data_6H1K # _entry.id 6H1K # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.371 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 6H1K pdb_00006h1k 10.2210/pdb6h1k/pdb WWPDB D_1200010903 ? ? BMRB 34302 ? ? # _pdbx_database_related.db_name BMRB _pdbx_database_related.details 'The major G-quadruplex form of HIV-1 LTR' _pdbx_database_related.db_id 34302 _pdbx_database_related.content_type unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.entry_id 6H1K _pdbx_database_status.recvd_initial_deposition_date 2018-07-11 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.status_code_cs REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y _pdbx_database_status.status_code_nmr_data REL # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Phan, A.T.' 1 ? 'Heddi, B.' 2 ? 'Butovskaya, E.' 3 ? 'Bakalar, B.' 4 ? 'Richter, S.N.' 5 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'J. Am. Chem. Soc.' _citation.journal_id_ASTM JACSAT _citation.journal_id_CSD ? _citation.journal_id_ISSN 1520-5126 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 140 _citation.language ? _citation.page_first 13654 _citation.page_last 13662 _citation.title 'Major G-Quadruplex Form of HIV-1 LTR Reveals a (3 + 1) Folding Topology Containing a Stem-Loop.' _citation.year 2018 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1021/jacs.8b05332 _citation.pdbx_database_id_PubMed 30299955 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Butovskaya, E.' 1 ? primary 'Heddi, B.' 2 ? primary 'Bakalar, B.' 3 ? primary 'Richter, S.N.' 4 0000-0002-5446-9029 primary 'Phan, A.T.' 5 0000-0002-4970-3861 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'DNA (28-MER)' _entity.formula_weight 8865.647 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;(DG)(DG)(DG)(DA)(DG)(DG)(DC)(DG)(DT)(DG)(DG)(DC)(DC)(DT)(DG)(DG)(DG)(DC)(DG)(DG) (DG)(DA)(DC)(DT)(DG)(DG)(DG)(DG) ; _entity_poly.pdbx_seq_one_letter_code_can GGGAGGCGTGGCCTGGGCGGGACTGGGG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DG n 1 3 DG n 1 4 DA n 1 5 DG n 1 6 DG n 1 7 DC n 1 8 DG n 1 9 DT n 1 10 DG n 1 11 DG n 1 12 DC n 1 13 DC n 1 14 DT n 1 15 DG n 1 16 DG n 1 17 DG n 1 18 DC n 1 19 DG n 1 20 DG n 1 21 DG n 1 22 DA n 1 23 DC n 1 24 DT n 1 25 DG n 1 26 DG n 1 27 DG n 1 28 DG n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 28 _pdbx_entity_src_syn.organism_scientific 'Human immunodeficiency virus 1' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 11676 _pdbx_entity_src_syn.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 6H1K _struct_ref.pdbx_db_accession 6H1K _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 6H1K _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 28 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 6H1K _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 28 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 28 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 1H-1H NOESY' 1 isotropic 2 1 1 '2D 1H-1H TOCSY' 1 isotropic 3 1 1 '2D 1H-13C HSQC' 1 isotropic 4 1 1 '2D 1H-13C HMBC' 1 isotropic 5 1 1 '2D 1H-13C HSQC aromatic' 1 isotropic # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure_units Pa _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 7.0 _pdbx_nmr_exptl_sample_conditions.ionic_strength '70mM KCL, 20mM KPi' _pdbx_nmr_exptl_sample_conditions.details ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_err ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_units 'Not defined' _pdbx_nmr_exptl_sample_conditions.label conditions_1 _pdbx_nmr_exptl_sample_conditions.pH_err ? _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.pressure_err ? _pdbx_nmr_exptl_sample_conditions.temperature_err ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.contents '70 mM NA potassium chloride, 20 mM NA potassium phosphate, 1 mM DNA (28-MER), 90% H2O/10% D2O' _pdbx_nmr_sample_details.solvent_system '90% H2O/10% D2O' _pdbx_nmr_sample_details.label ltr3 _pdbx_nmr_sample_details.type solution _pdbx_nmr_sample_details.details ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 'AVANCE II' ? Bruker 600 ? 2 'AVANCE II' ? Bruker 700 ? # _pdbx_nmr_refine.entry_id 6H1K _pdbx_nmr_refine.method 'DGSA-distance geometry simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 2 # _pdbx_nmr_ensemble.entry_id 6H1K _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 6H1K _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'structures with the lowest energy' # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 refinement Xplor-NIH ? 'Schwieters, Kuszewski, Tjandra and Clore' 2 'structure calculation' Xplor-NIH ? 'Schwieters, Kuszewski, Tjandra and Clore' 3 'chemical shift assignment' Sparky ? Goddard 4 'peak picking' Sparky ? Goddard # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 6H1K _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 6H1K _struct.title 'The major G-quadruplex form of HIV-1 LTR' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 6H1K _struct_keywords.text 'G-quadruplex structure, HIV-1 LTR, stem loop, DNA' _struct_keywords.pdbx_keywords DNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 1 N7 ? ? ? 1_555 A DG 20 N2 ? ? A DG 1 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog2 hydrog ? ? A DG 1 O6 ? ? ? 1_555 A DG 20 N1 ? ? A DG 1 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog3 hydrog ? ? A DG 1 N1 ? ? ? 1_555 A DG 27 O6 ? ? A DG 1 A DG 27 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog4 hydrog ? ? A DG 1 N2 ? ? ? 1_555 A DG 27 N7 ? ? A DG 1 A DG 27 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog5 hydrog ? ? A DG 2 N1 ? ? ? 1_555 A DG 19 O6 ? ? A DG 2 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog6 hydrog ? ? A DG 2 N2 ? ? ? 1_555 A DG 19 N7 ? ? A DG 2 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A DG 2 N7 ? ? ? 1_555 A DG 26 N2 ? ? A DG 2 A DG 26 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A DG 2 O6 ? ? ? 1_555 A DG 26 N1 ? ? A DG 2 A DG 26 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A DG 5 N1 ? ? ? 1_555 A DC 13 N3 ? ? A DG 5 A DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DG 5 N2 ? ? ? 1_555 A DC 13 O2 ? ? A DG 5 A DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DG 5 O6 ? ? ? 1_555 A DC 13 N4 ? ? A DG 5 A DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DG 6 N1 ? ? ? 1_555 A DC 12 N3 ? ? A DG 6 A DC 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DG 6 N2 ? ? ? 1_555 A DC 12 O2 ? ? A DG 6 A DC 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DG 6 O6 ? ? ? 1_555 A DC 12 N4 ? ? A DG 6 A DC 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DC 7 N3 ? ? ? 1_555 A DG 11 N1 ? ? A DC 7 A DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 7 N4 ? ? ? 1_555 A DG 11 O6 ? ? A DC 7 A DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DC 7 O2 ? ? ? 1_555 A DG 11 N2 ? ? A DC 7 A DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DG 15 N7 ? ? ? 1_555 A DG 19 N2 ? ? A DG 15 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog19 hydrog ? ? A DG 15 O6 ? ? ? 1_555 A DG 19 N1 ? ? A DG 15 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog20 hydrog ? ? A DG 15 N1 ? ? ? 1_555 A DG 26 O6 ? ? A DG 15 A DG 26 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog21 hydrog ? ? A DG 15 N2 ? ? ? 1_555 A DG 26 N7 ? ? A DG 15 A DG 26 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog22 hydrog ? ? A DG 16 N1 ? ? ? 1_555 A DG 20 O6 ? ? A DG 16 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog23 hydrog ? ? A DG 16 N2 ? ? ? 1_555 A DG 20 N7 ? ? A DG 16 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog24 hydrog ? ? A DG 16 N7 ? ? ? 1_555 A DG 27 N2 ? ? A DG 16 A DG 27 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog25 hydrog ? ? A DG 16 O6 ? ? ? 1_555 A DG 27 N1 ? ? A DG 16 A DG 27 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog26 hydrog ? ? A DG 17 N1 ? ? ? 1_555 A DG 21 O6 ? ? A DG 17 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog27 hydrog ? ? A DG 17 N2 ? ? ? 1_555 A DG 21 N7 ? ? A DG 17 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog28 hydrog ? ? A DG 17 N7 ? ? ? 1_555 A DG 28 N2 ? ? A DG 17 A DG 28 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog29 hydrog ? ? A DG 17 O6 ? ? ? 1_555 A DG 28 N1 ? ? A DG 17 A DG 28 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog30 hydrog ? ? A DG 21 N1 ? ? ? 1_555 A DG 25 O6 ? ? A DG 21 A DG 25 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog31 hydrog ? ? A DG 21 N2 ? ? ? 1_555 A DG 25 N7 ? ? A DG 21 A DG 25 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog32 hydrog ? ? A DG 25 N1 ? ? ? 1_555 A DG 28 O6 ? ? A DG 25 A DG 28 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog33 hydrog ? ? A DG 25 N2 ? ? ? 1_555 A DG 28 N7 ? ? A DG 25 A DG 28 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 6H1K _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DG 2 2 2 DG DG A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DA 4 4 4 DA DA A . n A 1 5 DG 5 5 5 DG DG A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DC 7 7 7 DC DC A . n A 1 8 DG 8 8 8 DG DG A . n A 1 9 DT 9 9 9 DT DT A . n A 1 10 DG 10 10 10 DG DG A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DC 12 12 12 DC DC A . n A 1 13 DC 13 13 13 DC DC A . n A 1 14 DT 14 14 14 DT DT A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DG 16 16 16 DG DG A . n A 1 17 DG 17 17 17 DG DG A . n A 1 18 DC 18 18 18 DC DC A . n A 1 19 DG 19 19 19 DG DG A . n A 1 20 DG 20 20 20 DG DG A . n A 1 21 DG 21 21 21 DG DG A . n A 1 22 DA 22 22 22 DA DA A . n A 1 23 DC 23 23 23 DC DC A . n A 1 24 DT 24 24 24 DT DT A . n A 1 25 DG 25 25 25 DG DG A . n A 1 26 DG 26 26 26 DG DG A . n A 1 27 DG 27 27 27 DG DG A . n A 1 28 DG 28 28 28 DG DG A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 0 ? 1 MORE 0 ? 1 'SSA (A^2)' 5270 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2018-10-17 2 'Structure model' 1 1 2018-11-07 3 'Structure model' 1 2 2019-05-08 4 'Structure model' 1 3 2023-06-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 3 'Structure model' 'Data collection' 4 4 'Structure model' 'Data collection' 5 4 'Structure model' 'Database references' 6 4 'Structure model' Other # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 3 'Structure model' pdbx_nmr_software 3 3 'Structure model' pdbx_seq_map_depositor_info 4 4 'Structure model' database_2 5 4 'Structure model' pdbx_database_status 6 4 'Structure model' pdbx_nmr_spectrometer # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 3 'Structure model' '_pdbx_nmr_software.name' 5 3 'Structure model' '_pdbx_seq_map_depositor_info.one_letter_code_mod' 6 4 'Structure model' '_database_2.pdbx_DOI' 7 4 'Structure model' '_database_2.pdbx_database_accession' 8 4 'Structure model' '_pdbx_database_status.status_code_nmr_data' 9 4 'Structure model' '_pdbx_nmr_spectrometer.model' # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 'potassium chloride' 70 ? mM NA 1 'potassium phosphate' 20 ? mM NA 1 'DNA (28-MER)' 1 ? mM 'natural abundance' # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "H3'" A DG 26 ? ? "O4'" A DG 27 ? ? 1.58 2 2 "O5'" A DG 1 ? ? "H1'" A DG 25 ? ? 1.59 3 4 OP1 A DT 9 ? ? H22 A DG 11 ? ? 1.56 4 4 "O5'" A DG 1 ? ? "H1'" A DG 25 ? ? 1.58 5 5 "H4'" A DC 18 ? ? OP2 A DG 20 ? ? 1.45 6 5 "H3'" A DG 25 ? ? OP2 A DG 27 ? ? 1.50 7 9 O2 A DC 7 ? ? H8 A DG 8 ? ? 1.50 8 9 "O5'" A DG 1 ? ? "H1'" A DG 25 ? ? 1.59 9 9 "H1'" A DT 14 ? ? OP2 A DG 15 ? ? 1.60 10 10 "H1'" A DG 5 ? ? "O4'" A DG 6 ? ? 1.58 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 6 C6 A DT 14 ? ? C5 A DT 14 ? ? C7 A DT 14 ? ? 119.18 122.90 -3.72 0.60 N 2 9 C6 A DT 14 ? ? C5 A DT 14 ? ? C7 A DT 14 ? ? 119.25 122.90 -3.65 0.60 N 3 10 C6 A DT 9 ? ? C5 A DT 9 ? ? C7 A DT 9 ? ? 119.29 122.90 -3.61 0.60 N 4 10 C6 A DT 14 ? ? C5 A DT 14 ? ? C7 A DT 14 ? ? 119.19 122.90 -3.71 0.60 N # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 6H1K 'double helix' 6H1K 'hairpin loop' 6H1K 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 5 1_555 A DC 13 1_555 -0.906 -0.259 -0.495 1.356 3.910 2.122 1 A_DG5:DC13_A A 5 ? A 13 ? 19 1 1 A DG 6 1_555 A DC 12 1_555 -0.386 -0.247 -0.085 3.493 4.113 -2.405 2 A_DG6:DC12_A A 6 ? A 12 ? 19 1 1 A DC 7 1_555 A DG 11 1_555 0.042 -0.139 -0.744 -5.408 13.171 -5.124 3 A_DC7:DG11_A A 7 ? A 11 ? 19 1 1 A DG 15 1_555 A DG 19 1_555 -0.985 -3.843 -0.091 6.132 -1.279 92.816 4 A_DG15:DG19_A A 15 ? A 19 ? 6 3 1 A DG 16 1_555 A DG 27 1_555 -1.015 -3.844 0.422 -5.709 2.216 94.204 5 A_DG16:DG27_A A 16 ? A 27 ? 6 3 1 A DG 20 1_555 A DG 1 1_555 1.335 3.555 -0.230 -4.484 3.137 -89.585 6 A_DG20:DG1_A A 20 ? A 1 ? 6 3 1 A DG 25 1_555 A DG 28 1_555 1.594 3.590 0.746 -25.475 -7.831 -90.080 7 A_DG25:DG28_A A 25 ? A 28 ? 6 3 1 A DG 21 1_555 A DG 17 1_555 -0.647 -3.439 -0.141 11.447 0.351 97.986 8 A_DG21:DG17_A A 21 ? A 17 ? 6 3 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 5 1_555 A DC 13 1_555 A DG 6 1_555 A DC 12 1_555 -0.102 -1.639 3.688 -1.559 -7.039 30.942 -1.465 -0.152 3.956 -12.973 2.873 31.751 1 AA_DG5DG6:DC12DC13_AA A 5 ? A 13 ? A 6 ? A 12 ? 1 A DG 6 1_555 A DC 12 1_555 A DC 7 1_555 A DG 11 1_555 -0.216 -1.593 4.492 3.605 -2.640 30.792 -2.269 1.361 4.555 -4.940 -6.745 31.107 2 AA_DG6DC7:DG11DC12_AA A 6 ? A 12 ? A 7 ? A 11 ? 1 A DG 15 1_555 A DG 19 1_555 A DG 16 1_555 A DG 27 1_555 0.879 3.446 -0.783 -169.345 42.848 -27.635 -1.632 0.806 -0.180 -21.920 -86.634 -174.836 3 AA_DG15DG16:DG27DG19_AA A 15 ? A 19 ? A 16 ? A 27 ? 1 A DG 16 1_555 A DG 27 1_555 A DG 20 1_555 A DG 1 1_555 1.456 3.820 0.280 -2.420 -7.566 -175.410 -1.911 0.728 0.291 3.786 -1.211 -175.421 4 AA_DG16DG20:DG1DG27_AA A 16 ? A 27 ? A 20 ? A 1 ? 1 A DG 25 1_555 A DG 28 1_555 A DG 21 1_555 A DG 17 1_555 -1.640 -3.405 -0.473 9.744 -7.051 178.808 -1.703 0.820 -0.473 -3.526 -4.872 178.815 5 AA_DG25DG21:DG17DG28_AA A 25 ? A 28 ? A 21 ? A 17 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'Ministry of Education (Singapore)' Singapore MOE2012-T2-1-102 1 'Bill & Melinda Gates Foundation' Italy 'OPP1035881, OPP1097238' 2 'European Research Council' Italy 'ERC Consolidator grant 615879' 3 # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? #