.887 3.718 0.086 -1.788 30.966 30 AA_C301A249:U264G265_AA A 301 ? A 265 ? A 249 ? A 264 ? 1 A A 48 1_555 A U 63 1_555 A C 49 1_555 A G 62 1_555 -1.168 -0.723 2.935 -2.948 1.295 26.743 -1.854 1.820 3.006 2.786 6.344 26.933 31 AA_A249C250:G263U264_AA A 249 ? A 264 ? A 250 ? A 263 ? 1 A C 49 1_555 A G 62 1_555 A C 50 1_555 A G 61 1_555 -0.087 -1.814 3.267 -0.154 8.342 32.618 -4.404 0.126 2.734 14.557 0.269 33.640 32 AA_C250C251:G262G263_AA A 250 ? A 263 ? A 251 ? A 262 ? 1 A C 50 1_555 A G 61 1_555 A G 51 1_555 A C 60 1_555 -0.290 -1.623 3.148 -0.154 18.383 30.200 -4.957 0.459 1.883 31.846 0.268 35.243 33 AA_C251G252:C261G262_AA A 251 ? A 262 ? A 252 ? A 261 ? 1 A G 51 1_555 A C 60 1_555 A G 52 1_555 A C 59 1_555 -0.187 -1.034 2.719 -1.295 2.176 37.531 -1.836 0.151 2.662 3.378 2.010 37.613 34 AA_G252G253:C260C261_AA A 252 ? A 261 ? A 253 ? A 260 ? 1 A G 52 1_555 A C 59 1_555 A U 53 1_555 A A 56 1_555 -3.016 0.110 -0.947 32.893 162.691 141.191 0.222 1.475 -1.055 81.732 -16.525 175.353 35 AA_G253U254:A257C260_AA A 253 ? A 260 ? A 254 ? A 257 ? 1 A U 53 1_555 A A 56 1_555 A A 54 1_555 A A 81 1_555 -2.756 2.135 -3.225 -10.022 11.062 -115.730 -1.137 -1.514 -3.493 -6.517 -5.904 -116.338 36 AA_U254A255:A282A257_AA A 254 ? A 257 ? A 255 ? A 282 ? 1 A A 75 1_555 A A 105 1_555 A C 76 1_555 A G 103 1_555 1.092 -0.935 3.409 -4.616 -1.612 58.735 -0.865 -1.355 3.345 -1.641 4.697 58.920 37 AA_A276C277:G304A306_AA A 276 ? A 306 ? A 277 ? A 304 ? 1 A C 76 1_555 A G 103 1_555 A U 77 1_555 A A 102 1_555 -0.991 -1.596 3.019 -1.377 12.159 27.270 -5.203 1.687 2.171 24.297 2.752 29.842 38 AA_C277U278:A303G304_AA A 277 ? A 304 ? A 278 ? A 303 ? 1 A U 77 1_555 A A 102 1_555 A G 78 1_555 A C 101 1_555 -0.023 -1.939 3.354 -1.466 3.566 25.976 -5.215 -0.338 3.061 7.878 3.239 26.256 39 AA_U278G279:C302A303_AA A 278 ? A 303 ? A 279 ? A 302 ? 1 A G 78 1_555 A C 101 1_555 A U 79 1_555 A A 98 1_555 -0.951 -2.084 3.234 5.847 1.868 93.459 -1.463 0.757 3.152 1.282 -4.012 93.614 40 AA_G279U280:A299C302_AA A 279 ? A 302 ? A 280 ? A 299 ? 1 A U 82 1_555 A A 96 1_555 A U 83 1_555 A A 95 1_555 -0.383 -1.971 3.085 0.221 6.569 32.732 -4.397 0.700 2.648 11.511 -0.388 33.368 41 AA_U283U284:A296A297_AA A 283 ? A 297 ? A 284 ? A 296 ? 1 A U 83 1_555 A A 95 1_555 A G 84 1_555 A C 94 1_555 0.409 -1.893 3.351 -0.547 10.130 28.857 -5.460 -0.878 2.548 19.579 1.057 30.553 42 AA_U284G285:C295A296_AA A 284 ? A 296 ? A 285 ? A 295 ? 1 A G 84 1_555 A C 94 1_555 A G 85 1_555 A C 93 1_555 0.039 -2.336 3.422 1.557 10.094 37.680 -4.668 0.122 2.730 15.288 -2.359 38.992 43 AA_G285G286:C294C295_AA A 285 ? A 295 ? A 286 ? A 294 ? 1 A G 85 1_555 A C 93 1_555 A C 86 1_555 A G 92 1_555 -0.765 -1.216 3.150 0.548 -0.533 30.474 -2.210 1.560 3.156 -1.014 -1.043 30.484 44 AA_G286C287:G293C294_AA A 286 ? A 294 ? A 287 ? A 293 ? 1 A C 86 1_555 A G 92 1_555 A C 87 1_555 A G 90 1_555 -0.135 -2.181 3.072 -1.178 0.678 74.459 -1.822 0.077 3.057 0.560 0.974 74.469 45 AA_C287C288:G291G293_AA A 287 ? A 293 ? A 288 ? A 291 ? 1 A G 124 1_555 A A 148 1_555 A C 125 1_555 A G 147 1_555 1.088 -1.157 3.722 -2.487 4.562 35.528 -2.598 -2.159 3.470 7.426 4.049 35.894 46 AA_G325C326:G348A349_AA A 325 ? A 349 ? A 326 ? A 348 ? 1 A C 125 1_555 A G 147 1_555 A C 127 1_555 A U 146 1_555 -3.143 -0.978 4.585 32.168 16.363 49.461 -1.872 4.890 1.994 17.188 -33.790 60.552 47 AA_C326C328:U347G348_AA A 326 ? A 348 ? A 328 ? A 347 ? 1 A U 131 1_555 A A 143 1_555 A U 132 1_555 A A 141 1_555 0.039 -1.402 5.044 -28.901 23.112 42.928 -3.461 -2.506 3.356 26.508 33.149 56.100 48 AA_U332U333:A342A344_AA A 332 ? A 344 ? A 333 ? A 342 ? 1 A U 132 1_555 A A 141 1_555 A C 133 1_555 A G 140 1_555 -0.546 -1.843 3.111 8.520 8.025 85.997 -1.507 0.572 2.912 5.860 -6.221 86.635 49 AA_U333C334:G341A342_AA A 333 ? A 342 ? A 334 ? A 341 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' 'R01 GM058443' 1 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' 'R35 GM118108' 2 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' 'T32 GM008382' 3 # _atom_sites.entry_id 6VMY _atom_sites.fract_transf_matrix[1][1] 0.008454 _atom_sites.fract_transf_matrix[1][2] 0.004881 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.009762 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.003823 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol _atom_type.pdbx_scat_Z _atom_type.pdbx_N_electrons _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c C 6 6 2.310 20.844 1.020 10.208 1.589 0.569 0.865 51.651 0.216 CO 27 27 12.289 4.279 7.344 0.278 4.005 13.536 2.350 71.169 1.183 H 1 1 0.493 10.511 0.323 26.126 0.140 3.142 0.041 57.800 0.003 MG 12 12 5.427 2.828 2.176 79.261 1.228 0.381 2.310 7.194 0.935 MG+2 12 10 3.499 2.168 3.838 4.754 1.328 0.185 0.850 10.141 0.561 N 7 7 12.222 0.006 3.135 9.893 2.014 28.997 1.167 0.583 -11.538 O 8 8 3.049 13.277 2.287 5.701 1.546 0.324 0.867 32.909 0.251 P 15 15 6.435 1.907 4.179 27.157 1.780 0.526 1.491 68.164 1.268 # loop_ #