data_6AC7 # _entry.id 6AC7 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.370 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 6AC7 pdb_00006ac7 10.2210/pdb6ac7/pdb WWPDB D_1300006886 ? ? BMRB 36203 ? ? # _pdbx_database_related.db_name BMRB _pdbx_database_related.details 'Structure of a G-quadruplex' _pdbx_database_related.db_id 36203 _pdbx_database_related.content_type unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.entry_id 6AC7 _pdbx_database_status.recvd_initial_deposition_date 2018-07-25 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Sengar, A.' 1 ? 'Vandana, J.J.' 2 ? 'Chambers, V.S.' 3 ? 'Di Antonio, M.' 4 ? 'Winnerdy, F.R.' 5 ? 'Balasubramanian, S.' 6 ? 'Phan, A.T.' 7 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 47 _citation.language ? _citation.page_first 1564 _citation.page_last 1572 _citation.title 'Structure of a (3+1) hybrid G-quadruplex in the PARP1 promoter.' _citation.year 2019 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gky1179 _citation.pdbx_database_id_PubMed 30551210 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Sengar, A.' 1 ? primary 'Vandana, J.J.' 2 ? primary 'Chambers, V.S.' 3 ? primary 'Di Antonio, M.' 4 ? primary 'Winnerdy, F.R.' 5 ? primary 'Balasubramanian, S.' 6 ? primary 'Phan, A.T.' 7 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description "5'-D(*TP*GP*GP*GP*GP*TP*CP*CP*GP*AP*GP*GP*CP*GP*GP*GP*GP*CP*TP*TP*GP*GP*G)-3'" _entity.formula_weight 7250.629 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_name_com.entity_id 1 _entity_name_com.name TP3-T6 # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;(DT)(DG)(DG)(DG)(DG)(DT)(DC)(DC)(DG)(DA)(DG)(DG)(DC)(DG)(DG)(DG)(DG)(DC)(DT)(DT) (DG)(DG)(DG) ; _entity_poly.pdbx_seq_one_letter_code_can TGGGGTCCGAGGCGGGGCTTGGG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DT n 1 2 DG n 1 3 DG n 1 4 DG n 1 5 DG n 1 6 DT n 1 7 DC n 1 8 DC n 1 9 DG n 1 10 DA n 1 11 DG n 1 12 DG n 1 13 DC n 1 14 DG n 1 15 DG n 1 16 DG n 1 17 DG n 1 18 DC n 1 19 DT n 1 20 DT n 1 21 DG n 1 22 DG n 1 23 DG n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 23 _pdbx_entity_src_syn.organism_scientific 'Homo sapiens' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 9606 _pdbx_entity_src_syn.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 6AC7 _struct_ref.pdbx_db_accession 6AC7 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 6AC7 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 23 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 6AC7 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 23 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 23 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 1H-1H NOESY' 1 isotropic 2 2 1 '2D 1H-1H NOESY' 2 isotropic 3 1 2 '2D 1H-1H NOESY' 1 isotropic 4 1 3 '1D 1H-15N HMQC' 1 isotropic # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.details _pdbx_nmr_exptl_sample_conditions.ionic_strength_err _pdbx_nmr_exptl_sample_conditions.ionic_strength_units _pdbx_nmr_exptl_sample_conditions.label _pdbx_nmr_exptl_sample_conditions.pH_err _pdbx_nmr_exptl_sample_conditions.pH_units _pdbx_nmr_exptl_sample_conditions.pressure_err _pdbx_nmr_exptl_sample_conditions.temperature_err _pdbx_nmr_exptl_sample_conditions.temperature_units 1 298 atm 1 7 100 '70 mM KCl, 20 mM KPi, pH 7.0' ? mM 'Phosphate buffer' ? pH ? ? K 2 283 atm 1 7 100 '70 mM KCl, 20 mM KPi, pH 7.0' ? mM 'Low temperature phosphate buffer' ? pH ? ? K # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 '1 mM TP3-T6, 70 mM potassium chloride, 7.7 mM KH2PO4, 12.3 mM K2HPO4, 90% H2O/10% D2O' '90% H2O/10% D2O' TP3-T6-H2O solution '1mM TP3-T6 oligonucleotide sample in H2O solvent' 2 '1 mM TP3-T6, 70 mM potassium chloride, 7.7 mM KH2PO4, 12.3 mM K2HPO4, 100% D2O' '100% D2O' TP3-T6-D2O solution '1mM TP3-T6 oligonucleotide sample in D2O solvent' 3 '0.4 mM U-4% 15N Guanine TP3-T6, 70 mM potassium chloride, 7.7 mM KH2PO4, 12.3 mM K2HPO4, 90% H2O/10% D2O' '90% H2O/10% D2O' 15N_samples solution '0.4 mM 4%-15N labeled TP3-T6 oligonucleotides samples in H2O solvent' # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 'AVANCE III' ? Bruker 600 ? 2 'AVANCE III' ? Bruker 800 ? # loop_ _pdbx_nmr_refine.entry_id _pdbx_nmr_refine.method _pdbx_nmr_refine.details _pdbx_nmr_refine.software_ordinal 6AC7 'DGSA-distance geometry simulated annealing' ? 1 6AC7 'molecular dynamics' ? 2 # _pdbx_nmr_ensemble.entry_id 6AC7 _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 6AC7 _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 refinement 'X-PLOR NIH' 2.42 'Schwieters, Kuszewski, Tjandra and Clore' 2 'structure calculation' 'X-PLOR NIH' 2.42 'Schwieters, Kuszewski, Tjandra and Clore' 3 'chemical shift assignment' Sparky 3.12 Goddard 4 'peak picking' Sparky 3.12 Goddard # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 6AC7 _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 6AC7 _struct.title 'Structure of a (3+1) hybrid G-quadruplex in the PARP1 promoter' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 6AC7 _struct_keywords.text 'G-quadruplex, DNA' _struct_keywords.pdbx_keywords DNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 2 N7 ? ? ? 1_555 A DG 14 N1 ? ? A DG 2 A DG 14 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog2 hydrog ? ? A DG 2 O6 ? ? ? 1_555 A DG 14 N2 ? ? A DG 2 A DG 14 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog3 hydrog ? ? A DG 3 N7 ? ? ? 1_555 A DG 12 N2 ? ? A DG 3 A DG 12 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog4 hydrog ? ? A DG 3 O6 ? ? ? 1_555 A DG 12 N1 ? ? A DG 3 A DG 12 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog5 hydrog ? ? A DG 3 N1 ? ? ? 1_555 A DG 21 O6 ? ? A DG 3 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog6 hydrog ? ? A DG 3 N2 ? ? ? 1_555 A DG 21 N7 ? ? A DG 3 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A DG 4 N1 ? ? ? 1_555 A DG 11 O6 ? ? A DG 4 A DG 11 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A DG 4 N2 ? ? ? 1_555 A DG 11 N7 ? ? A DG 4 A DG 11 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A DG 4 N7 ? ? ? 1_555 A DG 22 N2 ? ? A DG 4 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog10 hydrog ? ? A DG 4 O6 ? ? ? 1_555 A DG 22 N1 ? ? A DG 4 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog11 hydrog ? ? A DG 5 N1 ? ? ? 1_555 A DG 9 O6 ? ? A DG 5 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog12 hydrog ? ? A DG 5 N2 ? ? ? 1_555 A DG 9 N7 ? ? A DG 5 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog13 hydrog ? ? A DG 5 N7 ? ? ? 1_555 A DG 23 N2 ? ? A DG 5 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog14 hydrog ? ? A DG 5 O6 ? ? ? 1_555 A DG 23 N1 ? ? A DG 5 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog15 hydrog ? ? A DG 9 N1 ? ? ? 1_555 A DG 17 O6 ? ? A DG 9 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog16 hydrog ? ? A DG 9 N2 ? ? ? 1_555 A DG 17 N7 ? ? A DG 9 A DG 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog17 hydrog ? ? A DG 11 N1 ? ? ? 1_555 A DG 16 O6 ? ? A DG 11 A DG 16 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog18 hydrog ? ? A DG 11 N2 ? ? ? 1_555 A DG 16 N7 ? ? A DG 11 A DG 16 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog19 hydrog ? ? A DG 12 N7 ? ? ? 1_555 A DG 15 N2 ? ? A DG 12 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog20 hydrog ? ? A DG 12 O6 ? ? ? 1_555 A DG 15 N1 ? ? A DG 12 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog21 hydrog ? ? A DG 15 N7 ? ? ? 1_555 A DG 21 N2 ? ? A DG 15 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog22 hydrog ? ? A DG 15 O6 ? ? ? 1_555 A DG 21 N1 ? ? A DG 15 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog23 hydrog ? ? A DG 16 N1 ? ? ? 1_555 A DG 22 O6 ? ? A DG 16 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog24 hydrog ? ? A DG 16 N2 ? ? ? 1_555 A DG 22 N7 ? ? A DG 16 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog25 hydrog ? ? A DG 17 N1 ? ? ? 1_555 A DG 23 O6 ? ? A DG 17 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog26 hydrog ? ? A DG 17 N2 ? ? ? 1_555 A DG 23 N7 ? ? A DG 17 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 6AC7 _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DT 1 1 1 DT DT A . n A 1 2 DG 2 2 2 DG DG A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DG 4 4 4 DG DG A . n A 1 5 DG 5 5 5 DG DG A . n A 1 6 DT 6 6 6 DT DT A . n A 1 7 DC 7 7 7 DC DC A . n A 1 8 DC 8 8 8 DC DC A . n A 1 9 DG 9 9 9 DG DG A . n A 1 10 DA 10 10 10 DA DA A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DG 12 12 12 DG DG A . n A 1 13 DC 13 13 13 DC DC A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DG 16 16 16 DG DG A . n A 1 17 DG 17 17 17 DG DG A . n A 1 18 DC 18 18 18 DC DC A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DT 20 20 20 DT DT A . n A 1 21 DG 21 21 21 DG DG A . n A 1 22 DG 22 22 22 DG DG A . n A 1 23 DG 23 23 23 DG DG A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 0 ? 1 MORE 0 ? 1 'SSA (A^2)' 4120 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2019-02-27 2 'Structure model' 1 1 2019-06-12 3 'Structure model' 1 2 2019-07-10 4 'Structure model' 1 3 2023-06-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Structure summary' 3 3 'Structure model' 'Data collection' 4 3 'Structure model' 'Database references' 5 4 'Structure model' 'Database references' 6 4 'Structure model' Other # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' pdbx_nmr_software 2 2 'Structure model' struct 3 3 'Structure model' citation 4 3 'Structure model' pdbx_nmr_spectrometer 5 4 'Structure model' database_2 6 4 'Structure model' pdbx_database_status # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_pdbx_nmr_software.name' 2 2 'Structure model' '_struct.title' 3 3 'Structure model' '_citation.journal_volume' 4 3 'Structure model' '_citation.page_first' 5 3 'Structure model' '_citation.page_last' 6 3 'Structure model' '_citation.year' 7 3 'Structure model' '_pdbx_nmr_spectrometer.model' 8 4 'Structure model' '_database_2.pdbx_DOI' 9 4 'Structure model' '_database_2.pdbx_database_accession' 10 4 'Structure model' '_pdbx_database_status.status_code_nmr_data' # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 TP3-T6 1 ? mM 'natural abundance' 1 'potassium chloride' 70 ? mM 'natural abundance' 1 KH2PO4 7.7 ? mM 'natural abundance' 1 K2HPO4 12.3 ? mM 'natural abundance' 2 TP3-T6 1 ? mM 'natural abundance' 2 'potassium chloride' 70 ? mM 'natural abundance' 2 KH2PO4 7.7 ? mM 'natural abundance' 2 K2HPO4 12.3 ? mM 'natural abundance' 3 TP3-T6 0.4 ? mM 'U-4% 15N Guanine' 3 'potassium chloride' 70 ? mM 'natural abundance' 3 KH2PO4 7.7 ? mM 'natural abundance' 3 K2HPO4 12.3 ? mM 'natural abundance' # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 5 _pdbx_validate_close_contact.auth_atom_id_1 H22 _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 DG _pdbx_validate_close_contact.auth_seq_id_1 5 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 OP1 _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 DC _pdbx_validate_close_contact.auth_seq_id_2 7 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 1.50 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 6AC7 'double helix' 6AC7 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 2 1_555 A DG 14 1_555 -5.333 0.151 0.061 -11.102 1.851 -107.699 1 A_DG2:DG14_A A 2 ? A 14 ? 7 4 1 A DG 21 1_555 A DG 15 1_555 1.471 3.329 -0.172 -6.584 3.839 -97.582 2 A_DG21:DG15_A A 21 ? A 15 ? 6 3 1 A DG 3 1_555 A DG 12 1_555 -1.052 -3.375 0.505 -2.006 -3.127 98.574 3 A_DG3:DG12_A A 3 ? A 12 ? 6 3 1 A DG 5 1_555 A DG 9 1_555 0.521 3.446 0.227 -8.029 -1.322 -100.610 4 A_DG5:DG9_A A 5 ? A 9 ? 6 3 1 A DG 11 1_555 A DG 16 1_555 1.697 3.830 0.331 -9.754 -4.159 -82.085 5 A_DG11:DG16_A A 11 ? A 16 ? 6 3 1 A DG 4 1_555 A DG 22 1_555 -1.077 -3.742 0.061 -2.992 7.142 92.697 6 A_DG4:DG22_A A 4 ? A 22 ? 6 3 1 A DG 17 1_555 A DG 23 1_555 0.466 3.586 -0.086 -3.908 -0.232 -100.952 7 A_DG17:DG23_A A 17 ? A 23 ? 6 3 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 2 1_555 A DG 14 1_555 A DG 21 1_555 A DG 15 1_555 -0.621 -2.315 -3.367 5.506 -1.215 85.925 -1.724 0.328 -3.368 -0.891 -4.036 86.074 1 AA_DG2DG21:DG15DG14_AA A 2 ? A 14 ? A 21 ? A 15 ? 1 A DG 21 1_555 A DG 15 1_555 A DG 3 1_555 A DG 12 1_555 -2.415 -3.338 -0.006 7.371 2.704 175.660 -1.670 1.209 -0.015 1.353 -3.688 175.670 2 AA_DG21DG3:DG12DG15_AA A 21 ? A 15 ? A 3 ? A 12 ? 1 A DG 5 1_555 A DG 9 1_555 A DG 11 1_555 A DG 16 1_555 -0.520 -1.152 -3.442 -0.150 0.850 56.995 -1.158 0.553 -3.456 0.890 0.157 57.001 3 AA_DG5DG11:DG16DG9_AA A 5 ? A 9 ? A 11 ? A 16 ? 1 A DG 11 1_555 A DG 16 1_555 A DG 4 1_555 A DG 22 1_555 -1.711 -3.442 -0.403 -1.741 1.125 178.262 -1.721 0.856 -0.403 0.563 0.871 178.263 4 AA_DG11DG4:DG22DG16_AA A 11 ? A 16 ? A 4 ? A 22 ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? #