data_6WR9 # _entry.id 6WR9 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 6WR9 pdb_00006wr9 10.2210/pdb6wr9/pdb WWPDB D_1000248857 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 6WR9 _pdbx_database_status.recvd_initial_deposition_date 2020-04-29 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Simmons, C.R.' 1 0000-0002-2290-6132 'MacCulloch, T.' 2 0000-0001-5875-3361 'Stephanopoulos, N.' 3 0000-0001-7859-410X 'Yan, H.' 4 0000-0001-7397-9852 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nat Commun' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2041-1723 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 13 _citation.language ? _citation.page_first 3112 _citation.page_last 3112 _citation.title 'The influence of Holliday junction sequence and dynamics on DNA crystal self-assembly.' _citation.year 2022 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41467-022-30779-6 _citation.pdbx_database_id_PubMed 35662248 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Simmons, C.R.' 1 ? primary 'MacCulloch, T.' 2 ? primary 'Krepl, M.' 3 0000-0002-9833-4281 primary 'Matthies, M.' 4 ? primary 'Buchberger, A.' 5 ? primary 'Crawford, I.' 6 ? primary 'Sponer, J.' 7 0000-0001-6558-6186 primary 'Sulc, P.' 8 0000-0003-1565-6769 primary 'Stephanopoulos, N.' 9 0000-0001-7859-410X primary 'Yan, H.' 10 0000-0001-7397-9852 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 6WR9 _cell.details ? _cell.formula_units_Z ? _cell.length_a 68.988 _cell.length_a_esd ? _cell.length_b 68.988 _cell.length_b_esd ? _cell.length_c 60.793 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 3 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 6WR9 _symmetry.cell_setting ? _symmetry.Int_Tables_number 145 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 32' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*GP*AP*GP*CP*AP*GP*AP*CP*TP*AP*GP*AP*CP*AP*CP*CP*AP*CP*TP*CP*A)-3') ; 6410.177 1 ? ? ? ? 2 polymer syn ;DNA (5'-D(P*TP*GP*TP*CP*T)-3') ; 1486.009 1 ? ? ? ? 3 polymer syn ;DNA (5'-D(*TP*CP*TP*GP*AP*GP*TP*GP*G)-3') ; 2786.833 1 ? ? ? ? 4 polymer syn ;DNA (5'-D(P*AP*GP*TP*CP*TP*GP*C)-3') ; 2113.410 1 ? ? ? ? 5 non-polymer syn 'MAGNESIUM ION' 24.305 1 ? ? ? ? 6 non-polymer syn 'CACODYLATE ION' 136.989 2 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no no ;(DG)(DA)(DG)(DC)(DA)(DG)(DA)(DC)(DT)(DA)(DG)(DA)(DC)(DA)(DC)(DC)(DA)(DC)(DT)(DC) (DA) ; GAGCAGACTAGACACCACTCA A ? 2 polydeoxyribonucleotide no no '(DT)(DG)(DT)(DC)(DT)' TGTCT B ? 3 polydeoxyribonucleotide no no '(DT)(DC)(DT)(DG)(DA)(DG)(DT)(DG)(DG)' TCTGAGTGG C ? 4 polydeoxyribonucleotide no no '(DA)(DG)(DT)(DC)(DT)(DG)(DC)' AGTCTGC D ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DA n 1 3 DG n 1 4 DC n 1 5 DA n 1 6 DG n 1 7 DA n 1 8 DC n 1 9 DT n 1 10 DA n 1 11 DG n 1 12 DA n 1 13 DC n 1 14 DA n 1 15 DC n 1 16 DC n 1 17 DA n 1 18 DC n 1 19 DT n 1 20 DC n 1 21 DA n 2 1 DT n 2 2 DG n 2 3 DT n 2 4 DC n 2 5 DT n 3 1 DT n 3 2 DC n 3 3 DT n 3 4 DG n 3 5 DA n 3 6 DG n 3 7 DT n 3 8 DG n 3 9 DG n 4 1 DA n 4 2 DG n 4 3 DT n 4 4 DC n 4 5 DT n 4 6 DG n 4 7 DC n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 21 'synthetic construct' ? 32630 ? 2 1 sample 1 5 'synthetic construct' ? 32630 ? 3 1 sample 1 9 'synthetic construct' ? 32630 ? 4 1 sample 1 7 'synthetic construct' ? 32630 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 6WR9 6WR9 ? 1 ? 1 2 PDB 6WR9 6WR9 ? 2 ? 1 3 PDB 6WR9 6WR9 ? 3 ? 1 4 PDB 6WR9 6WR9 ? 4 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 6WR9 A 1 ? 21 ? 6WR9 1 ? 21 ? 1 21 2 2 6WR9 B 1 ? 5 ? 6WR9 1 ? 5 ? 1 5 3 3 6WR9 C 1 ? 9 ? 6WR9 1 ? 9 ? 1 9 4 4 6WR9 D 1 ? 7 ? 6WR9 10 ? 16 ? 10 16 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight CAC non-polymer . 'CACODYLATE ION' dimethylarsinate 'C2 H6 As O2 -1' 136.989 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 6WR9 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 6.53 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 81.16 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 298 _exptl_crystal_grow.temp_details 'temperature gradient generated from 60 to 25 C at 0.3 degrees per hour' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.5 mL of 0.05 M Cacodylate pH 7.0 with 20 mM MgCl2, 1.0 mM spermine, 1.0 mM CoH18N6, and 15% Ethanol was added to the reservoir with 2 uL added to the drop containing 4 uL of DNA stock ; _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS3 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2018-04-15 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'ALS BEAMLINE 5.0.2' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 5.0.2 _diffrn_source.pdbx_synchrotron_site ALS # _reflns.B_iso_Wilson_estimate 62.070 _reflns.entry_id 6WR9 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.050 _reflns.d_resolution_low 50.000 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 5625 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 93.400 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 9.200 _reflns.pdbx_Rmerge_I_obs 0.070 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 6.100 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 0.715 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.074 _reflns.pdbx_Rpim_I_all 0.023 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 1.0 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_all _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split 3.050 3.100 ? ? ? ? ? ? 220 72.800 ? ? ? ? 0.470 ? ? ? ? ? ? ? ? 6.300 ? 0.493 ? ? 0.504 0.177 ? 1 1 0.953 ? ? 3.100 3.160 ? ? ? ? ? ? 217 72.100 ? ? ? ? 0.320 ? ? ? ? ? ? ? ? 6.200 ? 0.493 ? ? 0.345 0.122 ? 2 1 0.963 ? ? 3.160 3.220 ? ? ? ? ? ? 241 84.300 ? ? ? ? 0.151 ? ? ? ? ? ? ? ? 7.000 ? 0.656 ? ? 0.160 0.054 ? 3 1 0.996 ? ? 3.220 3.290 ? ? ? ? ? ? 249 81.900 ? ? ? ? 0.111 ? ? ? ? ? ? ? ? 7.400 ? 0.969 ? ? 0.117 0.036 ? 4 1 0.998 ? ? 3.290 3.360 ? ? ? ? ? ? 282 88.100 ? ? ? ? 0.195 ? ? ? ? ? ? ? ? 7.700 ? 0.592 ? ? 0.207 0.067 ? 5 1 0.992 ? ? 3.360 3.430 ? ? ? ? ? ? 266 92.000 ? ? ? ? 0.160 ? ? ? ? ? ? ? ? 8.000 ? 1.041 ? ? 0.170 0.056 ? 6 1 0.986 ? ? 3.430 3.520 ? ? ? ? ? ? 271 91.200 ? ? ? ? 0.241 ? ? ? ? ? ? ? ? 8.200 ? 0.527 ? ? 0.255 0.083 ? 7 1 0.990 ? ? 3.520 3.620 ? ? ? ? ? ? 290 95.100 ? ? ? ? 0.212 ? ? ? ? ? ? ? ? 8.700 ? 0.526 ? ? 0.225 0.072 ? 8 1 0.993 ? ? 3.620 3.720 ? ? ? ? ? ? 274 92.900 ? ? ? ? 0.370 ? ? ? ? ? ? ? ? 8.600 ? 0.794 ? ? 0.394 0.131 ? 9 1 0.955 ? ? 3.720 3.840 ? ? ? ? ? ? 301 98.400 ? ? ? ? 0.224 ? ? ? ? ? ? ? ? 9.000 ? 0.492 ? ? 0.237 0.078 ? 10 1 0.994 ? ? 3.840 3.980 ? ? ? ? ? ? 309 100.000 ? ? ? ? 0.199 ? ? ? ? ? ? ? ? 9.400 ? 0.748 ? ? 0.210 0.067 ? 11 1 0.995 ? ? 3.980 4.140 ? ? ? ? ? ? 291 100.000 ? ? ? ? 0.179 ? ? ? ? ? ? ? ? 10.400 ? 0.556 ? ? 0.189 0.058 ? 12 1 0.994 ? ? 4.140 4.330 ? ? ? ? ? ? 315 100.000 ? ? ? ? 0.157 ? ? ? ? ? ? ? ? 10.600 ? 0.538 ? ? 0.165 0.051 ? 13 1 0.995 ? ? 4.330 4.560 ? ? ? ? ? ? 310 100.000 ? ? ? ? 0.146 ? ? ? ? ? ? ? ? 10.600 ? 0.537 ? ? 0.153 0.047 ? 14 1 0.995 ? ? 4.560 4.840 ? ? ? ? ? ? 282 100.000 ? ? ? ? 0.118 ? ? ? ? ? ? ? ? 10.500 ? 0.625 ? ? 0.124 0.038 ? 15 1 0.996 ? ? 4.840 5.210 ? ? ? ? ? ? 293 100.000 ? ? ? ? 0.080 ? ? ? ? ? ? ? ? 10.200 ? 0.663 ? ? 0.084 0.026 ? 16 1 0.998 ? ? 5.210 5.740 ? ? ? ? ? ? 309 100.000 ? ? ? ? 0.062 ? ? ? ? ? ? ? ? 10.800 ? 0.787 ? ? 0.065 0.020 ? 17 1 0.997 ? ? 5.740 6.570 ? ? ? ? ? ? 304 100.000 ? ? ? ? 0.061 ? ? ? ? ? ? ? ? 10.800 ? 0.782 ? ? 0.064 0.019 ? 18 1 0.999 ? ? 6.570 8.270 ? ? ? ? ? ? 305 100.000 ? ? ? ? 0.047 ? ? ? ? ? ? ? ? 10.200 ? 0.992 ? ? 0.049 0.015 ? 19 1 0.999 ? ? 8.270 50.000 ? ? ? ? ? ? 296 99.300 ? ? ? ? 0.040 ? ? ? ? ? ? ? ? 10.400 ? 1.290 ? ? 0.042 0.014 ? 20 1 0.999 ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max 172.760 _refine.B_iso_mean 110.8124 _refine.B_iso_min 55.050 _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 6WR9 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.0710 _refine.ls_d_res_low 34.4940 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 5511 _refine.ls_number_reflns_R_free 264 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 91.2900 _refine.ls_percent_reflns_R_free 4.7900 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2239 _refine.ls_R_factor_R_free 0.2463 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2228 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details ? _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.990 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 5KEK _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 33.3900 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.0600 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id final _refine_hist.details ? _refine_hist.d_res_high 3.0710 _refine_hist.d_res_low 34.4940 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 858 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total 42 _refine_hist.pdbx_B_iso_mean_ligand 133.69 _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 855 _refine_hist.pdbx_number_atoms_ligand 3 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.009 ? 956 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.985 ? 1467 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.049 ? 166 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.007 ? 42 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 34.435 ? 406 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 3.0711 3.8685 . . 117 2381 83.0000 . . . 0.3871 0.0000 0.3372 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.8685 34.4940 . . 147 2866 100.0000 . . . 0.2122 0.0000 0.1900 . . . . . . . . . . . # _struct.entry_id 6WR9 _struct.title 'Self-assembly of a 3D DNA crystal lattice (4x5 duplex version) containing the J32 immobile Holliday junction' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 6WR9 _struct_keywords.text 'Structural DNA nanotechnology, immobile Holliday junctions, 3D DNA self-assembly, designer DNA crystals, DNA' _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 5 ? F N N 6 ? G N N 6 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 3 N1 ? ? ? 1_555 D DC 7 N3 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DG 3 N2 ? ? ? 1_555 D DC 7 O2 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DG 3 O6 ? ? ? 1_555 D DC 7 N4 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DC 4 N3 ? ? ? 1_555 D DG 6 N1 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DC 4 N4 ? ? ? 1_555 D DG 6 O6 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DC 4 O2 ? ? ? 1_555 D DG 6 N2 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DA 5 N1 ? ? ? 1_555 D DT 5 N3 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DA 5 N6 ? ? ? 1_555 D DT 5 O4 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DG 6 N1 ? ? ? 1_555 D DC 4 N3 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DG 6 N2 ? ? ? 1_555 D DC 4 O2 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DG 6 O6 ? ? ? 1_555 D DC 4 N4 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DA 7 N1 ? ? ? 1_555 D DT 3 N3 ? ? A DA 7 D DT 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DA 7 N6 ? ? ? 1_555 D DT 3 O4 ? ? A DA 7 D DT 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DC 8 N3 ? ? ? 1_555 D DG 2 N1 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DC 8 N4 ? ? ? 1_555 D DG 2 O6 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 8 O2 ? ? ? 1_555 D DG 2 N2 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DT 9 N3 ? ? ? 1_555 D DA 1 N1 ? ? A DT 9 D DA 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DT 9 O4 ? ? ? 1_555 D DA 1 N6 ? ? A DT 9 D DA 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DA 10 N1 ? ? ? 1_555 B DT 5 N3 ? ? A DA 10 B DT 5 1_555 ? ? ? ? ? ? 'DA-DT PAIR' ? ? ? hydrog20 hydrog ? ? A DG 11 N1 ? ? ? 1_555 B DC 4 N3 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DG 11 N2 ? ? ? 1_555 B DC 4 O2 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DG 11 O6 ? ? ? 1_555 B DC 4 N4 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DA 12 N1 ? ? ? 1_555 B DT 3 N3 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DA 12 N6 ? ? ? 1_555 B DT 3 O4 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DC 13 N3 ? ? ? 1_555 B DG 2 N1 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DC 13 N4 ? ? ? 1_555 B DG 2 O6 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DC 13 O2 ? ? ? 1_555 B DG 2 N2 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DA 14 N1 ? ? ? 1_555 B DT 1 N3 ? ? A DA 14 B DT 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DA 14 N6 ? ? ? 1_555 B DT 1 O4 ? ? A DA 14 B DT 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A DC 15 N3 ? ? ? 1_555 C DG 9 N1 ? ? A DC 15 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A DC 15 N4 ? ? ? 1_555 C DG 9 O6 ? ? A DC 15 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A DC 15 O2 ? ? ? 1_555 C DG 9 N2 ? ? A DC 15 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DC 16 N3 ? ? ? 1_555 C DG 8 N1 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DC 16 N4 ? ? ? 1_555 C DG 8 O6 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DC 16 O2 ? ? ? 1_555 C DG 8 N2 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DA 17 N1 ? ? ? 1_555 C DT 7 N3 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DA 17 N6 ? ? ? 1_555 C DT 7 O4 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DC 18 N3 ? ? ? 1_555 C DG 6 N1 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DC 18 N4 ? ? ? 1_555 C DG 6 O6 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DC 18 O2 ? ? ? 1_555 C DG 6 N2 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DT 19 N3 ? ? ? 1_555 C DA 5 N1 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DT 19 O4 ? ? ? 1_555 C DA 5 N6 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DC 20 N3 ? ? ? 1_555 C DG 4 N1 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DC 20 N4 ? ? ? 1_555 C DG 4 O6 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A DC 20 O2 ? ? ? 1_555 C DG 4 N2 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A DA 21 N1 ? ? ? 1_555 C DT 3 N3 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A DA 21 N6 ? ? ? 1_555 C DT 3 O4 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 6WR9 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.014495 _atom_sites.fract_transf_matrix[1][2] 0.008369 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.016738 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.016449 _atom_sites.fract_transf_vector[1] 0.000000 _atom_sites.fract_transf_vector[2] 0.000000 _atom_sites.fract_transf_vector[3] 0.000000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol AS C MG N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DA 2 2 2 DA DA A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DC 4 4 4 DC DC A . n A 1 5 DA 5 5 5 DA DA A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DA 7 7 7 DA DA A . n A 1 8 DC 8 8 8 DC DC A . n A 1 9 DT 9 9 9 DT DT A . n A 1 10 DA 10 10 10 DA DA A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DA 12 12 12 DA DA A . n A 1 13 DC 13 13 13 DC DC A . n A 1 14 DA 14 14 14 DA DA A . n A 1 15 DC 15 15 15 DC DC A . n A 1 16 DC 16 16 16 DC DC A . n A 1 17 DA 17 17 17 DA DA A . n A 1 18 DC 18 18 18 DC DC A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DC 20 20 20 DC DC A . n A 1 21 DA 21 21 21 DA DA A . n B 2 1 DT 1 1 1 DT DT B . n B 2 2 DG 2 2 2 DG DG B . n B 2 3 DT 3 3 3 DT DT B . n B 2 4 DC 4 4 4 DC DC B . n B 2 5 DT 5 5 5 DT DT B . n C 3 1 DT 1 1 1 DT DT C . n C 3 2 DC 2 2 2 DC DC C . n C 3 3 DT 3 3 3 DT DT C . n C 3 4 DG 4 4 4 DG DG C . n C 3 5 DA 5 5 5 DA DA C . n C 3 6 DG 6 6 6 DG DG C . n C 3 7 DT 7 7 7 DT DT C . n C 3 8 DG 8 8 8 DG DG C . n C 3 9 DG 9 9 9 DG DG C . n D 4 1 DA 1 10 10 DA DA D . n D 4 2 DG 2 11 11 DG DG D . n D 4 3 DT 3 12 12 DT DT D . n D 4 4 DC 4 13 13 DC DC D . n D 4 5 DT 5 14 14 DT DT D . n D 4 6 DG 6 15 15 DG DG D . n D 4 7 DC 7 16 16 DC DC D . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code E 5 MG 1 101 1 MG MG B . F 6 CAC 1 101 3 CAC AS C . G 6 CAC 1 101 2 CAC AS D . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details tetrameric _pdbx_struct_assembly.oligomeric_count 4 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 2550 ? 1 MORE -18 ? 1 'SSA (A^2)' 7860 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2021-07-14 2 'Structure model' 1 1 2022-07-06 3 'Structure model' 1 2 2023-10-18 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 2 'Structure model' database_2 4 3 'Structure model' chem_comp_atom 5 3 'Structure model' chem_comp_bond 6 3 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_CSD' 4 2 'Structure model' '_citation.journal_id_ISSN' 5 2 'Structure model' '_citation.journal_volume' 6 2 'Structure model' '_citation.page_first' 7 2 'Structure model' '_citation.page_last' 8 2 'Structure model' '_citation.pdbx_database_id_DOI' 9 2 'Structure model' '_citation.pdbx_database_id_PubMed' 10 2 'Structure model' '_citation.title' 11 2 'Structure model' '_citation.year' 12 2 'Structure model' '_database_2.pdbx_DOI' 13 2 'Structure model' '_database_2.pdbx_database_accession' # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 2 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.11.1_2575 3 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? 3.25 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 5 # _pdbx_entry_details.entry_id 6WR9 _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 "O3'" A DC 16 ? ? "C3'" A DC 16 ? ? 1.379 1.419 -0.040 0.006 N 2 1 "O3'" C DG 8 ? ? "C3'" C DG 8 ? ? 1.380 1.419 -0.039 0.006 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A DC 20 ? ? "C1'" A DC 20 ? ? N1 A DC 20 ? ? 110.50 108.30 2.20 0.30 N 2 1 "O4'" B DT 1 ? ? "C4'" B DT 1 ? ? "C3'" B DT 1 ? ? 101.90 104.50 -2.60 0.40 N 3 1 "O4'" C DG 9 ? ? "C1'" C DG 9 ? ? N9 C DG 9 ? ? 111.29 108.30 2.99 0.30 N 4 1 "O4'" D DA 10 ? ? "C1'" D DA 10 ? ? N9 D DA 10 ? ? 110.10 108.30 1.80 0.30 N # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 N 1 C CAC 101 ? O1 ? F CAC 1 O1 2 1 N 1 C CAC 101 ? O2 ? F CAC 1 O2 3 1 N 1 C CAC 101 ? C1 ? F CAC 1 C1 4 1 N 1 C CAC 101 ? C2 ? F CAC 1 C2 5 1 N 1 D CAC 101 ? O1 ? G CAC 1 O1 6 1 N 1 D CAC 101 ? O2 ? G CAC 1 O2 7 1 N 1 D CAC 101 ? C1 ? G CAC 1 C1 8 1 N 1 D CAC 101 ? C2 ? G CAC 1 C2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal CAC AS AS N N 1 CAC O1 O N N 2 CAC O2 O N N 3 CAC C1 C N N 4 CAC C2 C N N 5 CAC H11 H N N 6 CAC H12 H N N 7 CAC H13 H N N 8 CAC H21 H N N 9 CAC H22 H N N 10 CAC H23 H N N 11 DA OP3 O N N 12 DA P P N N 13 DA OP1 O N N 14 DA OP2 O N N 15 DA "O5'" O N N 16 DA "C5'" C N N 17 DA "C4'" C N R 18 DA "O4'" O N N 19 DA "C3'" C N S 20 DA "O3'" O N N 21 DA "C2'" C N N 22 DA "C1'" C N R 23 DA N9 N Y N 24 DA C8 C Y N 25 DA N7 N Y N 26 DA C5 C Y N 27 DA C6 C Y N 28 DA N6 N N N 29 DA N1 N Y N 30 DA C2 C Y N 31 DA N3 N Y N 32 DA C4 C Y N 33 DA HOP3 H N N 34 DA HOP2 H N N 35 DA "H5'" H N N 36 DA "H5''" H N N 37 DA "H4'" H N N 38 DA "H3'" H N N 39 DA "HO3'" H N N 40 DA "H2'" H N N 41 DA "H2''" H N N 42 DA "H1'" H N N 43 DA H8 H N N 44 DA H61 H N N 45 DA H62 H N N 46 DA H2 H N N 47 DC OP3 O N N 48 DC P P N N 49 DC OP1 O N N 50 DC OP2 O N N 51 DC "O5'" O N N 52 DC "C5'" C N N 53 DC "C4'" C N R 54 DC "O4'" O N N 55 DC "C3'" C N S 56 DC "O3'" O N N 57 DC "C2'" C N N 58 DC "C1'" C N R 59 DC N1 N N N 60 DC C2 C N N 61 DC O2 O N N 62 DC N3 N N N 63 DC C4 C N N 64 DC N4 N N N 65 DC C5 C N N 66 DC C6 C N N 67 DC HOP3 H N N 68 DC HOP2 H N N 69 DC "H5'" H N N 70 DC "H5''" H N N 71 DC "H4'" H N N 72 DC "H3'" H N N 73 DC "HO3'" H N N 74 DC "H2'" H N N 75 DC "H2''" H N N 76 DC "H1'" H N N 77 DC H41 H N N 78 DC H42 H N N 79 DC H5 H N N 80 DC H6 H N N 81 DG OP3 O N N 82 DG P P N N 83 DG OP1 O N N 84 DG OP2 O N N 85 DG "O5'" O N N 86 DG "C5'" C N N 87 DG "C4'" C N R 88 DG "O4'" O N N 89 DG "C3'" C N S 90 DG "O3'" O N N 91 DG "C2'" C N N 92 DG "C1'" C N R 93 DG N9 N Y N 94 DG C8 C Y N 95 DG N7 N Y N 96 DG C5 C Y N 97 DG C6 C N N 98 DG O6 O N N 99 DG N1 N N N 100 DG C2 C N N 101 DG N2 N N N 102 DG N3 N N N 103 DG C4 C Y N 104 DG HOP3 H N N 105 DG HOP2 H N N 106 DG "H5'" H N N 107 DG "H5''" H N N 108 DG "H4'" H N N 109 DG "H3'" H N N 110 DG "HO3'" H N N 111 DG "H2'" H N N 112 DG "H2''" H N N 113 DG "H1'" H N N 114 DG H8 H N N 115 DG H1 H N N 116 DG H21 H N N 117 DG H22 H N N 118 DT OP3 O N N 119 DT P P N N 120 DT OP1 O N N 121 DT OP2 O N N 122 DT "O5'" O N N 123 DT "C5'" C N N 124 DT "C4'" C N R 125 DT "O4'" O N N 126 DT "C3'" C N S 127 DT "O3'" O N N 128 DT "C2'" C N N 129 DT "C1'" C N R 130 DT N1 N N N 131 DT C2 C N N 132 DT O2 O N N 133 DT N3 N N N 134 DT C4 C N N 135 DT O4 O N N 136 DT C5 C N N 137 DT C7 C N N 138 DT C6 C N N 139 DT HOP3 H N N 140 DT HOP2 H N N 141 DT "H5'" H N N 142 DT "H5''" H N N 143 DT "H4'" H N N 144 DT "H3'" H N N 145 DT "HO3'" H N N 146 DT "H2'" H N N 147 DT "H2''" H N N 148 DT "H1'" H N N 149 DT H3 H N N 150 DT H71 H N N 151 DT H72 H N N 152 DT H73 H N N 153 DT H6 H N N 154 MG MG MG N N 155 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal CAC AS O1 doub N N 1 CAC AS O2 sing N N 2 CAC AS C1 sing N N 3 CAC AS C2 sing N N 4 CAC C1 H11 sing N N 5 CAC C1 H12 sing N N 6 CAC C1 H13 sing N N 7 CAC C2 H21 sing N N 8 CAC C2 H22 sing N N 9 CAC C2 H23 sing N N 10 DA OP3 P sing N N 11 DA OP3 HOP3 sing N N 12 DA P OP1 doub N N 13 DA P OP2 sing N N 14 DA P "O5'" sing N N 15 DA OP2 HOP2 sing N N 16 DA "O5'" "C5'" sing N N 17 DA "C5'" "C4'" sing N N 18 DA "C5'" "H5'" sing N N 19 DA "C5'" "H5''" sing N N 20 DA "C4'" "O4'" sing N N 21 DA "C4'" "C3'" sing N N 22 DA "C4'" "H4'" sing N N 23 DA "O4'" "C1'" sing N N 24 DA "C3'" "O3'" sing N N 25 DA "C3'" "C2'" sing N N 26 DA "C3'" "H3'" sing N N 27 DA "O3'" "HO3'" sing N N 28 DA "C2'" "C1'" sing N N 29 DA "C2'" "H2'" sing N N 30 DA "C2'" "H2''" sing N N 31 DA "C1'" N9 sing N N 32 DA "C1'" "H1'" sing N N 33 DA N9 C8 sing Y N 34 DA N9 C4 sing Y N 35 DA C8 N7 doub Y N 36 DA C8 H8 sing N N 37 DA N7 C5 sing Y N 38 DA C5 C6 sing Y N 39 DA C5 C4 doub Y N 40 DA C6 N6 sing N N 41 DA C6 N1 doub Y N 42 DA N6 H61 sing N N 43 DA N6 H62 sing N N 44 DA N1 C2 sing Y N 45 DA C2 N3 doub Y N 46 DA C2 H2 sing N N 47 DA N3 C4 sing Y N 48 DC OP3 P sing N N 49 DC OP3 HOP3 sing N N 50 DC P OP1 doub N N 51 DC P OP2 sing N N 52 DC P "O5'" sing N N 53 DC OP2 HOP2 sing N N 54 DC "O5'" "C5'" sing N N 55 DC "C5'" "C4'" sing N N 56 DC "C5'" "H5'" sing N N 57 DC "C5'" "H5''" sing N N 58 DC "C4'" "O4'" sing N N 59 DC "C4'" "C3'" sing N N 60 DC "C4'" "H4'" sing N N 61 DC "O4'" "C1'" sing N N 62 DC "C3'" "O3'" sing N N 63 DC "C3'" "C2'" sing N N 64 DC "C3'" "H3'" sing N N 65 DC "O3'" "HO3'" sing N N 66 DC "C2'" "C1'" sing N N 67 DC "C2'" "H2'" sing N N 68 DC "C2'" "H2''" sing N N 69 DC "C1'" N1 sing N N 70 DC "C1'" "H1'" sing N N 71 DC N1 C2 sing N N 72 DC N1 C6 sing N N 73 DC C2 O2 doub N N 74 DC C2 N3 sing N N 75 DC N3 C4 doub N N 76 DC C4 N4 sing N N 77 DC C4 C5 sing N N 78 DC N4 H41 sing N N 79 DC N4 H42 sing N N 80 DC C5 C6 doub N N 81 DC C5 H5 sing N N 82 DC C6 H6 sing N N 83 DG OP3 P sing N N 84 DG OP3 HOP3 sing N N 85 DG P OP1 doub N N 86 DG P OP2 sing N N 87 DG P "O5'" sing N N 88 DG OP2 HOP2 sing N N 89 DG "O5'" "C5'" sing N N 90 DG "C5'" "C4'" sing N N 91 DG "C5'" "H5'" sing N N 92 DG "C5'" "H5''" sing N N 93 DG "C4'" "O4'" sing N N 94 DG "C4'" "C3'" sing N N 95 DG "C4'" "H4'" sing N N 96 DG "O4'" "C1'" sing N N 97 DG "C3'" "O3'" sing N N 98 DG "C3'" "C2'" sing N N 99 DG "C3'" "H3'" sing N N 100 DG "O3'" "HO3'" sing N N 101 DG "C2'" "C1'" sing N N 102 DG "C2'" "H2'" sing N N 103 DG "C2'" "H2''" sing N N 104 DG "C1'" N9 sing N N 105 DG "C1'" "H1'" sing N N 106 DG N9 C8 sing Y N 107 DG N9 C4 sing Y N 108 DG C8 N7 doub Y N 109 DG C8 H8 sing N N 110 DG N7 C5 sing Y N 111 DG C5 C6 sing N N 112 DG C5 C4 doub Y N 113 DG C6 O6 doub N N 114 DG C6 N1 sing N N 115 DG N1 C2 sing N N 116 DG N1 H1 sing N N 117 DG C2 N2 sing N N 118 DG C2 N3 doub N N 119 DG N2 H21 sing N N 120 DG N2 H22 sing N N 121 DG N3 C4 sing N N 122 DT OP3 P sing N N 123 DT OP3 HOP3 sing N N 124 DT P OP1 doub N N 125 DT P OP2 sing N N 126 DT P "O5'" sing N N 127 DT OP2 HOP2 sing N N 128 DT "O5'" "C5'" sing N N 129 DT "C5'" "C4'" sing N N 130 DT "C5'" "H5'" sing N N 131 DT "C5'" "H5''" sing N N 132 DT "C4'" "O4'" sing N N 133 DT "C4'" "C3'" sing N N 134 DT "C4'" "H4'" sing N N 135 DT "O4'" "C1'" sing N N 136 DT "C3'" "O3'" sing N N 137 DT "C3'" "C2'" sing N N 138 DT "C3'" "H3'" sing N N 139 DT "O3'" "HO3'" sing N N 140 DT "C2'" "C1'" sing N N 141 DT "C2'" "H2'" sing N N 142 DT "C2'" "H2''" sing N N 143 DT "C1'" N1 sing N N 144 DT "C1'" "H1'" sing N N 145 DT N1 C2 sing N N 146 DT N1 C6 sing N N 147 DT C2 O2 doub N N 148 DT C2 N3 sing N N 149 DT N3 C4 sing N N 150 DT N3 H3 sing N N 151 DT C4 O4 doub N N 152 DT C4 C5 sing N N 153 DT C5 C7 sing N N 154 DT C5 C6 doub N N 155 DT C7 H71 sing N N 156 DT C7 H72 sing N N 157 DT C7 H73 sing N N 158 DT C6 H6 sing N N 159 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 6WR9 'double helix' 6WR9 'a-form double helix' 6WR9 'b-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 3 1_555 D DC 7 1_555 -0.058 -0.114 0.157 0.559 -5.947 -2.286 1 A_DG3:DC16_D A 3 ? D 16 ? 19 1 1 A DC 4 1_555 D DG 6 1_555 0.196 -0.060 0.031 -3.640 -6.208 -1.425 2 A_DC4:DG15_D A 4 ? D 15 ? 19 1 1 A DA 5 1_555 D DT 5 1_555 0.180 -0.106 0.715 3.798 -6.288 0.624 3 A_DA5:DT14_D A 5 ? D 14 ? 20 1 1 A DG 6 1_555 D DC 4 1_555 -0.142 -0.168 0.527 4.100 -8.144 0.490 4 A_DG6:DC13_D A 6 ? D 13 ? 19 1 1 A DA 7 1_555 D DT 3 1_555 0.070 -0.065 0.228 -0.884 -7.041 -4.068 5 A_DA7:DT12_D A 7 ? D 12 ? 20 1 1 A DC 8 1_555 D DG 2 1_555 0.123 -0.183 0.354 -0.679 -9.874 -0.434 6 A_DC8:DG11_D A 8 ? D 11 ? 19 1 1 A DT 9 1_555 D DA 1 1_555 -0.371 -0.033 0.247 -8.196 -7.908 -0.052 7 A_DT9:DA10_D A 9 ? D 10 ? 20 1 1 A DA 10 1_555 B DT 5 1_555 -0.524 0.364 0.234 -7.304 -2.613 10.309 8 A_DA10:DT5_B A 10 ? B 5 ? ? 1 1 A DG 11 1_555 B DC 4 1_555 -0.140 -0.249 0.573 8.034 -2.561 0.378 9 A_DG11:DC4_B A 11 ? B 4 ? 19 1 1 A DA 12 1_555 B DT 3 1_555 0.111 -0.225 0.343 0.076 -8.619 -2.386 10 A_DA12:DT3_B A 12 ? B 3 ? 20 1 1 A DC 13 1_555 B DG 2 1_555 0.242 -0.228 0.557 2.515 -6.701 -3.145 11 A_DC13:DG2_B A 13 ? B 2 ? 19 1 1 A DA 14 1_555 B DT 1 1_555 0.171 -0.123 0.764 7.882 -7.249 -5.502 12 A_DA14:DT1_B A 14 ? B 1 ? 20 1 1 A DC 15 1_555 C DG 9 1_555 0.259 -0.095 0.234 1.301 -3.897 -0.317 13 A_DC15:DG9_C A 15 ? C 9 ? 19 1 1 A DC 16 1_555 C DG 8 1_555 0.186 -0.216 0.811 3.472 -6.457 -0.453 14 A_DC16:DG8_C A 16 ? C 8 ? 19 1 1 A DA 17 1_555 C DT 7 1_555 0.262 -0.078 0.622 0.087 -9.639 -2.806 15 A_DA17:DT7_C A 17 ? C 7 ? 20 1 1 A DC 18 1_555 C DG 6 1_555 0.132 -0.074 0.289 -2.628 -7.032 -0.278 16 A_DC18:DG6_C A 18 ? C 6 ? 19 1 1 A DT 19 1_555 C DA 5 1_555 -0.099 -0.060 0.005 0.082 -12.186 -1.048 17 A_DT19:DA5_C A 19 ? C 5 ? 20 1 1 A DC 20 1_555 C DG 4 1_555 0.244 -0.047 -0.078 1.227 -6.466 3.004 18 A_DC20:DG4_C A 20 ? C 4 ? 19 1 1 A DA 21 1_555 C DT 3 1_555 0.193 -0.092 -0.080 -2.621 -11.568 0.270 19 A_DA21:DT3_C A 21 ? C 3 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 3 1_555 D DC 7 1_555 A DC 4 1_555 D DG 6 1_555 0.376 -0.264 3.231 2.829 -0.311 40.718 -0.345 -0.230 3.250 -0.447 -4.060 40.813 1 AA_DG3DC4:DG15DC16_DD A 3 ? D 16 ? A 4 ? D 15 ? 1 A DC 4 1_555 D DG 6 1_555 A DA 5 1_555 D DT 5 1_555 0.461 1.013 3.248 0.454 3.086 34.061 1.231 -0.712 3.330 5.254 -0.773 34.200 2 AA_DC4DA5:DT14DG15_DD A 4 ? D 15 ? A 5 ? D 14 ? 1 A DA 5 1_555 D DT 5 1_555 A DG 6 1_555 D DC 4 1_555 -0.247 -0.145 3.300 -2.890 0.232 32.446 -0.299 -0.069 3.308 0.415 5.160 32.572 3 AA_DA5DG6:DC13DT14_DD A 5 ? D 14 ? A 6 ? D 13 ? 1 A DG 6 1_555 D DC 4 1_555 A DA 7 1_555 D DT 3 1_555 -0.142 -1.010 3.331 0.212 2.317 37.273 -1.885 0.251 3.264 3.621 -0.331 37.343 4 AA_DG6DA7:DT12DC13_DD A 6 ? D 13 ? A 7 ? D 12 ? 1 A DA 7 1_555 D DT 3 1_555 A DC 8 1_555 D DG 2 1_555 0.585 -0.846 3.291 -4.661 2.907 32.958 -1.946 -1.777 3.098 5.080 8.145 33.400 5 AA_DA7DC8:DG11DT12_DD A 7 ? D 12 ? A 8 ? D 11 ? 1 A DC 8 1_555 D DG 2 1_555 A DT 9 1_555 D DA 1 1_555 -0.434 -1.519 3.647 -3.145 -4.136 28.820 -1.972 0.074 3.847 -8.226 6.255 29.275 6 AA_DC8DT9:DA10DG11_DD A 8 ? D 11 ? A 9 ? D 10 ? 1 A DT 9 1_555 D DA 1 1_555 A DA 10 1_555 B DT 5 1_555 -0.691 -1.204 2.995 -1.189 1.437 30.314 -2.561 1.102 2.961 2.745 2.272 30.370 7 AA_DT9DA10:DT5DA10_BD A 9 ? D 10 ? A 10 ? B 5 ? 1 A DA 10 1_555 B DT 5 1_555 A DG 11 1_555 B DC 4 1_555 -0.413 0.153 3.079 -3.370 4.563 29.738 -0.585 0.142 3.094 8.790 6.492 30.262 8 AA_DA10DG11:DC4DT5_BB A 10 ? B 5 ? A 11 ? B 4 ? 1 A DG 11 1_555 B DC 4 1_555 A DA 12 1_555 B DT 3 1_555 -0.183 -0.234 3.497 0.903 3.234 37.721 -0.802 0.405 3.461 4.989 -1.393 37.865 9 AA_DG11DA12:DT3DC4_BB A 11 ? B 4 ? A 12 ? B 3 ? 1 A DA 12 1_555 B DT 3 1_555 A DC 13 1_555 B DG 2 1_555 0.939 -1.084 3.181 -3.961 -3.126 39.165 -1.248 -1.844 3.149 -4.640 5.879 39.476 10 AA_DA12DC13:DG2DT3_BB A 12 ? B 3 ? A 13 ? B 2 ? 1 A DC 13 1_555 B DG 2 1_555 A DA 14 1_555 B DT 1 1_555 -0.785 -0.693 2.929 -5.001 -0.788 35.668 -1.018 0.620 3.022 -1.278 8.114 36.014 11 AA_DC13DA14:DT1DG2_BB A 13 ? B 2 ? A 14 ? B 1 ? 1 A DA 14 1_555 B DT 1 1_555 A DC 15 1_555 C DG 9 1_555 -0.917 -1.480 3.338 2.591 -0.461 29.393 -2.807 2.359 3.269 -0.907 -5.094 29.508 12 AA_DA14DC15:DG9DT1_CB A 14 ? B 1 ? A 15 ? C 9 ? 1 A DC 15 1_555 C DG 9 1_555 A DC 16 1_555 C DG 8 1_555 -0.087 -0.184 3.429 -1.793 4.518 26.570 -1.597 -0.292 3.350 9.727 3.860 27.003 13 AA_DC15DC16:DG8DG9_CC A 15 ? C 9 ? A 16 ? C 8 ? 1 A DC 16 1_555 C DG 8 1_555 A DA 17 1_555 C DT 7 1_555 0.098 1.650 3.531 0.240 -2.884 47.174 2.308 -0.102 3.431 -3.600 -0.300 47.257 14 AA_DC16DA17:DT7DG8_CC A 16 ? C 8 ? A 17 ? C 7 ? 1 A DA 17 1_555 C DT 7 1_555 A DC 18 1_555 C DG 6 1_555 -0.056 -0.787 3.356 -1.224 0.435 28.244 -1.715 -0.177 3.343 0.891 2.508 28.273 15 AA_DA17DC18:DG6DT7_CC A 17 ? C 7 ? A 18 ? C 6 ? 1 A DC 18 1_555 C DG 6 1_555 A DT 19 1_555 C DA 5 1_555 -0.179 -0.483 3.216 2.610 0.334 34.804 -0.855 0.685 3.190 0.558 -4.355 34.900 16 AA_DC18DT19:DA5DG6_CC A 18 ? C 6 ? A 19 ? C 5 ? 1 A DT 19 1_555 C DA 5 1_555 A DC 20 1_555 C DG 4 1_555 0.913 0.550 3.469 3.543 2.849 33.046 0.446 -0.955 3.578 4.979 -6.192 33.349 17 AA_DT19DC20:DG4DA5_CC A 19 ? C 5 ? A 20 ? C 4 ? 1 A DC 20 1_555 C DG 4 1_555 A DA 21 1_555 C DT 3 1_555 -0.483 1.879 3.534 -1.501 1.791 40.587 2.487 0.513 3.625 2.580 2.162 40.652 18 AA_DC20DA21:DT3DG4_CC A 20 ? C 4 ? A 21 ? C 3 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Science Foundation (NSF, United States)' 'United States' 1360635 1 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R01GM104960 2 'National Science Foundation (NSF, United States)' 'United States' NSF2004250 3 # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 5 'MAGNESIUM ION' MG 6 'CACODYLATE ION' CAC # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 5KEK _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? #