data_6WRA # _entry.id 6WRA # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 6WRA pdb_00006wra 10.2210/pdb6wra/pdb WWPDB D_1000248858 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 6WRA _pdbx_database_status.recvd_initial_deposition_date 2020-04-29 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Simmons, C.R.' 1 0000-0002-2290-6132 'MacCulloch, T.' 2 0000-0001-5875-3361 'Stephanopoulos, N.' 3 0000-0001-7859-410X 'Yan, H.' 4 0000-0001-7397-9852 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nat Commun' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2041-1723 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 13 _citation.language ? _citation.page_first 3112 _citation.page_last 3112 _citation.title 'The influence of Holliday junction sequence and dynamics on DNA crystal self-assembly.' _citation.year 2022 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41467-022-30779-6 _citation.pdbx_database_id_PubMed 35662248 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Simmons, C.R.' 1 ? primary 'MacCulloch, T.' 2 ? primary 'Krepl, M.' 3 0000-0002-9833-4281 primary 'Matthies, M.' 4 ? primary 'Buchberger, A.' 5 ? primary 'Crawford, I.' 6 ? primary 'Sponer, J.' 7 0000-0001-6558-6186 primary 'Sulc, P.' 8 0000-0003-1565-6769 primary 'Stephanopoulos, N.' 9 0000-0001-7859-410X primary 'Yan, H.' 10 0000-0001-7397-9852 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 6WRA _cell.details ? _cell.formula_units_Z ? _cell.length_a 68.810 _cell.length_a_esd ? _cell.length_b 68.810 _cell.length_b_esd ? _cell.length_c 59.712 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 3 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 6WRA _symmetry.cell_setting ? _symmetry.Int_Tables_number 145 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 32' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*GP*AP*GP*CP*AP*GP*AP*CP*AP*AP*GP*AP*CP*TP*CP*CP*AP*CP*TP*CP*A)-3') ; 6410.177 1 ? ? ? ? 2 polymer syn ;DNA (5'-D(P*AP*GP*TP*CP*T)-3') ; 1495.023 1 ? ? ? ? 3 polymer syn ;DNA (5'-D(*TP*CP*TP*GP*AP*GP*TP*GP*G)-3') ; 2786.833 1 ? ? ? ? 4 polymer syn ;DNA (5'-D(P*TP*GP*TP*CP*TP*GP*C)-3') ; 2104.396 1 ? ? ? ? 5 non-polymer syn 'MAGNESIUM ION' 24.305 2 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no no ;(DG)(DA)(DG)(DC)(DA)(DG)(DA)(DC)(DA)(DA)(DG)(DA)(DC)(DT)(DC)(DC)(DA)(DC)(DT)(DC) (DA) ; GAGCAGACAAGACTCCACTCA A ? 2 polydeoxyribonucleotide no no '(DA)(DG)(DT)(DC)(DT)' AGTCT B ? 3 polydeoxyribonucleotide no no '(DT)(DC)(DT)(DG)(DA)(DG)(DT)(DG)(DG)' TCTGAGTGG C ? 4 polydeoxyribonucleotide no no '(DT)(DG)(DT)(DC)(DT)(DG)(DC)' TGTCTGC D ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DA n 1 3 DG n 1 4 DC n 1 5 DA n 1 6 DG n 1 7 DA n 1 8 DC n 1 9 DA n 1 10 DA n 1 11 DG n 1 12 DA n 1 13 DC n 1 14 DT n 1 15 DC n 1 16 DC n 1 17 DA n 1 18 DC n 1 19 DT n 1 20 DC n 1 21 DA n 2 1 DA n 2 2 DG n 2 3 DT n 2 4 DC n 2 5 DT n 3 1 DT n 3 2 DC n 3 3 DT n 3 4 DG n 3 5 DA n 3 6 DG n 3 7 DT n 3 8 DG n 3 9 DG n 4 1 DT n 4 2 DG n 4 3 DT n 4 4 DC n 4 5 DT n 4 6 DG n 4 7 DC n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 21 'synthetic construct' ? 32630 ? 2 1 sample 1 5 'synthetic construct' ? 32630 ? 3 1 sample 1 9 'synthetic construct' ? 32630 ? 4 1 sample 1 7 'synthetic construct' ? 32630 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 6WRA 6WRA ? 1 ? 1 2 PDB 6WRA 6WRA ? 2 ? 1 3 PDB 6WRA 6WRA ? 3 ? 1 4 PDB 6WRA 6WRA ? 4 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 6WRA A 1 ? 21 ? 6WRA 1 ? 21 ? 1 21 2 2 6WRA B 1 ? 5 ? 6WRA 1 ? 5 ? 1 5 3 3 6WRA C 1 ? 9 ? 6WRA 1 ? 9 ? 1 9 4 4 6WRA D 1 ? 7 ? 6WRA 10 ? 16 ? 10 16 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 6WRA _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 6.38 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 80.71 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 298 _exptl_crystal_grow.temp_details 'temperature gradient generated from 60 to 25 C at 0.3 degrees per hour' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.5 mL of 0.05 M HEPES pH 7.5 with 20 mM MgCl2, 1.0 mM spermine, and 5% PEG 8000 was added to the reservoir with 2 uL added to the drop containing 4 uL of DNA stock ; _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS3 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2017-10-15 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.98 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 19-ID' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.98 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 19-ID _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 6WRA _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.000 _reflns.d_resolution_low 50.000 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 6287 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.400 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 5.800 _reflns.pdbx_Rmerge_I_obs 0.131 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 8.800 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 1.742 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.144 _reflns.pdbx_Rpim_I_all 0.059 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.911 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_all _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split 3.000 3.050 ? ? ? ? ? ? 281 95.600 ? ? ? ? 0.747 ? ? ? ? ? ? ? ? 4.700 ? 0.518 ? ? 0.825 0.343 ? 1 1 0.915 ? ? 3.050 3.110 ? ? ? ? ? ? 309 96.600 ? ? ? ? 0.318 ? ? ? ? ? ? ? ? 4.900 ? 0.603 ? ? 0.351 0.145 ? 2 1 0.980 ? ? 3.110 3.170 ? ? ? ? ? ? 300 97.700 ? ? ? ? 0.202 ? ? ? ? ? ? ? ? 4.900 ? 0.790 ? ? 0.222 0.091 ? 3 1 0.992 ? ? 3.170 3.230 ? ? ? ? ? ? 330 100.000 ? ? ? ? 0.131 ? ? ? ? ? ? ? ? 4.800 ? 1.135 ? ? 0.148 0.067 ? 4 1 0.989 ? ? 3.230 3.300 ? ? ? ? ? ? 322 99.400 ? ? ? ? 0.163 ? ? ? ? ? ? ? ? 5.000 ? 1.314 ? ? 0.187 0.089 ? 5 1 0.980 ? ? 3.300 3.380 ? ? ? ? ? ? 304 100.000 ? ? ? ? 0.160 ? ? ? ? ? ? ? ? 6.000 ? 1.224 ? ? 0.174 0.069 ? 6 1 0.990 ? ? 3.380 3.460 ? ? ? ? ? ? 311 100.000 ? ? ? ? 0.178 ? ? ? ? ? ? ? ? 5.900 ? 2.321 ? ? 0.197 0.084 ? 7 1 0.988 ? ? 3.460 3.560 ? ? ? ? ? ? 330 100.000 ? ? ? ? 0.156 ? ? ? ? ? ? ? ? 6.200 ? 1.139 ? ? 0.170 0.067 ? 8 1 0.994 ? ? 3.560 3.660 ? ? ? ? ? ? 316 100.000 ? ? ? ? 0.224 ? ? ? ? ? ? ? ? 6.000 ? 1.660 ? ? 0.245 0.100 ? 9 1 0.991 ? ? 3.660 3.780 ? ? ? ? ? ? 310 100.000 ? ? ? ? 0.181 ? ? ? ? ? ? ? ? 6.100 ? 1.379 ? ? 0.198 0.079 ? 10 1 0.988 ? ? 3.780 3.910 ? ? ? ? ? ? 337 100.000 ? ? ? ? 0.200 ? ? ? ? ? ? ? ? 5.800 ? 2.393 ? ? 0.218 0.087 ? 11 1 0.990 ? ? 3.910 4.070 ? ? ? ? ? ? 304 100.000 ? ? ? ? 0.125 ? ? ? ? ? ? ? ? 5.500 ? 1.983 ? ? 0.138 0.058 ? 12 1 0.990 ? ? 4.070 4.260 ? ? ? ? ? ? 327 100.000 ? ? ? ? 0.118 ? ? ? ? ? ? ? ? 6.300 ? 2.058 ? ? 0.129 0.051 ? 13 1 0.988 ? ? 4.260 4.480 ? ? ? ? ? ? 298 100.000 ? ? ? ? 0.113 ? ? ? ? ? ? ? ? 6.300 ? 2.295 ? ? 0.123 0.048 ? 14 1 0.991 ? ? 4.480 4.760 ? ? ? ? ? ? 333 99.700 ? ? ? ? 0.102 ? ? ? ? ? ? ? ? 6.200 ? 2.060 ? ? 0.111 0.044 ? 15 1 0.991 ? ? 4.760 5.130 ? ? ? ? ? ? 307 100.000 ? ? ? ? 0.101 ? ? ? ? ? ? ? ? 6.000 ? 2.739 ? ? 0.111 0.046 ? 16 1 0.986 ? ? 5.130 5.640 ? ? ? ? ? ? 332 100.000 ? ? ? ? 0.090 ? ? ? ? ? ? ? ? 5.900 ? 3.062 ? ? 0.098 0.039 ? 17 1 0.993 ? ? 5.640 6.460 ? ? ? ? ? ? 293 100.000 ? ? ? ? 0.098 ? ? ? ? ? ? ? ? 6.400 ? 2.149 ? ? 0.106 0.041 ? 18 1 0.989 ? ? 6.460 8.130 ? ? ? ? ? ? 319 99.400 ? ? ? ? 0.088 ? ? ? ? ? ? ? ? 5.900 ? 2.601 ? ? 0.097 0.040 ? 19 1 0.989 ? ? 8.130 50.000 ? ? ? ? ? ? 324 98.800 ? ? ? ? 0.138 ? ? ? ? ? ? ? ? 6.000 ? 0.329 ? ? 0.152 0.063 ? 20 1 0.938 ? ? # _refine.aniso_B[1][1] -2.8800 _refine.aniso_B[1][2] -1.4400 _refine.aniso_B[1][3] 0.0000 _refine.aniso_B[2][2] -2.8800 _refine.aniso_B[2][3] 0.0000 _refine.aniso_B[3][3] 9.3300 _refine.B_iso_max 239.080 _refine.B_iso_mean 96.4770 _refine.B_iso_min 41.260 _refine.correlation_coeff_Fo_to_Fc 0.9600 _refine.correlation_coeff_Fo_to_Fc_free 0.9640 _refine.details 'HYDROGENS HAVE BEEN ADDED IN THE RIDING POSITIONS U VALUES : REFINED INDIVIDUALLY' _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 6WRA _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.0000 _refine.ls_d_res_low 50 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 5787 _refine.ls_number_reflns_R_free 311 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 96.5800 _refine.ls_percent_reflns_R_free 5.1000 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2079 _refine.ls_R_factor_R_free 0.2351 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2064 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details ? _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 0.000 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 5KEK _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_R_Free_selection_details RANDOM _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R 0.3840 _refine.pdbx_overall_ESU_R_Free 0.2800 _refine.pdbx_solvent_vdw_probe_radii 1.2000 _refine.pdbx_solvent_ion_probe_radii 0.8000 _refine.pdbx_solvent_shrinkage_radii 0.8000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B 13.7840 _refine.overall_SU_ML 0.2460 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id final _refine_hist.details ? _refine_hist.d_res_high 3.0000 _refine_hist.d_res_low 50 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 857 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total 42 _refine_hist.pdbx_B_iso_mean_ligand 74.24 _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 855 _refine_hist.pdbx_number_atoms_ligand 2 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.d_res_high 3.0010 _refine_ls_shell.d_res_low 3.0790 _refine_ls_shell.number_reflns_all 418 _refine_ls_shell.number_reflns_obs ? _refine_ls_shell.number_reflns_R_free 22 _refine_ls_shell.number_reflns_R_work 396 _refine_ls_shell.percent_reflns_obs 94.1400 _refine_ls_shell.percent_reflns_R_free ? _refine_ls_shell.R_factor_all ? _refine_ls_shell.R_factor_obs ? _refine_ls_shell.R_factor_R_free 0.4170 _refine_ls_shell.R_factor_R_free_error 0.0000 _refine_ls_shell.R_factor_R_work 0.3240 _refine_ls_shell.redundancy_reflns_all ? _refine_ls_shell.redundancy_reflns_obs ? _refine_ls_shell.wR_factor_all ? _refine_ls_shell.wR_factor_obs ? _refine_ls_shell.wR_factor_R_free ? _refine_ls_shell.wR_factor_R_work ? _refine_ls_shell.pdbx_R_complete ? _refine_ls_shell.pdbx_total_number_of_bins_used 20 _refine_ls_shell.pdbx_phase_error ? _refine_ls_shell.pdbx_fsc_work ? _refine_ls_shell.pdbx_fsc_free ? # _struct.entry_id 6WRA _struct.title 'Self-assembly of a 3D DNA crystal lattice (4x5 duplex version) containing the J34 immobile Holliday junction' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 6WRA _struct_keywords.text 'Structural DNA nanotechnology, immobile Holliday junctions, 3D DNA self-assembly, designer DNA crystals, DNA' _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 5 ? F N N 5 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 3 O6 ? ? ? 1_555 D DC 7 N4 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? 'DG-DC PAIR' ? ? ? hydrog2 hydrog ? ? A DC 4 N3 ? ? ? 1_555 D DG 6 N1 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DC 4 N4 ? ? ? 1_555 D DG 6 O6 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DC 4 O2 ? ? ? 1_555 D DG 6 N2 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DA 5 N1 ? ? ? 1_555 D DT 5 N3 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DA 5 N6 ? ? ? 1_555 D DT 5 O4 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DG 6 N1 ? ? ? 1_555 D DC 4 N3 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DG 6 N2 ? ? ? 1_555 D DC 4 O2 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DG 6 O6 ? ? ? 1_555 D DC 4 N4 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DA 7 N1 ? ? ? 1_555 D DT 3 N3 ? ? A DA 7 D DT 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DA 7 N6 ? ? ? 1_555 D DT 3 O4 ? ? A DA 7 D DT 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DC 8 N3 ? ? ? 1_555 D DG 2 N1 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DC 8 N4 ? ? ? 1_555 D DG 2 O6 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DC 8 O2 ? ? ? 1_555 D DG 2 N2 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DA 9 N1 ? ? ? 1_555 D DT 1 N3 ? ? A DA 9 D DT 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DA 9 N6 ? ? ? 1_555 D DT 1 O4 ? ? A DA 9 D DT 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DA 10 N1 ? ? ? 1_555 B DT 5 N3 ? ? A DA 10 B DT 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DA 10 N6 ? ? ? 1_555 B DT 5 O4 ? ? A DA 10 B DT 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DG 11 N1 ? ? ? 1_555 B DC 4 N3 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DG 11 N2 ? ? ? 1_555 B DC 4 O2 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DG 11 O6 ? ? ? 1_555 B DC 4 N4 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DA 12 N1 ? ? ? 1_555 B DT 3 N3 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DA 12 N6 ? ? ? 1_555 B DT 3 O4 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DC 13 N3 ? ? ? 1_555 B DG 2 N1 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DC 13 N4 ? ? ? 1_555 B DG 2 O6 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DC 13 O2 ? ? ? 1_555 B DG 2 N2 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DT 14 N3 ? ? ? 1_555 B DA 1 N1 ? ? A DT 14 B DA 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DT 14 O4 ? ? ? 1_555 B DA 1 N6 ? ? A DT 14 B DA 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DC 15 N3 ? ? ? 1_555 C DG 9 N1 ? ? A DC 15 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A DC 15 N4 ? ? ? 1_555 C DG 9 O6 ? ? A DC 15 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A DC 15 O2 ? ? ? 1_555 C DG 9 N2 ? ? A DC 15 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A DC 16 N3 ? ? ? 1_555 C DG 8 N1 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DC 16 N4 ? ? ? 1_555 C DG 8 O6 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DC 16 O2 ? ? ? 1_555 C DG 8 N2 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DA 17 N1 ? ? ? 1_555 C DT 7 N3 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DA 17 N6 ? ? ? 1_555 C DT 7 O4 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DC 18 N3 ? ? ? 1_555 C DG 6 N1 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DC 18 N4 ? ? ? 1_555 C DG 6 O6 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DC 18 O2 ? ? ? 1_555 C DG 6 N2 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DT 19 N3 ? ? ? 1_555 C DA 5 N1 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DT 19 O4 ? ? ? 1_555 C DA 5 N6 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DC 20 N3 ? ? ? 1_555 C DG 4 N1 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DC 20 N4 ? ? ? 1_555 C DG 4 O6 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DC 20 O2 ? ? ? 1_555 C DG 4 N2 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A DA 21 N1 ? ? ? 1_555 C DT 3 N3 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A DA 21 N6 ? ? ? 1_555 C DT 3 O4 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 6WRA _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.014533 _atom_sites.fract_transf_matrix[1][2] 0.008391 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.016781 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.016747 _atom_sites.fract_transf_vector[1] 0.000000 _atom_sites.fract_transf_vector[2] 0.000000 _atom_sites.fract_transf_vector[3] 0.000000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DA 2 2 2 DA DA A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DC 4 4 4 DC DC A . n A 1 5 DA 5 5 5 DA DA A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DA 7 7 7 DA DA A . n A 1 8 DC 8 8 8 DC DC A . n A 1 9 DA 9 9 9 DA DA A . n A 1 10 DA 10 10 10 DA DA A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DA 12 12 12 DA DA A . n A 1 13 DC 13 13 13 DC DC A . n A 1 14 DT 14 14 14 DT DT A . n A 1 15 DC 15 15 15 DC DC A . n A 1 16 DC 16 16 16 DC DC A . n A 1 17 DA 17 17 17 DA DA A . n A 1 18 DC 18 18 18 DC DC A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DC 20 20 20 DC DC A . n A 1 21 DA 21 21 21 DA DA A . n B 2 1 DA 1 1 1 DA DA B . n B 2 2 DG 2 2 2 DG DG B . n B 2 3 DT 3 3 3 DT DT B . n B 2 4 DC 4 4 4 DC DC B . n B 2 5 DT 5 5 5 DT DT B . n C 3 1 DT 1 1 1 DT DT C . n C 3 2 DC 2 2 2 DC DC C . n C 3 3 DT 3 3 3 DT DT C . n C 3 4 DG 4 4 4 DG DG C . n C 3 5 DA 5 5 5 DA DA C . n C 3 6 DG 6 6 6 DG DG C . n C 3 7 DT 7 7 7 DT DT C . n C 3 8 DG 8 8 8 DG DG C . n C 3 9 DG 9 9 9 DG DG C . n D 4 1 DT 1 10 10 DT DT D . n D 4 2 DG 2 11 11 DG DG D . n D 4 3 DT 3 12 12 DT DT D . n D 4 4 DC 4 13 13 DC DC D . n D 4 5 DT 5 14 14 DT DT D . n D 4 6 DG 6 15 15 DG DG D . n D 4 7 DC 7 16 16 DC DC D . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code E 5 MG 1 101 2 MG MG B . F 5 MG 1 101 1 MG MG D . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details tetrameric _pdbx_struct_assembly.oligomeric_count 4 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2021-07-14 2 'Structure model' 1 1 2022-07-06 3 'Structure model' 1 2 2023-10-18 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 2 'Structure model' database_2 4 3 'Structure model' chem_comp_atom 5 3 'Structure model' chem_comp_bond 6 3 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_CSD' 4 2 'Structure model' '_citation.journal_id_ISSN' 5 2 'Structure model' '_citation.journal_volume' 6 2 'Structure model' '_citation.page_first' 7 2 'Structure model' '_citation.page_last' 8 2 'Structure model' '_citation.pdbx_database_id_DOI' 9 2 'Structure model' '_citation.pdbx_database_id_PubMed' 10 2 'Structure model' '_citation.title' 11 2 'Structure model' '_citation.year' 12 2 'Structure model' '_database_2.pdbx_DOI' 13 2 'Structure model' '_database_2.pdbx_database_accession' # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 2 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.11.1_2575 3 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? 3.25 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 5 # _pdbx_entry_details.entry_id 6WRA _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _pdbx_validate_symm_contact.id _pdbx_validate_symm_contact.PDB_model_num _pdbx_validate_symm_contact.auth_atom_id_1 _pdbx_validate_symm_contact.auth_asym_id_1 _pdbx_validate_symm_contact.auth_comp_id_1 _pdbx_validate_symm_contact.auth_seq_id_1 _pdbx_validate_symm_contact.PDB_ins_code_1 _pdbx_validate_symm_contact.label_alt_id_1 _pdbx_validate_symm_contact.site_symmetry_1 _pdbx_validate_symm_contact.auth_atom_id_2 _pdbx_validate_symm_contact.auth_asym_id_2 _pdbx_validate_symm_contact.auth_comp_id_2 _pdbx_validate_symm_contact.auth_seq_id_2 _pdbx_validate_symm_contact.PDB_ins_code_2 _pdbx_validate_symm_contact.label_alt_id_2 _pdbx_validate_symm_contact.site_symmetry_2 _pdbx_validate_symm_contact.dist 1 1 "O3'" C DG 9 ? ? 1_555 OP1 D DT 10 ? ? 3_555 1.76 2 1 "O3'" C DG 9 ? ? 1_555 OP2 D DT 10 ? ? 3_555 1.91 3 1 OP2 B DA 1 ? ? 1_555 "O3'" B DT 5 ? ? 3_555 1.91 4 1 "O3'" C DG 9 ? ? 1_555 P D DT 10 ? ? 3_555 1.98 5 1 P B DA 1 ? ? 1_555 "O3'" B DT 5 ? ? 3_555 2.01 6 1 OP1 B DA 1 ? ? 1_555 "O3'" B DT 5 ? ? 3_555 2.05 # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 "O3'" A DC 16 ? ? P A DA 17 ? ? 1.514 1.607 -0.093 0.012 Y 2 1 "O3'" B DC 4 ? ? P B DT 5 ? ? 1.508 1.607 -0.099 0.012 Y 3 1 "O3'" C DG 8 ? ? P C DG 9 ? ? 1.513 1.607 -0.094 0.012 Y # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C3'" A DC 16 ? ? "C2'" A DC 16 ? ? "C1'" A DC 16 ? ? 97.44 102.40 -4.96 0.80 N 2 1 "O5'" A DC 18 ? ? "C5'" A DC 18 ? ? "C4'" A DC 18 ? ? 103.65 109.40 -5.75 0.80 N 3 1 "C1'" A DC 18 ? ? "O4'" A DC 18 ? ? "C4'" A DC 18 ? ? 102.98 110.10 -7.12 1.00 N 4 1 "O5'" B DA 1 ? ? P B DA 1 ? ? OP1 B DA 1 ? ? 99.40 105.70 -6.30 0.90 N 5 1 "C1'" C DG 9 ? ? "O4'" C DG 9 ? ? "C4'" C DG 9 ? ? 103.51 110.10 -6.59 1.00 N 6 1 "O5'" D DT 10 ? ? P D DT 10 ? ? OP2 D DT 10 ? ? 98.52 105.70 -7.18 0.90 N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal DA OP3 O N N 1 DA P P N N 2 DA OP1 O N N 3 DA OP2 O N N 4 DA "O5'" O N N 5 DA "C5'" C N N 6 DA "C4'" C N R 7 DA "O4'" O N N 8 DA "C3'" C N S 9 DA "O3'" O N N 10 DA "C2'" C N N 11 DA "C1'" C N R 12 DA N9 N Y N 13 DA C8 C Y N 14 DA N7 N Y N 15 DA C5 C Y N 16 DA C6 C Y N 17 DA N6 N N N 18 DA N1 N Y N 19 DA C2 C Y N 20 DA N3 N Y N 21 DA C4 C Y N 22 DA HOP3 H N N 23 DA HOP2 H N N 24 DA "H5'" H N N 25 DA "H5''" H N N 26 DA "H4'" H N N 27 DA "H3'" H N N 28 DA "HO3'" H N N 29 DA "H2'" H N N 30 DA "H2''" H N N 31 DA "H1'" H N N 32 DA H8 H N N 33 DA H61 H N N 34 DA H62 H N N 35 DA H2 H N N 36 DC OP3 O N N 37 DC P P N N 38 DC OP1 O N N 39 DC OP2 O N N 40 DC "O5'" O N N 41 DC "C5'" C N N 42 DC "C4'" C N R 43 DC "O4'" O N N 44 DC "C3'" C N S 45 DC "O3'" O N N 46 DC "C2'" C N N 47 DC "C1'" C N R 48 DC N1 N N N 49 DC C2 C N N 50 DC O2 O N N 51 DC N3 N N N 52 DC C4 C N N 53 DC N4 N N N 54 DC C5 C N N 55 DC C6 C N N 56 DC HOP3 H N N 57 DC HOP2 H N N 58 DC "H5'" H N N 59 DC "H5''" H N N 60 DC "H4'" H N N 61 DC "H3'" H N N 62 DC "HO3'" H N N 63 DC "H2'" H N N 64 DC "H2''" H N N 65 DC "H1'" H N N 66 DC H41 H N N 67 DC H42 H N N 68 DC H5 H N N 69 DC H6 H N N 70 DG OP3 O N N 71 DG P P N N 72 DG OP1 O N N 73 DG OP2 O N N 74 DG "O5'" O N N 75 DG "C5'" C N N 76 DG "C4'" C N R 77 DG "O4'" O N N 78 DG "C3'" C N S 79 DG "O3'" O N N 80 DG "C2'" C N N 81 DG "C1'" C N R 82 DG N9 N Y N 83 DG C8 C Y N 84 DG N7 N Y N 85 DG C5 C Y N 86 DG C6 C N N 87 DG O6 O N N 88 DG N1 N N N 89 DG C2 C N N 90 DG N2 N N N 91 DG N3 N N N 92 DG C4 C Y N 93 DG HOP3 H N N 94 DG HOP2 H N N 95 DG "H5'" H N N 96 DG "H5''" H N N 97 DG "H4'" H N N 98 DG "H3'" H N N 99 DG "HO3'" H N N 100 DG "H2'" H N N 101 DG "H2''" H N N 102 DG "H1'" H N N 103 DG H8 H N N 104 DG H1 H N N 105 DG H21 H N N 106 DG H22 H N N 107 DT OP3 O N N 108 DT P P N N 109 DT OP1 O N N 110 DT OP2 O N N 111 DT "O5'" O N N 112 DT "C5'" C N N 113 DT "C4'" C N R 114 DT "O4'" O N N 115 DT "C3'" C N S 116 DT "O3'" O N N 117 DT "C2'" C N N 118 DT "C1'" C N R 119 DT N1 N N N 120 DT C2 C N N 121 DT O2 O N N 122 DT N3 N N N 123 DT C4 C N N 124 DT O4 O N N 125 DT C5 C N N 126 DT C7 C N N 127 DT C6 C N N 128 DT HOP3 H N N 129 DT HOP2 H N N 130 DT "H5'" H N N 131 DT "H5''" H N N 132 DT "H4'" H N N 133 DT "H3'" H N N 134 DT "HO3'" H N N 135 DT "H2'" H N N 136 DT "H2''" H N N 137 DT "H1'" H N N 138 DT H3 H N N 139 DT H71 H N N 140 DT H72 H N N 141 DT H73 H N N 142 DT H6 H N N 143 MG MG MG N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal DA OP3 P sing N N 1 DA OP3 HOP3 sing N N 2 DA P OP1 doub N N 3 DA P OP2 sing N N 4 DA P "O5'" sing N N 5 DA OP2 HOP2 sing N N 6 DA "O5'" "C5'" sing N N 7 DA "C5'" "C4'" sing N N 8 DA "C5'" "H5'" sing N N 9 DA "C5'" "H5''" sing N N 10 DA "C4'" "O4'" sing N N 11 DA "C4'" "C3'" sing N N 12 DA "C4'" "H4'" sing N N 13 DA "O4'" "C1'" sing N N 14 DA "C3'" "O3'" sing N N 15 DA "C3'" "C2'" sing N N 16 DA "C3'" "H3'" sing N N 17 DA "O3'" "HO3'" sing N N 18 DA "C2'" "C1'" sing N N 19 DA "C2'" "H2'" sing N N 20 DA "C2'" "H2''" sing N N 21 DA "C1'" N9 sing N N 22 DA "C1'" "H1'" sing N N 23 DA N9 C8 sing Y N 24 DA N9 C4 sing Y N 25 DA C8 N7 doub Y N 26 DA C8 H8 sing N N 27 DA N7 C5 sing Y N 28 DA C5 C6 sing Y N 29 DA C5 C4 doub Y N 30 DA C6 N6 sing N N 31 DA C6 N1 doub Y N 32 DA N6 H61 sing N N 33 DA N6 H62 sing N N 34 DA N1 C2 sing Y N 35 DA C2 N3 doub Y N 36 DA C2 H2 sing N N 37 DA N3 C4 sing Y N 38 DC OP3 P sing N N 39 DC OP3 HOP3 sing N N 40 DC P OP1 doub N N 41 DC P OP2 sing N N 42 DC P "O5'" sing N N 43 DC OP2 HOP2 sing N N 44 DC "O5'" "C5'" sing N N 45 DC "C5'" "C4'" sing N N 46 DC "C5'" "H5'" sing N N 47 DC "C5'" "H5''" sing N N 48 DC "C4'" "O4'" sing N N 49 DC "C4'" "C3'" sing N N 50 DC "C4'" "H4'" sing N N 51 DC "O4'" "C1'" sing N N 52 DC "C3'" "O3'" sing N N 53 DC "C3'" "C2'" sing N N 54 DC "C3'" "H3'" sing N N 55 DC "O3'" "HO3'" sing N N 56 DC "C2'" "C1'" sing N N 57 DC "C2'" "H2'" sing N N 58 DC "C2'" "H2''" sing N N 59 DC "C1'" N1 sing N N 60 DC "C1'" "H1'" sing N N 61 DC N1 C2 sing N N 62 DC N1 C6 sing N N 63 DC C2 O2 doub N N 64 DC C2 N3 sing N N 65 DC N3 C4 doub N N 66 DC C4 N4 sing N N 67 DC C4 C5 sing N N 68 DC N4 H41 sing N N 69 DC N4 H42 sing N N 70 DC C5 C6 doub N N 71 DC C5 H5 sing N N 72 DC C6 H6 sing N N 73 DG OP3 P sing N N 74 DG OP3 HOP3 sing N N 75 DG P OP1 doub N N 76 DG P OP2 sing N N 77 DG P "O5'" sing N N 78 DG OP2 HOP2 sing N N 79 DG "O5'" "C5'" sing N N 80 DG "C5'" "C4'" sing N N 81 DG "C5'" "H5'" sing N N 82 DG "C5'" "H5''" sing N N 83 DG "C4'" "O4'" sing N N 84 DG "C4'" "C3'" sing N N 85 DG "C4'" "H4'" sing N N 86 DG "O4'" "C1'" sing N N 87 DG "C3'" "O3'" sing N N 88 DG "C3'" "C2'" sing N N 89 DG "C3'" "H3'" sing N N 90 DG "O3'" "HO3'" sing N N 91 DG "C2'" "C1'" sing N N 92 DG "C2'" "H2'" sing N N 93 DG "C2'" "H2''" sing N N 94 DG "C1'" N9 sing N N 95 DG "C1'" "H1'" sing N N 96 DG N9 C8 sing Y N 97 DG N9 C4 sing Y N 98 DG C8 N7 doub Y N 99 DG C8 H8 sing N N 100 DG N7 C5 sing Y N 101 DG C5 C6 sing N N 102 DG C5 C4 doub Y N 103 DG C6 O6 doub N N 104 DG C6 N1 sing N N 105 DG N1 C2 sing N N 106 DG N1 H1 sing N N 107 DG C2 N2 sing N N 108 DG C2 N3 doub N N 109 DG N2 H21 sing N N 110 DG N2 H22 sing N N 111 DG N3 C4 sing N N 112 DT OP3 P sing N N 113 DT OP3 HOP3 sing N N 114 DT P OP1 doub N N 115 DT P OP2 sing N N 116 DT P "O5'" sing N N 117 DT OP2 HOP2 sing N N 118 DT "O5'" "C5'" sing N N 119 DT "C5'" "C4'" sing N N 120 DT "C5'" "H5'" sing N N 121 DT "C5'" "H5''" sing N N 122 DT "C4'" "O4'" sing N N 123 DT "C4'" "C3'" sing N N 124 DT "C4'" "H4'" sing N N 125 DT "O4'" "C1'" sing N N 126 DT "C3'" "O3'" sing N N 127 DT "C3'" "C2'" sing N N 128 DT "C3'" "H3'" sing N N 129 DT "O3'" "HO3'" sing N N 130 DT "C2'" "C1'" sing N N 131 DT "C2'" "H2'" sing N N 132 DT "C2'" "H2''" sing N N 133 DT "C1'" N1 sing N N 134 DT "C1'" "H1'" sing N N 135 DT N1 C2 sing N N 136 DT N1 C6 sing N N 137 DT C2 O2 doub N N 138 DT C2 N3 sing N N 139 DT N3 C4 sing N N 140 DT N3 H3 sing N N 141 DT C4 O4 doub N N 142 DT C4 C5 sing N N 143 DT C5 C7 sing N N 144 DT C5 C6 doub N N 145 DT C7 H71 sing N N 146 DT C7 H72 sing N N 147 DT C7 H73 sing N N 148 DT C6 H6 sing N N 149 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 6WRA 'double helix' 6WRA 'a-form double helix' 6WRA 'b-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 3 1_555 D DC 7 1_555 0.587 0.554 0.481 3.737 -10.504 -13.043 1 A_DG3:DC16_D A 3 ? D 16 ? ? 1 1 A DC 4 1_555 D DG 6 1_555 0.305 0.014 0.539 4.614 -18.965 2.935 2 A_DC4:DG15_D A 4 ? D 15 ? 19 1 1 A DA 5 1_555 D DT 5 1_555 0.783 -0.362 1.154 10.339 -7.274 -5.747 3 A_DA5:DT14_D A 5 ? D 14 ? 20 1 1 A DG 6 1_555 D DC 4 1_555 0.229 -0.313 0.562 10.823 -5.524 -7.226 4 A_DG6:DC13_D A 6 ? D 13 ? 19 1 1 A DA 7 1_555 D DT 3 1_555 -0.137 -0.183 0.119 -0.423 -5.988 -7.762 5 A_DA7:DT12_D A 7 ? D 12 ? 20 1 1 A DC 8 1_555 D DG 2 1_555 -0.026 -0.345 0.221 2.700 -2.751 -3.588 6 A_DC8:DG11_D A 8 ? D 11 ? 19 1 1 A DA 9 1_555 D DT 1 1_555 -0.082 -0.070 0.182 7.750 -2.482 0.517 7 A_DA9:DT10_D A 9 ? D 10 ? 20 1 1 A DA 10 1_555 B DT 5 1_555 0.267 -0.180 0.695 11.601 -4.330 -7.491 8 A_DA10:DT5_B A 10 ? B 5 ? 20 1 1 A DG 11 1_555 B DC 4 1_555 0.091 -0.110 0.639 8.947 -7.738 3.053 9 A_DG11:DC4_B A 11 ? B 4 ? 19 1 1 A DA 12 1_555 B DT 3 1_555 -0.085 -0.266 0.160 3.295 -12.036 -6.233 10 A_DA12:DT3_B A 12 ? B 3 ? 20 1 1 A DC 13 1_555 B DG 2 1_555 -0.035 -0.212 0.412 -0.338 -15.586 3.223 11 A_DC13:DG2_B A 13 ? B 2 ? 19 1 1 A DT 14 1_555 B DA 1 1_555 0.194 -0.257 0.620 3.209 -10.490 -6.350 12 A_DT14:DA1_B A 14 ? B 1 ? 20 1 1 A DC 15 1_555 C DG 9 1_555 -0.075 -0.134 0.797 -6.665 -9.795 1.947 13 A_DC15:DG9_C A 15 ? C 9 ? 19 1 1 A DC 16 1_555 C DG 8 1_555 -0.354 -0.057 0.866 -0.003 -12.168 -0.611 14 A_DC16:DG8_C A 16 ? C 8 ? 19 1 1 A DA 17 1_555 C DT 7 1_555 0.381 -0.209 0.172 -3.093 -3.004 -6.333 15 A_DA17:DT7_C A 17 ? C 7 ? 20 1 1 A DC 18 1_555 C DG 6 1_555 -0.061 -0.211 0.282 -5.366 -9.039 -3.216 16 A_DC18:DG6_C A 18 ? C 6 ? 19 1 1 A DT 19 1_555 C DA 5 1_555 -1.548 -0.107 0.014 -4.184 -13.074 -2.761 17 A_DT19:DA5_C A 19 ? C 5 ? 20 1 1 A DC 20 1_555 C DG 4 1_555 -1.034 0.439 0.221 0.121 -11.915 2.179 18 A_DC20:DG4_C A 20 ? C 4 ? 19 1 1 A DA 21 1_555 C DT 3 1_555 1.455 0.678 0.138 -6.062 -18.400 -8.956 19 A_DA21:DT3_C A 21 ? C 3 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 3 1_555 D DC 7 1_555 A DC 4 1_555 D DG 6 1_555 0.489 -1.090 3.123 1.662 7.413 32.580 -3.027 -0.596 2.834 12.994 -2.913 33.431 1 AA_DG3DC4:DG15DC16_DD A 3 ? D 16 ? A 4 ? D 15 ? 1 A DC 4 1_555 D DG 6 1_555 A DA 5 1_555 D DT 5 1_555 -0.638 0.376 3.153 -7.860 -5.005 35.993 1.244 -0.024 3.141 -7.937 12.464 37.141 2 AA_DC4DA5:DT14DG15_DD A 4 ? D 15 ? A 5 ? D 14 ? 1 A DA 5 1_555 D DT 5 1_555 A DG 6 1_555 D DC 4 1_555 -0.285 -0.817 3.369 1.309 -0.715 28.489 -1.491 0.885 3.372 -1.451 -2.657 28.528 3 AA_DA5DG6:DC13DT14_DD A 5 ? D 14 ? A 6 ? D 13 ? 1 A DG 6 1_555 D DC 4 1_555 A DA 7 1_555 D DT 3 1_555 -0.290 -0.908 3.597 0.240 6.128 32.023 -2.765 0.561 3.368 10.981 -0.430 32.590 4 AA_DG6DA7:DT12DC13_DD A 6 ? D 13 ? A 7 ? D 12 ? 1 A DA 7 1_555 D DT 3 1_555 A DC 8 1_555 D DG 2 1_555 0.407 -0.762 3.318 -4.184 1.040 36.915 -1.336 -1.199 3.232 1.636 6.579 37.157 5 AA_DA7DC8:DG11DT12_DD A 7 ? D 12 ? A 8 ? D 11 ? 1 A DC 8 1_555 D DG 2 1_555 A DA 9 1_555 D DT 1 1_555 -0.709 -1.589 3.123 -5.676 4.716 29.698 -3.888 0.290 2.924 9.027 10.863 30.581 6 AA_DC8DA9:DT10DG11_DD A 8 ? D 11 ? A 9 ? D 10 ? 1 A DA 9 1_555 D DT 1 1_555 A DA 10 1_555 B DT 5 1_555 -1.505 -0.792 3.107 -5.607 -6.620 31.707 -0.250 1.687 3.408 -11.841 10.029 32.843 7 AA_DA9DA10:DT5DT10_BD A 9 ? D 10 ? A 10 ? B 5 ? 1 A DA 10 1_555 B DT 5 1_555 A DG 11 1_555 B DC 4 1_555 0.543 -0.100 3.438 -0.392 3.634 31.293 -0.896 -1.077 3.398 6.708 0.724 31.501 8 AA_DA10DG11:DC4DT5_BB A 10 ? B 5 ? A 11 ? B 4 ? 1 A DG 11 1_555 B DC 4 1_555 A DA 12 1_555 B DT 3 1_555 -0.135 -0.615 3.333 1.592 4.662 34.399 -1.747 0.472 3.216 7.833 -2.676 34.739 9 AA_DG11DA12:DT3DC4_BB A 11 ? B 4 ? A 12 ? B 3 ? 1 A DA 12 1_555 B DT 3 1_555 A DC 13 1_555 B DG 2 1_555 0.947 -1.153 3.275 -1.927 -4.836 35.998 -1.162 -1.790 3.344 -7.774 3.098 36.360 10 AA_DA12DC13:DG2DT3_BB A 12 ? B 3 ? A 13 ? B 2 ? 1 A DC 13 1_555 B DG 2 1_555 A DT 14 1_555 B DA 1 1_555 -0.572 -1.499 3.183 -2.125 -0.042 36.451 -2.388 0.626 3.212 -0.067 3.394 36.511 11 AA_DC13DT14:DA1DG2_BB A 13 ? B 2 ? A 14 ? B 1 ? 1 A DT 14 1_555 B DA 1 1_555 A DC 15 1_555 C DG 9 1_555 -0.461 -0.913 3.370 -1.185 -0.183 29.662 -1.743 0.642 3.391 -0.358 2.313 29.686 12 AA_DT14DC15:DG9DA1_CB A 14 ? B 1 ? A 15 ? C 9 ? 1 A DC 15 1_555 C DG 9 1_555 A DC 16 1_555 C DG 8 1_555 -0.666 0.125 3.311 0.854 7.198 21.955 -2.237 1.966 3.162 18.271 -2.168 23.107 13 AA_DC15DC16:DG8DG9_CC A 15 ? C 9 ? A 16 ? C 8 ? 1 A DC 16 1_555 C DG 8 1_555 A DA 17 1_555 C DT 7 1_555 -0.110 2.066 3.565 3.687 -8.888 53.263 2.843 0.358 3.194 -9.824 -4.075 54.062 14 AA_DC16DA17:DT7DG8_CC A 16 ? C 8 ? A 17 ? C 7 ? 1 A DA 17 1_555 C DT 7 1_555 A DC 18 1_555 C DG 6 1_555 0.315 -0.638 3.341 -2.945 1.472 26.969 -1.734 -1.421 3.249 3.142 6.285 27.166 15 AA_DA17DC18:DG6DT7_CC A 17 ? C 7 ? A 18 ? C 6 ? 1 A DC 18 1_555 C DG 6 1_555 A DT 19 1_555 C DA 5 1_555 0.037 -0.423 3.194 4.124 4.530 28.274 -1.818 0.810 3.064 9.137 -8.319 28.917 16 AA_DC18DT19:DA5DG6_CC A 18 ? C 6 ? A 19 ? C 5 ? 1 A DT 19 1_555 C DA 5 1_555 A DC 20 1_555 C DG 4 1_555 0.801 0.390 3.333 1.503 1.453 34.209 0.427 -1.118 3.377 2.467 -2.552 34.271 17 AA_DT19DC20:DG4DA5_CC A 19 ? C 5 ? A 20 ? C 4 ? 1 A DC 20 1_555 C DG 4 1_555 A DA 21 1_555 C DT 3 1_555 -0.547 1.482 3.591 -0.282 -4.721 50.931 2.070 0.613 3.452 -5.476 0.327 51.136 18 AA_DC20DA21:DT3DG4_CC A 20 ? C 4 ? A 21 ? C 3 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Science Foundation (NSF, United States)' 'United States' 1360635 1 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R01GM104960 2 'National Science Foundation (NSF, United States)' 'United States' NSF2004250 3 # _pdbx_entity_nonpoly.entity_id 5 _pdbx_entity_nonpoly.name 'MAGNESIUM ION' _pdbx_entity_nonpoly.comp_id MG # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 5KEK _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? #