data_6WLJ # _entry.id 6WLJ # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.387 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 6WLJ pdb_00006wlj 10.2210/pdb6wlj/pdb WWPDB D_1000248510 ? ? EMDB EMD-21831 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2020-07-08 2 'Structure model' 1 1 2020-07-15 3 'Structure model' 1 2 2024-03-06 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' chem_comp_atom 4 3 'Structure model' chem_comp_bond 5 3 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 2 'Structure model' '_citation.pdbx_database_id_PubMed' 5 2 'Structure model' '_citation.title' 6 2 'Structure model' '_citation_author.identifier_ORCID' 7 3 'Structure model' '_database_2.pdbx_DOI' 8 3 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 6WLJ _pdbx_database_status.recvd_initial_deposition_date 2020-04-20 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _pdbx_database_related.db_name _pdbx_database_related.details _pdbx_database_related.db_id _pdbx_database_related.content_type EMDB . EMD-21831 'associated EM volume' EMDB . EMD-21832 'other EM volume' EMDB . EMD-21833 'other EM volume' EMDB . EMD-21834 'other EM volume' EMDB . EMD-21835 'other EM volume' EMDB . EMD-21836 'other EM volume' EMDB . EMD-21838 'other EM volume' EMDB . EMD-21839 'other EM volume' EMDB . EMD-21840 'other EM volume' EMDB . EMD-21841 'other EM volume' EMDB . EMD-21842 'other EM volume' # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kappel, K.' 1 0000-0002-2129-199X 'Zhang, K.' 2 ? 'Su, Z.' 3 ? 'Watkins, A.M.' 4 ? 'Kladwang, W.' 5 ? 'Li, S.' 6 ? 'Pintilie, G.' 7 ? 'Topkar, V.V.' 8 ? 'Rangan, R.' 9 ? 'Zheludev, I.N.' 10 ? 'Yesselman, J.D.' 11 ? 'Chiu, W.' 12 ? 'Das, R.' 13 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Nat.Methods _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 1548-7105 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 17 _citation.language ? _citation.page_first 699 _citation.page_last 707 _citation.title 'Accelerated cryo-EM-guided determination of three-dimensional RNA-only structures.' _citation.year 2020 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41592-020-0878-9 _citation.pdbx_database_id_PubMed 32616928 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Kappel, K.' 1 ? primary 'Zhang, K.' 2 ? primary 'Su, Z.' 3 ? primary 'Watkins, A.M.' 4 ? primary 'Kladwang, W.' 5 ? primary 'Li, S.' 6 ? primary 'Pintilie, G.' 7 ? primary 'Topkar, V.V.' 8 ? primary 'Rangan, R.' 9 ? primary 'Zheludev, I.N.' 10 ? primary 'Yesselman, J.D.' 11 ? primary 'Chiu, W.' 12 ? primary 'Das, R.' 13 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (130-MER)' _entity.formula_weight 42145.086 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGCGAUAUGGCAUGGAAUCAGCUCAAGGAACUGUGAACGUAUAUCGGGCAACGACUAGGAAACUAGUCGUUGGGAAGAAA CUGCCGAUAUACGGGAGUUCCUUGAGCGGGAGAUUCCAUGCCUAAGUCGC ; _entity_poly.pdbx_seq_one_letter_code_can ;GGCGAUAUGGCAUGGAAUCAGCUCAAGGAACUGUGAACGUAUAUCGGGCAACGACUAGGAAACUAGUCGUUGGGAAGAAA CUGCCGAUAUACGGGAGUUCCUUGAGCGGGAGAUUCCAUGCCUAAGUCGC ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 G n 1 5 A n 1 6 U n 1 7 A n 1 8 U n 1 9 G n 1 10 G n 1 11 C n 1 12 A n 1 13 U n 1 14 G n 1 15 G n 1 16 A n 1 17 A n 1 18 U n 1 19 C n 1 20 A n 1 21 G n 1 22 C n 1 23 U n 1 24 C n 1 25 A n 1 26 A n 1 27 G n 1 28 G n 1 29 A n 1 30 A n 1 31 C n 1 32 U n 1 33 G n 1 34 U n 1 35 G n 1 36 A n 1 37 A n 1 38 C n 1 39 G n 1 40 U n 1 41 A n 1 42 U n 1 43 A n 1 44 U n 1 45 C n 1 46 G n 1 47 G n 1 48 G n 1 49 C n 1 50 A n 1 51 A n 1 52 C n 1 53 G n 1 54 A n 1 55 C n 1 56 U n 1 57 A n 1 58 G n 1 59 G n 1 60 A n 1 61 A n 1 62 A n 1 63 C n 1 64 U n 1 65 A n 1 66 G n 1 67 U n 1 68 C n 1 69 G n 1 70 U n 1 71 U n 1 72 G n 1 73 G n 1 74 G n 1 75 A n 1 76 A n 1 77 G n 1 78 A n 1 79 A n 1 80 A n 1 81 C n 1 82 U n 1 83 G n 1 84 C n 1 85 C n 1 86 G n 1 87 A n 1 88 U n 1 89 A n 1 90 U n 1 91 A n 1 92 C n 1 93 G n 1 94 G n 1 95 G n 1 96 A n 1 97 G n 1 98 U n 1 99 U n 1 100 C n 1 101 C n 1 102 U n 1 103 U n 1 104 G n 1 105 A n 1 106 G n 1 107 C n 1 108 G n 1 109 G n 1 110 G n 1 111 A n 1 112 G n 1 113 A n 1 114 U n 1 115 U n 1 116 C n 1 117 C n 1 118 A n 1 119 U n 1 120 G n 1 121 C n 1 122 C n 1 123 U n 1 124 A n 1 125 A n 1 126 G n 1 127 U n 1 128 C n 1 129 G n 1 130 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 130 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 A 5 5 5 A A A . n A 1 6 U 6 6 6 U U A . n A 1 7 A 7 7 7 A A A . n A 1 8 U 8 8 8 U U A . n A 1 9 G 9 9 9 G G A . n A 1 10 G 10 10 10 G G A . n A 1 11 C 11 11 11 C C A . n A 1 12 A 12 12 12 A A A . n A 1 13 U 13 13 13 U U A . n A 1 14 G 14 14 14 G G A . n A 1 15 G 15 15 15 G G A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 U 18 18 18 U U A . n A 1 19 C 19 19 19 C C A . n A 1 20 A 20 20 20 A A A . n A 1 21 G 21 21 21 G G A . n A 1 22 C 22 22 22 C C A . n A 1 23 U 23 23 23 U U A . n A 1 24 C 24 24 24 C C A . n A 1 25 A 25 25 25 A A A . n A 1 26 A 26 26 26 A A A . n A 1 27 G 27 27 27 G G A . n A 1 28 G 28 28 28 G G A . n A 1 29 A 29 29 29 A A A . n A 1 30 A 30 30 30 A A A . n A 1 31 C 31 31 31 C C A . n A 1 32 U 32 32 32 U U A . n A 1 33 G 33 33 33 G G A . n A 1 34 U 34 34 34 U U A . n A 1 35 G 35 35 35 G G A . n A 1 36 A 36 36 36 A A A . n A 1 37 A 37 37 37 A A A . n A 1 38 C 38 38 38 C C A . n A 1 39 G 39 39 39 G G A . n A 1 40 U 40 40 40 U U A . n A 1 41 A 41 41 41 A A A . n A 1 42 U 42 42 42 U U A . n A 1 43 A 43 43 43 A A A . n A 1 44 U 44 44 44 U U A . n A 1 45 C 45 45 45 C C A . n A 1 46 G 46 46 46 G G A . n A 1 47 G 47 47 47 G G A . n A 1 48 G 48 48 48 G G A . n A 1 49 C 49 49 49 C C A . n A 1 50 A 50 50 50 A A A . n A 1 51 A 51 51 51 A A A . n A 1 52 C 52 52 52 C C A . n A 1 53 G 53 53 53 G G A . n A 1 54 A 54 54 54 A A A . n A 1 55 C 55 55 55 C C A . n A 1 56 U 56 56 56 U U A . n A 1 57 A 57 57 57 A A A . n A 1 58 G 58 58 58 G G A . n A 1 59 G 59 59 59 G G A . n A 1 60 A 60 60 60 A A A . n A 1 61 A 61 61 61 A A A . n A 1 62 A 62 62 62 A A A . n A 1 63 C 63 63 63 C C A . n A 1 64 U 64 64 64 U U A . n A 1 65 A 65 65 65 A A A . n A 1 66 G 66 66 66 G G A . n A 1 67 U 67 67 67 U U A . n A 1 68 C 68 68 68 C C A . n A 1 69 G 69 69 69 G G A . n A 1 70 U 70 70 70 U U A . n A 1 71 U 71 71 71 U U A . n A 1 72 G 72 72 72 G G A . n A 1 73 G 73 73 73 G G A . n A 1 74 G 74 74 74 G G A . n A 1 75 A 75 75 75 A A A . n A 1 76 A 76 76 76 A A A . n A 1 77 G 77 77 77 G G A . n A 1 78 A 78 78 78 A A A . n A 1 79 A 79 79 79 A A A . n A 1 80 A 80 80 80 A A A . n A 1 81 C 81 81 81 C C A . n A 1 82 U 82 82 82 U U A . n A 1 83 G 83 83 83 G G A . n A 1 84 C 84 84 84 C C A . n A 1 85 C 85 85 85 C C A . n A 1 86 G 86 86 86 G G A . n A 1 87 A 87 87 87 A A A . n A 1 88 U 88 88 88 U U A . n A 1 89 A 89 89 89 A A A . n A 1 90 U 90 90 90 U U A . n A 1 91 A 91 91 91 A A A . n A 1 92 C 92 92 92 C C A . n A 1 93 G 93 93 93 G G A . n A 1 94 G 94 94 94 G G A . n A 1 95 G 95 95 95 G G A . n A 1 96 A 96 96 96 A A A . n A 1 97 G 97 97 97 G G A . n A 1 98 U 98 98 98 U U A . n A 1 99 U 99 99 99 U U A . n A 1 100 C 100 100 100 C C A . n A 1 101 C 101 101 101 C C A . n A 1 102 U 102 102 102 U U A . n A 1 103 U 103 103 103 U U A . n A 1 104 G 104 104 104 G G A . n A 1 105 A 105 105 105 A A A . n A 1 106 G 106 106 106 G G A . n A 1 107 C 107 107 107 C C A . n A 1 108 G 108 108 108 G G A . n A 1 109 G 109 109 109 G G A . n A 1 110 G 110 110 110 G G A . n A 1 111 A 111 111 111 A A A . n A 1 112 G 112 112 112 G G A . n A 1 113 A 113 113 113 A A A . n A 1 114 U 114 114 114 U U A . n A 1 115 U 115 115 115 U U A . n A 1 116 C 116 116 116 C C A . n A 1 117 C 117 117 117 C C A . n A 1 118 A 118 118 118 A A A . n A 1 119 U 119 119 119 U U A . n A 1 120 G 120 120 120 G G A . n A 1 121 C 121 121 121 C C A . n A 1 122 C 122 122 122 C C A . n A 1 123 U 123 123 123 U U A . n A 1 124 A 124 124 124 A A A . n A 1 125 A 125 125 125 A A A . n A 1 126 G 126 126 126 G G A . n A 1 127 U 127 127 127 U U A . n A 1 128 C 128 128 128 C C A . n A 1 129 G 129 129 129 G G A . n A 1 130 C 130 130 130 C C A . n # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 2 2 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 3 3 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 4 4 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 5 5 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 6 6 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 7 7 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 8 8 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 9 9 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 10 10 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 11 11 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 12 12 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 13 13 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 14 14 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 15 15 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 16 16 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 17 17 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 18 18 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 19 19 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 20 20 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 6WLJ _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _struct.entry_id 6WLJ _struct.title 'ATP-TTR-3 with AMP models, 9.6 Angstrom resolution' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 6WLJ _struct_keywords.text 'aptamer, RNA' _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 6WLJ _struct_ref.pdbx_db_accession 6WLJ _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 6WLJ _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 130 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 6WLJ _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 130 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 130 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 0 ? 1 MORE 0 ? 1 'SSA (A^2)' 21130 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 130 N3 ? ? A G 2 A C 130 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 130 O2 ? ? A G 2 A C 130 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 130 N4 ? ? A G 2 A C 130 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 129 N1 ? ? A C 3 A G 129 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 129 O6 ? ? A C 3 A G 129 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 129 N2 ? ? A C 3 A G 129 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 128 N3 ? ? A G 4 A C 128 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 128 O2 ? ? A G 4 A C 128 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 128 N4 ? ? A G 4 A C 128 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 127 N3 ? ? A A 5 A U 127 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 127 O4 ? ? A A 5 A U 127 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 6 N3 ? ? ? 1_555 A G 126 O6 ? ? A U 6 A G 126 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog13 hydrog ? ? A U 6 O2 ? ? ? 1_555 A G 126 N1 ? ? A U 6 A G 126 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog14 hydrog ? ? A A 7 N1 ? ? ? 1_555 A A 60 N6 ? ? A A 7 A A 60 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog15 hydrog ? ? A A 7 N6 ? ? ? 1_555 A A 60 N1 ? ? A A 7 A A 60 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog16 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 123 O2 ? ? A A 7 A U 123 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog17 hydrog ? ? A A 7 N7 ? ? ? 1_555 A U 123 N3 ? ? A A 7 A U 123 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog18 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 125 N1 ? ? A U 8 A A 125 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 125 N6 ? ? A U 8 A A 125 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 9 N2 ? ? ? 1_555 A A 62 N3 ? ? A G 9 A A 62 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog21 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 122 N3 ? ? A G 9 A C 122 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 122 O2 ? ? A G 9 A C 122 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 122 N4 ? ? A G 9 A C 122 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 121 N3 ? ? A G 10 A C 121 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 121 O2 ? ? A G 10 A C 121 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 121 N4 ? ? A G 10 A C 121 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 120 N1 ? ? A C 11 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 120 O6 ? ? A C 11 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 120 N2 ? ? A C 11 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A A 12 N1 ? ? ? 1_555 A U 119 N3 ? ? A A 12 A U 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A A 12 N6 ? ? ? 1_555 A U 119 O4 ? ? A A 12 A U 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A U 13 N3 ? ? ? 1_555 A A 118 N1 ? ? A U 13 A A 118 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A U 13 O4 ? ? ? 1_555 A A 118 N6 ? ? A U 13 A A 118 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 14 N1 ? ? ? 1_555 A C 117 N3 ? ? A G 14 A C 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 14 N2 ? ? ? 1_555 A C 117 O2 ? ? A G 14 A C 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 14 O6 ? ? ? 1_555 A C 117 N4 ? ? A G 14 A C 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 15 N1 ? ? ? 1_555 A C 116 N3 ? ? A G 15 A C 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 15 N2 ? ? ? 1_555 A C 116 O2 ? ? A G 15 A C 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 15 O6 ? ? ? 1_555 A C 116 N4 ? ? A G 15 A C 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A A 16 N1 ? ? ? 1_555 A U 115 N3 ? ? A A 16 A U 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A A 16 N6 ? ? ? 1_555 A U 115 O4 ? ? A A 16 A U 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A A 17 N1 ? ? ? 1_555 A U 114 N3 ? ? A A 17 A U 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A A 17 N6 ? ? ? 1_555 A U 114 O4 ? ? A A 17 A U 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A U 18 N3 ? ? ? 1_555 A A 113 N1 ? ? A U 18 A A 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A U 18 O4 ? ? ? 1_555 A A 113 N6 ? ? A U 18 A A 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 19 N3 ? ? ? 1_555 A G 112 N1 ? ? A C 19 A G 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 19 N4 ? ? ? 1_555 A G 112 O6 ? ? A C 19 A G 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 19 O2 ? ? ? 1_555 A G 112 N2 ? ? A C 19 A G 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 21 N1 ? ? ? 1_555 A C 107 N3 ? ? A G 21 A C 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 21 N2 ? ? ? 1_555 A C 107 O2 ? ? A G 21 A C 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 21 O6 ? ? ? 1_555 A C 107 N4 ? ? A G 21 A C 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 22 N3 ? ? ? 1_555 A G 106 N1 ? ? A C 22 A G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 22 N4 ? ? ? 1_555 A G 106 O6 ? ? A C 22 A G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 22 O2 ? ? ? 1_555 A G 106 N2 ? ? A C 22 A G 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A U 23 N3 ? ? ? 1_555 A A 105 N1 ? ? A U 23 A A 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A U 23 O4 ? ? ? 1_555 A A 105 N6 ? ? A U 23 A A 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 24 N3 ? ? ? 1_555 A G 104 N1 ? ? A C 24 A G 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 24 N4 ? ? ? 1_555 A G 104 O6 ? ? A C 24 A G 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 104 N2 ? ? A C 24 A G 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A A 25 N1 ? ? ? 1_555 A U 103 N3 ? ? A A 25 A U 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A A 25 N6 ? ? ? 1_555 A U 103 O4 ? ? A A 25 A U 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A A 26 N1 ? ? ? 1_555 A U 102 N3 ? ? A A 26 A U 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A A 26 N6 ? ? ? 1_555 A U 102 O4 ? ? A A 26 A U 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 101 N3 ? ? A G 27 A C 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 101 O2 ? ? A G 27 A C 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 101 N4 ? ? A G 27 A C 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A G 28 N1 ? ? ? 1_555 A C 100 N3 ? ? A G 28 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 100 O2 ? ? A G 28 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A G 28 O6 ? ? ? 1_555 A C 100 N4 ? ? A G 28 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A A 29 N1 ? ? ? 1_555 A U 99 N3 ? ? A A 29 A U 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A A 29 N6 ? ? ? 1_555 A U 99 O4 ? ? A A 29 A U 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A A 30 N1 ? ? ? 1_555 A U 98 N3 ? ? A A 30 A U 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A A 30 N6 ? ? ? 1_555 A U 98 O4 ? ? A A 30 A U 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A C 31 N3 ? ? ? 1_555 A G 97 N1 ? ? A C 31 A G 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A C 31 N4 ? ? ? 1_555 A G 97 O6 ? ? A C 31 A G 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A C 31 O2 ? ? ? 1_555 A G 97 N2 ? ? A C 31 A G 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A U 32 N3 ? ? ? 1_555 A A 96 N1 ? ? A U 32 A A 96 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A U 32 O4 ? ? ? 1_555 A A 96 N6 ? ? A U 32 A A 96 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A G 33 N3 ? ? ? 1_555 A G 35 N2 ? ? A G 33 A G 35 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog80 hydrog ? ? A A 37 N6 ? ? ? 1_555 A G 94 N3 ? ? A A 37 A G 94 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog81 hydrog ? ? A A 37 N7 ? ? ? 1_555 A G 94 N2 ? ? A A 37 A G 94 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog82 hydrog ? ? A C 38 N3 ? ? ? 1_555 A G 93 N1 ? ? A C 38 A G 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A C 38 N4 ? ? ? 1_555 A G 93 O6 ? ? A C 38 A G 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A C 38 O2 ? ? ? 1_555 A G 93 N2 ? ? A C 38 A G 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A G 39 N1 ? ? ? 1_555 A C 92 N3 ? ? A G 39 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A G 39 N2 ? ? ? 1_555 A C 92 O2 ? ? A G 39 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A G 39 O6 ? ? ? 1_555 A C 92 N4 ? ? A G 39 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A U 40 N3 ? ? ? 1_555 A A 91 N1 ? ? A U 40 A A 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A U 40 O4 ? ? ? 1_555 A A 91 N6 ? ? A U 40 A A 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A A 41 N1 ? ? ? 1_555 A U 90 N3 ? ? A A 41 A U 90 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A A 41 N6 ? ? ? 1_555 A U 90 O4 ? ? A A 41 A U 90 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A U 42 N3 ? ? ? 1_555 A A 89 N1 ? ? A U 42 A A 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A U 42 O4 ? ? ? 1_555 A A 89 N6 ? ? A U 42 A A 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? A A 43 N1 ? ? ? 1_555 A U 88 N3 ? ? A A 43 A U 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A A 43 N6 ? ? ? 1_555 A U 88 O4 ? ? A A 43 A U 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A U 44 N3 ? ? ? 1_555 A A 87 N1 ? ? A U 44 A A 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? A U 44 O4 ? ? ? 1_555 A A 87 N6 ? ? A U 44 A A 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? A C 45 N3 ? ? ? 1_555 A G 86 N1 ? ? A C 45 A G 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? A C 45 N4 ? ? ? 1_555 A G 86 O6 ? ? A C 45 A G 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? A C 45 O2 ? ? ? 1_555 A G 86 N2 ? ? A C 45 A G 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog101 hydrog ? ? A G 46 N1 ? ? ? 1_555 A C 85 N3 ? ? A G 46 A C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog102 hydrog ? ? A G 46 N2 ? ? ? 1_555 A C 85 O2 ? ? A G 46 A C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog103 hydrog ? ? A G 46 O6 ? ? ? 1_555 A C 85 N4 ? ? A G 46 A C 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog104 hydrog ? ? A G 47 N1 ? ? ? 1_555 A C 84 N3 ? ? A G 47 A C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog105 hydrog ? ? A G 47 N2 ? ? ? 1_555 A C 84 O2 ? ? A G 47 A C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog106 hydrog ? ? A G 47 O6 ? ? ? 1_555 A C 84 N4 ? ? A G 47 A C 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog107 hydrog ? ? A G 48 O6 ? ? ? 1_555 A A 75 N6 ? ? A G 48 A A 75 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog108 hydrog ? ? A G 48 N1 ? ? ? 1_555 A G 83 O6 ? ? A G 48 A G 83 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog109 hydrog ? ? A C 49 N3 ? ? ? 1_555 A G 72 N1 ? ? A C 49 A G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog110 hydrog ? ? A C 49 N4 ? ? ? 1_555 A G 72 O6 ? ? A C 49 A G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog111 hydrog ? ? A C 49 O2 ? ? ? 1_555 A G 72 N2 ? ? A C 49 A G 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog112 hydrog ? ? A A 50 N1 ? ? ? 1_555 A U 71 N3 ? ? A A 50 A U 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog113 hydrog ? ? A A 50 N6 ? ? ? 1_555 A U 71 O4 ? ? A A 50 A U 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog114 hydrog ? ? A A 51 N1 ? ? ? 1_555 A U 70 N3 ? ? A A 51 A U 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog115 hydrog ? ? A A 51 N6 ? ? ? 1_555 A U 70 O4 ? ? A A 51 A U 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog116 hydrog ? ? A C 52 N3 ? ? ? 1_555 A G 69 N1 ? ? A C 52 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog117 hydrog ? ? A C 52 N4 ? ? ? 1_555 A G 69 O6 ? ? A C 52 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog118 hydrog ? ? A C 52 O2 ? ? ? 1_555 A G 69 N2 ? ? A C 52 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog119 hydrog ? ? A G 53 N1 ? ? ? 1_555 A C 68 N3 ? ? A G 53 A C 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog120 hydrog ? ? A G 53 N2 ? ? ? 1_555 A C 68 O2 ? ? A G 53 A C 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog121 hydrog ? ? A G 53 O6 ? ? ? 1_555 A C 68 N4 ? ? A G 53 A C 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog122 hydrog ? ? A A 54 N1 ? ? ? 1_555 A U 67 N3 ? ? A A 54 A U 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog123 hydrog ? ? A A 54 N6 ? ? ? 1_555 A U 67 O4 ? ? A A 54 A U 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog124 hydrog ? ? A C 55 N3 ? ? ? 1_555 A G 66 N1 ? ? A C 55 A G 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog125 hydrog ? ? A C 55 N4 ? ? ? 1_555 A G 66 O6 ? ? A C 55 A G 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog126 hydrog ? ? A C 55 O2 ? ? ? 1_555 A G 66 N2 ? ? A C 55 A G 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog127 hydrog ? ? A U 56 N3 ? ? ? 1_555 A A 65 N1 ? ? A U 56 A A 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog128 hydrog ? ? A U 56 O4 ? ? ? 1_555 A A 65 N6 ? ? A U 56 A A 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog129 hydrog ? ? A A 57 N1 ? ? ? 1_555 A U 64 N3 ? ? A A 57 A U 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog130 hydrog ? ? A A 57 N6 ? ? ? 1_555 A U 64 O4 ? ? A A 57 A U 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog131 hydrog ? ? A G 58 N1 ? ? ? 1_555 A C 63 N3 ? ? A G 58 A C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog132 hydrog ? ? A G 58 N2 ? ? ? 1_555 A C 63 O2 ? ? A G 58 A C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog133 hydrog ? ? A G 58 O6 ? ? ? 1_555 A C 63 N4 ? ? A G 58 A C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog134 hydrog ? ? A G 59 N2 ? ? ? 1_555 A A 62 N7 ? ? A G 59 A A 62 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog135 hydrog ? ? A A 75 N1 ? ? ? 1_555 A U 82 N3 ? ? A A 75 A U 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog136 hydrog ? ? A A 75 N6 ? ? ? 1_555 A U 82 O4 ? ? A A 75 A U 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog137 hydrog ? ? A A 76 N3 ? ? ? 1_555 A A 80 N6 ? ? A A 76 A A 80 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog138 hydrog ? ? A A 76 N3 ? ? ? 1_555 A C 81 N4 ? ? A A 76 A C 81 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 2 1 N4 A C 19 ? ? "O2'" A G 109 ? ? 2.12 3 2 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 4 3 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 5 4 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 6 5 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 7 6 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 8 6 "O2'" A G 110 ? ? O4 A U 114 ? ? 2.19 9 7 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 10 7 "O2'" A G 109 ? ? O6 A G 112 ? ? 2.11 11 8 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 12 9 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 13 10 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 14 10 "HO2'" A A 37 ? ? "O2'" A G 97 ? ? 1.59 15 10 "O2'" A G 35 ? ? O6 A G 94 ? ? 2.17 16 10 "O2'" A G 48 ? ? "O2'" A G 77 ? ? 2.19 17 11 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 18 12 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 19 12 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.16 20 12 "O2'" A A 75 ? ? O2 A U 82 ? ? 2.18 21 13 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 22 13 "O2'" A A 37 ? ? "O3'" A G 97 ? ? 2.12 23 14 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 24 14 H21 A G 74 ? ? "O5'" A G 77 ? ? 1.57 25 14 "O2'" A G 108 ? ? N7 A G 110 ? ? 2.19 26 15 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 27 15 "O2'" A A 37 ? ? "O2'" A G 97 ? ? 2.12 28 16 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 29 16 "O2'" A G 110 ? ? O4 A U 114 ? ? 2.12 30 17 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 31 18 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 32 19 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 33 20 "HO2'" A A 61 ? ? "O2'" A U 123 ? ? 1.54 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 3 "C2'" A A 78 ? ? "C3'" A A 78 ? ? "O3'" A A 78 ? ? 124.85 113.70 11.15 1.60 N 2 3 "C2'" A A 80 ? ? "C3'" A A 80 ? ? "O3'" A A 80 ? ? 126.26 113.70 12.56 1.60 N 3 10 "C2'" A G 33 ? ? "C3'" A G 33 ? ? "O3'" A G 33 ? ? 92.58 109.50 -16.92 2.20 N 4 11 "C1'" A G 77 ? ? "O4'" A G 77 ? ? "C4'" A G 77 ? ? 105.02 109.70 -4.68 0.70 N # _em_3d_fitting.entry_id 6WLJ _em_3d_fitting.id 1 _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_protocol ? _em_3d_fitting.ref_space ? _em_3d_fitting.target_criteria ? _em_3d_fitting.method ? # _em_3d_reconstruction.entry_id 6WLJ _em_3d_reconstruction.id 1 _em_3d_reconstruction.algorithm ? _em_3d_reconstruction.details ? _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.num_class_averages ? _em_3d_reconstruction.num_particles 39136 _em_3d_reconstruction.resolution 9.6 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.symmetry_type POINT _em_3d_reconstruction.method ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.magnification_calibration ? # _em_buffer.id 1 _em_buffer.details ? _em_buffer.pH 8.0 _em_buffer.specimen_id 1 _em_buffer.name ? # _em_entity_assembly.id 1 _em_entity_assembly.parent_id 0 _em_entity_assembly.details 'RNA generated by in vitro transcription' _em_entity_assembly.name 'ATP-TTR-3 with AMP' _em_entity_assembly.source NATURAL _em_entity_assembly.type COMPLEX _em_entity_assembly.entity_id_list 1 _em_entity_assembly.synonym ? _em_entity_assembly.oligomeric_details ? # _em_imaging.id 1 _em_imaging.entry_id 6WLJ _em_imaging.accelerating_voltage 200 _em_imaging.alignment_procedure ? _em_imaging.c2_aperture_diameter ? _em_imaging.calibrated_defocus_max ? _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_magnification ? _em_imaging.cryogen ? _em_imaging.details ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.illumination_mode 'FLOOD BEAM' _em_imaging.microscope_model 'FEI TALOS ARCTICA' _em_imaging.mode 'BRIGHT FIELD' _em_imaging.nominal_cs ? _em_imaging.nominal_defocus_max ? _em_imaging.nominal_defocus_min ? _em_imaging.nominal_magnification ? _em_imaging.recording_temperature_maximum ? _em_imaging.recording_temperature_minimum ? _em_imaging.residual_tilt ? _em_imaging.specimen_holder_model ? _em_imaging.specimen_id 1 _em_imaging.citation_id ? _em_imaging.date ? _em_imaging.temperature ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.astigmatism ? _em_imaging.detector_distance ? _em_imaging.electron_beam_tilt_params ? _em_imaging.specimen_holder_type ? # _em_sample_support.citation_id ? _em_sample_support.details unspecified _em_sample_support.film_material ? _em_sample_support.grid_material ? _em_sample_support.grid_mesh_size ? _em_sample_support.grid_type ? _em_sample_support.id 1 _em_sample_support.method ? _em_sample_support.specimen_id 1 # _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.chamber_temperature ? _em_vitrification.cryogen_name ETHANE _em_vitrification.details ? _em_vitrification.humidity ? _em_vitrification.instrument ? _em_vitrification.entry_id 6WLJ _em_vitrification.citation_id ? _em_vitrification.method ? _em_vitrification.temp ? _em_vitrification.time_resolved_state ? # _em_experiment.entry_id 6WLJ _em_experiment.id 1 _em_experiment.aggregation_state PARTICLE _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.entity_assembly_id 1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # _em_ctf_correction.id 1 _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.type 'PHASE FLIPPING ONLY' _em_ctf_correction.details ? # _em_entity_assembly_molwt.entity_assembly_id 1 _em_entity_assembly_molwt.id 1 _em_entity_assembly_molwt.experimental_flag YES _em_entity_assembly_molwt.units MEGADALTONS _em_entity_assembly_molwt.value 0.042 # _em_entity_assembly_naturalsource.id 1 _em_entity_assembly_naturalsource.entity_assembly_id 1 _em_entity_assembly_naturalsource.cell ? _em_entity_assembly_naturalsource.cellular_location ? _em_entity_assembly_naturalsource.ncbi_tax_id 32630 _em_entity_assembly_naturalsource.organ ? _em_entity_assembly_naturalsource.organelle ? _em_entity_assembly_naturalsource.organism 'synthetic construct' _em_entity_assembly_naturalsource.strain ? _em_entity_assembly_naturalsource.tissue ? # _em_image_processing.id 1 _em_image_processing.image_recording_id 1 _em_image_processing.details ? # _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.avg_electron_dose_per_image 30 _em_image_recording.average_exposure_time ? _em_image_recording.details ? _em_image_recording.detector_mode ? _em_image_recording.film_or_detector_model 'GATAN K2 SUMMIT (4k x 4k)' _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged ? _em_image_recording.num_real_images ? # loop_ _em_software.id _em_software.category _em_software.details _em_software.name _em_software.version _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id 1 'PARTICLE SELECTION' ? ? ? 1 ? ? 2 'IMAGE ACQUISITION' ? ? ? ? ? 1 3 MASKING ? ? ? ? ? ? 4 'CTF CORRECTION' ? ? ? 1 ? ? 5 'LAYERLINE INDEXING' ? ? ? ? ? ? 6 'DIFFRACTION INDEXING' ? ? ? ? ? ? 7 'MODEL FITTING' ? ? ? ? ? ? 8 'MODEL REFINEMENT' ? ? ? ? ? ? 9 OTHER ? ? ? ? ? ? 10 'INITIAL EULER ASSIGNMENT' ? ? ? 1 ? ? 11 'FINAL EULER ASSIGNMENT' ? ? ? 1 ? ? 12 CLASSIFICATION ? ? ? 1 ? ? 13 RECONSTRUCTION ? ? ? 1 ? ? # _em_specimen.id 1 _em_specimen.experiment_id 1 _em_specimen.concentration ? _em_specimen.details ? _em_specimen.embedding_applied NO _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 6WLJ 'double helix' 6WLJ 'a-form double helix' 6WLJ 'bulge loop' 6WLJ 'mismatched base pair' 6WLJ 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 A C 130 1_555 -0.145 -0.134 -0.124 -5.546 -5.225 -0.830 1 A_G2:C130_A A 2 ? A 130 ? 19 1 1 A C 3 1_555 A G 129 1_555 0.165 -0.129 -0.023 -0.857 -1.369 -0.863 2 A_C3:G129_A A 3 ? A 129 ? 19 1 1 A G 4 1_555 A C 128 1_555 -0.097 -0.119 -0.136 -5.663 -3.266 -2.068 3 A_G4:C128_A A 4 ? A 128 ? 19 1 1 A A 5 1_555 A U 127 1_555 -0.195 -0.055 0.001 -7.294 -10.334 0.646 4 A_A5:U127_A A 5 ? A 127 ? 20 1 1 A U 6 1_555 A G 126 1_555 2.241 -0.668 -0.064 10.926 -13.771 0.745 5 A_U6:G126_A A 6 ? A 126 ? 28 1 1 A U 8 1_555 A A 125 1_555 0.036 -0.240 0.006 18.274 41.525 -13.435 6 A_U8:A125_A A 8 ? A 125 ? 20 1 1 A A 60 1_555 A A 7 1_555 1.394 1.222 0.148 -21.437 -2.865 -178.590 7 A_A60:A7_A A 60 ? A 7 ? 1 2 1 A G 9 1_555 A C 122 1_555 -0.201 -0.155 -0.430 -6.277 -12.091 -2.542 8 A_G9:C122_A A 9 ? A 122 ? 19 1 1 A G 10 1_555 A C 121 1_555 -0.563 0.021 -0.156 -13.164 -22.181 6.743 9 A_G10:C121_A A 10 ? A 121 ? 19 1 1 A C 11 1_555 A G 120 1_555 0.152 -0.128 -0.015 -0.511 -1.918 -1.198 10 A_C11:G120_A A 11 ? A 120 ? 19 1 1 A A 12 1_555 A U 119 1_555 0.030 -0.074 -0.120 -2.646 -3.339 -3.652 11 A_A12:U119_A A 12 ? A 119 ? 20 1 1 A U 13 1_555 A A 118 1_555 0.055 -0.087 -0.093 -2.292 -4.788 -2.539 12 A_U13:A118_A A 13 ? A 118 ? 20 1 1 A G 14 1_555 A C 117 1_555 -0.100 -0.124 -0.111 -4.989 -3.737 -1.865 13 A_G14:C117_A A 14 ? A 117 ? 19 1 1 A G 15 1_555 A C 116 1_555 -0.111 -0.125 -0.095 -4.460 -4.231 -1.760 14 A_G15:C116_A A 15 ? A 116 ? 19 1 1 A A 16 1_555 A U 115 1_555 0.013 -0.078 -0.125 -2.960 -3.786 -3.374 15 A_A16:U115_A A 16 ? A 115 ? 20 1 1 A A 17 1_555 A U 114 1_555 0.010 -0.082 -0.132 -1.710 -4.810 -2.830 16 A_A17:U114_A A 17 ? A 114 ? 20 1 1 A U 18 1_555 A A 113 1_555 0.078 -0.097 -0.127 -1.419 -5.701 -2.107 17 A_U18:A113_A A 18 ? A 113 ? 20 1 1 A C 19 1_555 A G 112 1_555 0.158 -0.128 -0.001 -1.331 -1.415 -1.279 18 A_C19:G112_A A 19 ? A 112 ? 19 1 1 A G 21 1_555 A C 107 1_555 -0.136 -0.137 -0.112 -4.988 -5.578 -1.066 19 A_G21:C107_A A 21 ? A 107 ? 19 1 1 A C 22 1_555 A G 106 1_555 0.163 -0.131 -0.045 -0.256 -2.022 -0.898 20 A_C22:G106_A A 22 ? A 106 ? 19 1 1 A U 23 1_555 A A 105 1_555 0.077 -0.085 -0.146 -1.393 -3.962 -3.111 21 A_U23:A105_A A 23 ? A 105 ? 20 1 1 A C 24 1_555 A G 104 1_555 0.153 -0.131 -0.012 -1.458 -0.717 -1.150 22 A_C24:G104_A A 24 ? A 104 ? 19 1 1 A A 25 1_555 A U 103 1_555 0.032 -0.071 -0.147 -3.169 -2.979 -3.841 23 A_A25:U103_A A 25 ? A 103 ? 20 1 1 A A 26 1_555 A U 102 1_555 0.010 -0.085 -0.167 -2.278 -4.509 -2.905 24 A_A26:U102_A A 26 ? A 102 ? 20 1 1 A G 27 1_555 A C 101 1_555 -0.109 -0.127 -0.137 -5.537 -4.202 -1.711 25 A_G27:C101_A A 27 ? A 101 ? 19 1 1 A G 28 1_555 A C 100 1_555 -0.105 -0.120 -0.107 -4.862 -3.786 -1.871 26 A_G28:C100_A A 28 ? A 100 ? 19 1 1 A A 29 1_555 A U 99 1_555 0.016 -0.077 -0.129 -3.196 -3.679 -3.347 27 A_A29:U99_A A 29 ? A 99 ? 20 1 1 A A 30 1_555 A U 98 1_555 0.012 -0.082 -0.140 -1.579 -5.015 -2.746 28 A_A30:U98_A A 30 ? A 98 ? 20 1 1 A C 31 1_555 A G 97 1_555 0.161 -0.128 -0.050 0.592 -2.404 -0.987 29 A_C31:G97_A A 31 ? A 97 ? 19 1 1 A U 32 1_555 A A 96 1_555 0.069 -0.089 -0.127 -0.926 -4.164 -2.578 30 A_U32:A96_A A 32 ? A 96 ? 20 1 1 A G 33 1_555 A G 35 1_555 2.408 6.565 2.071 9.196 -24.528 147.078 31 A_G33:G35_A A 33 ? A 35 ? ? 11 1 A A 37 1_555 A G 94 1_555 -6.747 -4.112 -0.039 2.379 -15.199 -7.554 32 A_A37:G94_A A 37 ? A 94 ? 11 10 1 A C 38 1_555 A G 93 1_555 0.147 -0.140 -0.076 2.324 -3.587 -0.700 33 A_C38:G93_A A 38 ? A 93 ? 19 1 1 A G 39 1_555 A C 92 1_555 -0.107 -0.126 -0.155 -6.675 -4.498 -1.714 34 A_G39:C92_A A 39 ? A 92 ? 19 1 1 A U 40 1_555 A A 91 1_555 0.053 -0.088 -0.077 -3.950 -5.587 -2.797 35 A_U40:A91_A A 40 ? A 91 ? 20 1 1 A A 41 1_555 A U 90 1_555 0.036 -0.073 -0.061 -4.133 -1.950 -3.377 36 A_A41:U90_A A 41 ? A 90 ? 20 1 1 A U 42 1_555 A A 89 1_555 0.048 -0.083 -0.069 -1.513 -3.306 -2.596 37 A_U42:A89_A A 42 ? A 89 ? 20 1 1 A A 43 1_555 A U 88 1_555 0.020 -0.083 -0.092 -2.072 -3.265 -2.864 38 A_A43:U88_A A 43 ? A 88 ? 20 1 1 A U 44 1_555 A A 87 1_555 0.075 -0.090 -0.120 -0.811 -4.751 -2.370 39 A_U44:A87_A A 44 ? A 87 ? 20 1 1 A C 45 1_555 A G 86 1_555 0.158 -0.131 -0.018 -0.771 -1.357 -1.074 40 A_C45:G86_A A 45 ? A 86 ? 19 1 1 A G 46 1_555 A C 85 1_555 -0.097 -0.124 -0.123 -4.643 -3.456 -2.042 41 A_G46:C85_A A 46 ? A 85 ? 19 1 1 A G 47 1_555 A C 84 1_555 -0.112 -0.125 -0.104 -5.330 -5.379 -1.791 42 A_G47:C84_A A 47 ? A 84 ? 19 1 1 A G 48 1_555 A G 83 1_555 2.930 1.586 0.780 7.489 -26.012 -65.115 43 A_G48:G83_A A 48 ? A 83 ? ? 1 1 A A 75 1_555 A U 82 1_555 -0.564 -0.174 0.875 -40.310 12.725 25.984 44 A_A75:U82_A A 75 ? A 82 ? 20 1 1 A A 76 1_555 A A 80 1_555 6.289 -4.046 -0.564 16.198 23.690 -11.914 45 A_A76:A80_A A 76 ? A 80 ? ? 10 1 A C 49 1_555 A G 72 1_555 0.146 -0.140 -0.076 2.371 -3.508 -0.643 46 A_C49:G72_A A 49 ? A 72 ? 19 1 1 A A 50 1_555 A U 71 1_555 0.019 -0.086 -0.176 -5.010 -2.433 -2.902 47 A_A50:U71_A A 50 ? A 71 ? 20 1 1 A A 51 1_555 A U 70 1_555 0.014 -0.080 -0.153 -3.379 -3.763 -2.785 48 A_A51:U70_A A 51 ? A 70 ? 20 1 1 A C 52 1_555 A G 69 1_555 0.159 -0.130 -0.031 -0.071 -2.084 -0.981 49 A_C52:G69_A A 52 ? A 69 ? 19 1 1 A G 53 1_555 A C 68 1_555 -0.099 -0.124 -0.122 -4.823 -3.306 -1.965 50 A_G53:C68_A A 53 ? A 68 ? 19 1 1 A A 54 1_555 A U 67 1_555 0.019 -0.075 -0.122 -2.896 -4.249 -3.291 51 A_A54:U67_A A 54 ? A 67 ? 20 1 1 A C 55 1_555 A G 66 1_555 0.161 -0.127 -0.048 0.572 -2.102 -0.993 52 A_C55:G66_A A 55 ? A 66 ? 19 1 1 A U 56 1_555 A A 65 1_555 0.050 -0.086 -0.105 -1.634 -3.283 -3.033 53 A_U56:A65_A A 56 ? A 65 ? 20 1 1 A A 57 1_555 A U 64 1_555 0.030 -0.082 -0.133 -3.612 -2.758 -3.097 54 A_A57:U64_A A 57 ? A 64 ? 20 1 1 A G 58 1_555 A C 63 1_555 -0.318 -0.106 0.015 0.193 9.530 2.626 55 A_G58:C63_A A 58 ? A 63 ? 19 1 1 A G 59 1_555 A A 62 1_555 6.767 -5.345 1.195 11.902 -5.825 -20.679 56 A_G59:A62_A A 59 ? A 62 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 A C 130 1_555 A C 3 1_555 A G 129 1_555 0.034 -1.737 3.129 -0.150 4.333 33.642 -3.620 -0.080 2.889 7.447 0.257 33.912 1 AA_G2C3:G129C130_AA A 2 ? A 130 ? A 3 ? A 129 ? 1 A C 3 1_555 A G 129 1_555 A G 4 1_555 A C 128 1_555 0.048 -1.753 3.448 1.397 8.598 30.314 -4.803 0.167 2.855 16.031 -2.605 31.512 2 AA_C3G4:C128G129_AA A 3 ? A 129 ? A 4 ? A 128 ? 1 A G 4 1_555 A C 128 1_555 A A 5 1_555 A U 127 1_555 0.449 -1.402 3.460 0.868 2.365 29.945 -3.211 -0.680 3.353 4.567 -1.676 30.048 3 AA_G4A5:U127C128_AA A 4 ? A 128 ? A 5 ? A 127 ? 1 A A 5 1_555 A U 127 1_555 A U 6 1_555 A G 126 1_555 0.227 -1.308 2.836 4.245 6.691 40.375 -2.472 0.063 2.606 9.582 -6.080 41.113 4 AA_A5U6:G126U127_AA A 5 ? A 127 ? A 6 ? A 126 ? 1 A U 6 1_555 A G 126 1_555 A U 8 1_555 A A 125 1_555 -4.923 -0.287 2.720 -2.184 35.053 58.917 -1.406 4.344 2.408 32.697 2.037 67.774 5 AA_U6U8:A125G126_AA A 6 ? A 126 ? A 8 ? A 125 ? 1 A U 8 1_555 A A 125 1_555 A A 60 1_555 A A 7 1_555 2.339 -0.573 3.894 18.047 -10.632 -143.738 0.362 1.331 3.750 5.587 9.484 -144.363 6 AA_U8A60:A7A125_AA A 8 ? A 125 ? A 60 ? A 7 ? 1 A A 60 1_555 A A 7 1_555 A G 9 1_555 A C 122 1_555 -3.228 -4.488 4.823 24.007 15.524 -154.548 2.220 -1.533 5.102 -7.949 12.293 -155.349 7 AA_A60G9:C122A7_AA A 60 ? A 7 ? A 9 ? A 122 ? 1 A G 9 1_555 A C 122 1_555 A G 10 1_555 A C 121 1_555 0.960 -1.935 3.486 2.380 4.911 29.062 -4.865 -1.363 3.190 9.678 -4.690 29.559 8 AA_G9G10:C121C122_AA A 9 ? A 122 ? A 10 ? A 121 ? 1 A G 10 1_555 A C 121 1_555 A C 11 1_555 A G 120 1_555 -3.049 -1.861 3.846 -4.902 2.027 18.852 -6.721 5.951 4.271 6.034 14.594 19.578 9 AA_G10C11:G120C121_AA A 10 ? A 121 ? A 11 ? A 120 ? 1 A C 11 1_555 A G 120 1_555 A A 12 1_555 A U 119 1_555 0.017 -1.706 3.315 1.151 8.738 30.891 -4.568 0.164 2.741 16.001 -2.108 32.094 10 AA_C11A12:U119G120_AA A 11 ? A 120 ? A 12 ? A 119 ? 1 A A 12 1_555 A U 119 1_555 A U 13 1_555 A A 118 1_555 0.324 -1.691 3.348 0.609 7.173 32.119 -4.175 -0.471 2.918 12.765 -1.084 32.895 11 AA_A12U13:A118U119_AA A 12 ? A 119 ? A 13 ? A 118 ? 1 A U 13 1_555 A A 118 1_555 A G 14 1_555 A C 117 1_555 0.181 -1.663 3.311 0.232 9.677 31.590 -4.471 -0.282 2.699 17.275 -0.415 33.003 12 AA_U13G14:C117A118_AA A 13 ? A 118 ? A 14 ? A 117 ? 1 A G 14 1_555 A C 117 1_555 A G 15 1_555 A C 116 1_555 0.166 -1.645 3.267 -0.228 7.317 31.960 -4.105 -0.331 2.830 13.075 0.407 32.766 13 AA_G14G15:C116C117_AA A 14 ? A 117 ? A 15 ? A 116 ? 1 A G 15 1_555 A C 116 1_555 A A 16 1_555 A U 115 1_555 0.039 -1.612 3.215 -0.043 8.223 32.716 -4.016 -0.073 2.740 14.317 0.075 33.706 14 AA_G15A16:U115C116_AA A 15 ? A 116 ? A 16 ? A 115 ? 1 A A 16 1_555 A U 115 1_555 A A 17 1_555 A U 114 1_555 0.187 -1.666 3.237 -0.005 7.614 31.759 -4.196 -0.333 2.773 13.670 0.009 32.636 15 AA_A16A17:U114U115_AA A 16 ? A 115 ? A 17 ? A 114 ? 1 A A 17 1_555 A U 114 1_555 A U 18 1_555 A A 113 1_555 0.274 -1.698 3.297 0.608 6.713 32.154 -4.105 -0.385 2.898 11.956 -1.084 32.834 16 AA_A17U18:A113U114_AA A 17 ? A 114 ? A 18 ? A 113 ? 1 A U 18 1_555 A A 113 1_555 A C 19 1_555 A G 112 1_555 0.223 -1.715 3.259 0.006 7.644 32.649 -4.154 -0.385 2.797 13.370 -0.010 33.508 17 AA_U18C19:G112A113_AA A 18 ? A 113 ? A 19 ? A 112 ? 1 A G 21 1_555 A C 107 1_555 A C 22 1_555 A G 106 1_555 0.048 -1.750 3.094 -0.119 4.220 33.772 -3.606 -0.099 2.861 7.229 0.204 34.027 18 AA_G21C22:G106C107_AA A 21 ? A 107 ? A 22 ? A 106 ? 1 A C 22 1_555 A G 106 1_555 A U 23 1_555 A A 105 1_555 0.113 -1.799 3.319 1.962 5.973 30.661 -4.426 0.149 2.926 11.149 -3.662 31.284 19 AA_C22U23:A105G106_AA A 22 ? A 106 ? A 23 ? A 105 ? 1 A U 23 1_555 A A 105 1_555 A C 24 1_555 A G 104 1_555 0.309 -1.709 3.284 0.191 7.968 32.885 -4.155 -0.503 2.807 13.823 -0.331 33.811 20 AA_U23C24:G104A105_AA A 23 ? A 105 ? A 24 ? A 104 ? 1 A C 24 1_555 A G 104 1_555 A A 25 1_555 A U 103 1_555 0.014 -1.689 3.322 1.492 9.118 31.032 -4.554 0.223 2.727 16.586 -2.715 32.345 21 AA_C24A25:U103G104_AA A 24 ? A 104 ? A 25 ? A 103 ? 1 A A 25 1_555 A U 103 1_555 A A 26 1_555 A U 102 1_555 0.237 -1.657 3.265 0.154 7.926 32.026 -4.186 -0.394 2.787 14.097 -0.274 32.968 22 AA_A25A26:U102U103_AA A 25 ? A 103 ? A 26 ? A 102 ? 1 A A 26 1_555 A U 102 1_555 A G 27 1_555 A C 101 1_555 0.177 -1.739 3.392 -0.318 8.074 31.445 -4.493 -0.372 2.866 14.598 0.575 32.441 23 AA_A26G27:C101U102_AA A 26 ? A 102 ? A 27 ? A 101 ? 1 A G 27 1_555 A C 101 1_555 A G 28 1_555 A C 100 1_555 0.122 -1.671 3.276 -0.260 6.255 31.827 -4.042 -0.262 2.902 11.269 0.468 32.421 24 AA_G27G28:C100C101_AA A 27 ? A 101 ? A 28 ? A 100 ? 1 A G 28 1_555 A C 100 1_555 A A 29 1_555 A U 99 1_555 0.053 -1.614 3.213 -0.014 8.250 32.744 -4.018 -0.093 2.737 14.351 0.024 33.740 25 AA_G28A29:U99C100_AA A 28 ? A 100 ? A 29 ? A 99 ? 1 A A 29 1_555 A U 99 1_555 A A 30 1_555 A U 98 1_555 0.196 -1.659 3.222 0.114 7.408 31.717 -4.162 -0.332 2.775 13.328 -0.204 32.550 26 AA_A29A30:U98U99_AA A 29 ? A 99 ? A 30 ? A 98 ? 1 A A 30 1_555 A U 98 1_555 A C 31 1_555 A G 97 1_555 0.272 -1.699 3.226 -0.155 6.662 32.891 -3.969 -0.496 2.835 11.618 0.271 33.541 27 AA_A30C31:G97U98_AA A 30 ? A 98 ? A 31 ? A 97 ? 1 A C 31 1_555 A G 97 1_555 A U 32 1_555 A A 96 1_555 0.149 -1.780 3.331 1.758 6.276 30.539 -4.460 0.046 2.920 11.748 -3.290 31.211 28 AA_C31U32:A96G97_AA A 31 ? A 97 ? A 32 ? A 96 ? 1 A U 32 1_555 A A 96 1_555 A G 33 1_555 A G 35 1_555 -1.984 -4.379 3.007 -6.880 18.481 -45.484 3.682 -2.957 4.074 -22.688 -8.446 -49.366 29 AA_U32G33:G35A96_AA A 32 ? A 96 ? A 33 ? A 35 ? 1 A A 37 1_555 A G 94 1_555 A C 38 1_555 A G 93 1_555 0.355 -0.563 3.443 -8.610 6.446 71.362 -0.702 -0.601 3.333 5.495 7.339 72.062 30 AA_A37C38:G93G94_AA A 37 ? A 94 ? A 38 ? A 93 ? 1 A C 38 1_555 A G 93 1_555 A G 39 1_555 A C 92 1_555 -0.016 -1.907 3.475 1.149 8.259 30.831 -4.952 0.236 2.878 15.189 -2.112 31.912 31 AA_C38G39:C92G93_AA A 38 ? A 93 ? A 39 ? A 92 ? 1 A G 39 1_555 A C 92 1_555 A U 40 1_555 A A 91 1_555 0.144 -1.660 3.228 0.489 5.115 33.062 -3.687 -0.173 2.947 8.920 -0.853 33.448 32 AA_G39U40:A91C92_AA A 39 ? A 92 ? A 40 ? A 91 ? 1 A U 40 1_555 A A 91 1_555 A A 41 1_555 A U 90 1_555 0.119 -1.613 3.239 0.085 9.981 32.064 -4.302 -0.194 2.633 17.546 -0.149 33.543 33 AA_U40A41:U90A91_AA A 40 ? A 91 ? A 41 ? A 90 ? 1 A A 41 1_555 A U 90 1_555 A U 42 1_555 A A 89 1_555 0.312 -1.653 3.305 0.687 7.409 31.550 -4.211 -0.443 2.859 13.395 -1.241 32.394 34 AA_A41U42:A89U90_AA A 41 ? A 90 ? A 42 ? A 89 ? 1 A U 42 1_555 A A 89 1_555 A A 43 1_555 A U 88 1_555 0.143 -1.645 3.256 0.312 9.966 31.880 -4.391 -0.202 2.638 17.613 -0.552 33.364 35 AA_U42A43:U88A89_AA A 42 ? A 89 ? A 43 ? A 88 ? 1 A A 43 1_555 A U 88 1_555 A U 44 1_555 A A 87 1_555 0.284 -1.698 3.302 0.656 6.841 31.902 -4.162 -0.397 2.891 12.268 -1.177 32.615 36 AA_A43U44:A87U88_AA A 43 ? A 88 ? A 44 ? A 87 ? 1 A U 44 1_555 A A 87 1_555 A C 45 1_555 A G 86 1_555 0.242 -1.719 3.260 0.246 7.915 32.702 -4.185 -0.381 2.782 13.806 -0.429 33.622 37 AA_U44C45:G86A87_AA A 44 ? A 87 ? A 45 ? A 86 ? 1 A C 45 1_555 A G 86 1_555 A G 46 1_555 A C 85 1_555 0.102 -1.730 3.389 1.056 8.942 30.416 -4.756 0.001 2.783 16.593 -1.960 31.691 38 AA_C45G46:C85G86_AA A 45 ? A 86 ? A 46 ? A 85 ? 1 A G 46 1_555 A C 85 1_555 A G 47 1_555 A C 84 1_555 0.214 -1.664 3.296 -0.184 7.215 32.120 -4.113 -0.407 2.864 12.838 0.328 32.901 39 AA_G46G47:C84C85_AA A 46 ? A 85 ? A 47 ? A 84 ? 1 A G 47 1_555 A C 84 1_555 A G 48 1_555 A G 83 1_555 -3.610 -0.679 4.258 7.286 3.151 47.000 -1.147 5.181 3.641 3.918 -9.060 47.628 40 AA_G47G48:G83C84_AA A 47 ? A 84 ? A 48 ? A 83 ? 1 A G 48 1_555 A G 83 1_555 A A 75 1_555 A U 82 1_555 -0.263 -3.159 1.955 -2.653 37.838 85.350 -2.525 0.160 0.802 26.819 1.880 91.898 41 AA_G48A75:U82G83_AA A 48 ? A 83 ? A 75 ? A 82 ? 1 A A 75 1_555 A U 82 1_555 A A 76 1_555 A A 80 1_555 -0.932 -0.279 3.537 -5.514 16.549 72.385 -0.797 0.585 3.469 13.817 4.603 74.177 42 AA_A75A76:A80U82_AA A 75 ? A 82 ? A 76 ? A 80 ? 1 A C 49 1_555 A G 72 1_555 A A 50 1_555 A U 71 1_555 -0.145 -1.861 3.446 1.211 8.859 31.499 -4.801 0.463 2.825 15.922 -2.177 32.713 43 AA_C49A50:U71G72_AA A 49 ? A 72 ? A 50 ? A 71 ? 1 A A 50 1_555 A U 71 1_555 A A 51 1_555 A U 70 1_555 0.160 -1.707 3.225 0.154 7.129 31.903 -4.185 -0.260 2.789 12.771 -0.276 32.670 44 AA_A50A51:U70U71_AA A 50 ? A 71 ? A 51 ? A 70 ? 1 A A 51 1_555 A U 70 1_555 A C 52 1_555 A G 69 1_555 0.297 -1.701 3.212 -0.029 5.907 32.672 -3.907 -0.524 2.869 10.394 0.051 33.187 45 AA_A51C52:G69U70_AA A 51 ? A 70 ? A 52 ? A 69 ? 1 A C 52 1_555 A G 69 1_555 A G 53 1_555 A C 68 1_555 0.069 -1.751 3.412 1.116 8.856 30.492 -4.780 0.074 2.807 16.402 -2.067 31.742 46 AA_C52G53:C68G69_AA A 52 ? A 69 ? A 53 ? A 68 ? 1 A G 53 1_555 A C 68 1_555 A A 54 1_555 A U 67 1_555 0.110 -1.614 3.207 -0.009 7.932 32.799 -3.974 -0.191 2.752 13.798 0.016 33.719 47 AA_G53A54:U67C68_AA A 53 ? A 68 ? A 54 ? A 67 ? 1 A A 54 1_555 A U 67 1_555 A C 55 1_555 A G 66 1_555 0.333 -1.684 3.208 -0.054 6.004 32.647 -3.891 -0.592 2.861 10.569 0.095 33.180 48 AA_A54C55:G66U67_AA A 54 ? A 67 ? A 55 ? A 66 ? 1 A C 55 1_555 A G 66 1_555 A U 56 1_555 A A 65 1_555 0.092 -1.788 3.376 1.587 7.263 30.747 -4.589 0.116 2.889 13.452 -2.940 31.612 49 AA_C55U56:A65G66_AA A 55 ? A 66 ? A 56 ? A 65 ? 1 A U 56 1_555 A A 65 1_555 A A 57 1_555 A U 64 1_555 0.182 -1.646 3.306 0.425 10.496 32.344 -4.390 -0.247 2.659 18.251 -0.739 33.964 50 AA_U56A57:U64A65_AA A 56 ? A 65 ? A 57 ? A 64 ? 1 A A 57 1_555 A U 64 1_555 A G 58 1_555 A C 63 1_555 -0.085 -1.643 3.839 -11.627 14.712 28.730 -5.285 -1.825 2.576 26.397 20.862 34.200 51 AA_A57G58:C63U64_AA A 57 ? A 64 ? A 58 ? A 63 ? 1 A G 58 1_555 A C 63 1_555 A G 59 1_555 A A 62 1_555 -2.527 -0.828 2.884 1.547 11.141 55.310 -1.412 2.751 2.620 11.865 -1.647 56.354 52 AA_G58G59:A62C63_AA A 58 ? A 63 ? A 59 ? A 62 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Institutes of Health/Office of the Director' 'United States' 'S10 OD021600' 1 'National Institutes of Health/National Institute Of Allergy and Infectious Diseases (NIH/NIAID)' 'United States' 'R21 AI145647' 2 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' 'P41GM103832, R01GM079429, U54GM103297, R35 GM112579' 3 # _atom_sites.entry_id 6WLJ _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_