data_6XXA # _entry.id 6XXA # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.330 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code PDB 6XXA WWPDB D_1292106479 BMRB 34484 # loop_ _pdbx_database_related.db_name _pdbx_database_related.details _pdbx_database_related.db_id _pdbx_database_related.content_type PDB 'Additional refinement with xplor-NIH' 6XWJ re-refinement BMRB ;Constitutive decay element CDE2 from human 3'UTR ; 34484 unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.entry_id 6XXA _pdbx_database_status.recvd_initial_deposition_date 2020-01-27 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.status_code_cs REL _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Schwalbe, H.' 1 0000-0001-5693-7909 'Binas, O.' 2 0000-0003-4727-7253 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 48 _citation.language ? _citation.page_first 7385 _citation.page_last 7403 _citation.title 'Structural basis for the recognition of transiently structured AU-rich elements by Roquin.' _citation.year 2020 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkaa465 _citation.pdbx_database_id_PubMed 32491174 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Binas, O.' 1 ? primary 'Tants, J.N.' 2 ? primary 'Peter, S.A.' 3 ? primary 'Janowski, R.' 4 ? primary 'Davydova, E.' 5 ? primary 'Braun, J.' 6 ? primary 'Niessing, D.' 7 ? primary 'Schwalbe, H.' 8 ? primary 'Weigand, J.E.' 9 ? primary 'Schlundt, A.' 10 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description CDE2 _entity.formula_weight 6690.004 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGUGCCUAAUAUUUAGGCACC _entity_poly.pdbx_seq_one_letter_code_can GGUGCCUAAUAUUUAGGCACC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 U n 1 4 G n 1 5 C n 1 6 C n 1 7 U n 1 8 A n 1 9 A n 1 10 U n 1 11 A n 1 12 U n 1 13 U n 1 14 U n 1 15 A n 1 16 G n 1 17 G n 1 18 C n 1 19 A n 1 20 C n 1 21 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 21 _pdbx_entity_src_syn.organism_scientific 'Thermosinus carboxydivorans Nor1' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 401526 _pdbx_entity_src_syn.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 6XXA _struct_ref.pdbx_db_accession 6XXA _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 6XXA _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 21 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 6XXA _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 21 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 21 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 1H-1H NOESY' 4 isotropic 2 1 1 '2D 1H-13C HSQC' 2 isotropic 3 2 2 '2D gamma HCN' 3 isotropic 4 2 2 '3D HCN' 1 isotropic 5 2 2 fwHCCH-TOCSY-CCH-E.COSY 1 isotropic 6 2 2 '3D HCP' 1 isotropic 7 2 2 '2D qHCP' 1 isotropic 8 2 2 HCCH-TOCSY 1 isotropic 9 2 2 '2D PFIDS' 5 isotropic # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.details _pdbx_nmr_exptl_sample_conditions.ionic_strength_err _pdbx_nmr_exptl_sample_conditions.ionic_strength_units _pdbx_nmr_exptl_sample_conditions.label _pdbx_nmr_exptl_sample_conditions.pH_err _pdbx_nmr_exptl_sample_conditions.pH_units _pdbx_nmr_exptl_sample_conditions.pressure_err _pdbx_nmr_exptl_sample_conditions.temperature_err _pdbx_nmr_exptl_sample_conditions.temperature_units 1 298 bar 1 6.2 '25 mM potassium phosphate, 50 mM KCl' ? ? 'Not defined' d2o_natab ? pH ? ? K 2 298 bar 1 6.2 '25 mM potassium phosphate, 50 mM KCl' ? ? 'Not defined' d2o_13c15n ? pH ? ? K # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 '900 uM CDE2, 100% D2O' '100% D2O' d2o_nat_ab solution ;25 mM potassium phosphate buffer 50 mM KCl ; 2 '1300 uM [U-99% 13C; U-99% 15N] CDE2, 100% D2O' '100% D2O' d2o_13c15n solution ;25 mM potassium phosphate buffer 50 mM KCl ; # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 'AVANCE III' ? Bruker 600 ? 2 'AVANCE III' ? Bruker 800 ? 3 'AVANCE III' ? Bruker 900 ? 4 'AVANCE III' ? Bruker 950 ? 5 'AVANCE III' ? Bruker 700 ? # _pdbx_nmr_refine.entry_id 6XXA _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # _pdbx_nmr_ensemble.entry_id 6XXA _pdbx_nmr_ensemble.conformers_calculated_total_number 50 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 6XXA _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 'structure calculation' CNS 1.2 'Brunger A. T. et.al.' 2 'peak picking' Sparky 3.2 Goddard 3 'chemical shift assignment' Sparky 3.2 Goddard # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 6XXA _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 6XXA _struct.title ;Constitutive decay element CDE2 from human 3'UTR ; _struct.pdbx_descriptor ;RNA (5'-R(*GP*GP*UP*GP*CP*CP*UP*AP*AP*UP*AP*UP*UP*UP*AP*GP*GP*CP*AP*CP*C)-3') ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 6XXA _struct_keywords.text 'hairpin Roquin binding, RNA' _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 1 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 1 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 1 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 2 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 2 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 2 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 19 N1 ? ? A U 3 A A 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 3 O4 ? ? ? 1_555 A A 19 N6 ? ? A U 3 A A 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 18 N3 ? ? A G 4 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 18 O2 ? ? A G 4 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 18 N4 ? ? A G 4 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 5 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 5 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 5 A G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 16 N1 ? ? A C 6 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 16 O6 ? ? A C 6 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 16 N2 ? ? A C 6 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 15 N1 ? ? A U 7 A A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 15 N6 ? ? A U 7 A A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 14 N3 ? ? A A 8 A U 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 14 O4 ? ? A A 8 A U 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A A 9 N1 ? ? ? 1_555 A U 13 N3 ? ? A A 9 A U 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A A 9 N6 ? ? ? 1_555 A U 13 O4 ? ? A A 9 A U 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 6XXA _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G GUA A . n A 1 2 G 2 2 2 G GUA A . n A 1 3 U 3 3 3 U URI A . n A 1 4 G 4 4 4 G GUA A . n A 1 5 C 5 5 5 C CYT A . n A 1 6 C 6 6 6 C CYT A . n A 1 7 U 7 7 7 U URI A . n A 1 8 A 8 8 8 A ADE A . n A 1 9 A 9 9 9 A ADE A . n A 1 10 U 10 10 10 U URI A . n A 1 11 A 11 11 11 A ADE A . n A 1 12 U 12 12 12 U URI A . n A 1 13 U 13 13 13 U URI A . n A 1 14 U 14 14 14 U URI A . n A 1 15 A 15 15 15 A ADE A . n A 1 16 G 16 16 16 G GUA A . n A 1 17 G 17 17 17 G GUA A . n A 1 18 C 18 18 18 C CYT A . n A 1 19 A 19 19 19 A ADE A . n A 1 20 C 20 20 20 C CYT A . n A 1 21 C 21 21 21 C CYT A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 0 ? 1 MORE 0 ? 1 'SSA (A^2)' 4280 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2020-05-27 2 'Structure model' 1 1 2020-06-17 3 'Structure model' 1 2 2020-07-29 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' citation # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.pdbx_database_id_PubMed' 2 2 'Structure model' '_citation.title' 3 2 'Structure model' '_citation_author.identifier_ORCID' 4 2 'Structure model' '_citation_author.name' 5 3 'Structure model' '_citation.journal_volume' 6 3 'Structure model' '_citation.page_first' 7 3 'Structure model' '_citation.page_last' # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 CDE2 900 ? uM 'natural abundance' 2 CDE2 1300 ? uM '[U-99% 13C; U-99% 15N]' # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 8 "C3'" A C 20 ? ? "O3'" A C 20 ? ? P A C 21 ? ? 127.54 119.70 7.84 1.20 Y 2 9 "C3'" A C 20 ? ? "O3'" A C 20 ? ? P A C 21 ? ? 127.26 119.70 7.56 1.20 Y 3 10 "C3'" A C 20 ? ? "O3'" A C 20 ? ? P A C 21 ? ? 126.93 119.70 7.23 1.20 Y # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 7 U A 13 ? ? 0.058 'SIDE CHAIN' 2 8 C A 21 ? ? 0.085 'SIDE CHAIN' 3 9 G A 1 ? ? 0.060 'SIDE CHAIN' 4 9 C A 21 ? ? 0.071 'SIDE CHAIN' 5 10 G A 1 ? ? 0.051 'SIDE CHAIN' 6 10 C A 21 ? ? 0.073 'SIDE CHAIN' # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 6XXA 'double helix' 6XXA 'a-form double helix' 6XXA 'hairpin loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 21 1_555 -0.470 -0.224 -0.036 -0.088 -7.438 1.107 1 A_G1:C21_A A 1 ? A 21 ? 19 1 1 A G 2 1_555 A C 20 1_555 0.448 -0.084 -0.139 -2.119 -0.197 -3.654 2 A_G2:C20_A A 2 ? A 20 ? 19 1 1 A U 3 1_555 A A 19 1_555 -0.017 -0.097 0.078 9.316 -2.305 -8.291 3 A_U3:A19_A A 3 ? A 19 ? 20 1 1 A G 4 1_555 A C 18 1_555 0.057 -0.125 0.071 -3.276 -5.621 1.086 4 A_G4:C18_A A 4 ? A 18 ? 19 1 1 A C 5 1_555 A G 17 1_555 -0.040 -0.072 -0.016 4.174 -1.877 0.196 5 A_C5:G17_A A 5 ? A 17 ? 19 1 1 A C 6 1_555 A G 16 1_555 0.069 -0.101 -0.027 1.716 -0.058 -0.949 6 A_C6:G16_A A 6 ? A 16 ? 19 1 1 A U 7 1_555 A A 15 1_555 -0.026 -0.180 -0.060 -4.849 -6.428 -2.796 7 A_U7:A15_A A 7 ? A 15 ? 20 1 1 A A 8 1_555 A U 14 1_555 -0.056 -0.173 0.286 1.498 -8.630 5.684 8 A_A8:U14_A A 8 ? A 14 ? 20 1 1 A A 9 1_555 A U 13 1_555 0.528 -0.048 -0.289 -0.339 -1.720 7.616 9 A_A9:U13_A A 9 ? A 13 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 21 1_555 A G 2 1_555 A C 20 1_555 -0.382 -2.239 3.783 -3.849 12.705 15.671 -11.549 -0.521 1.590 38.745 11.737 20.511 1 AA_G1G2:C20C21_AA A 1 ? A 21 ? A 2 ? A 20 ? 1 A G 2 1_555 A C 20 1_555 A U 3 1_555 A A 19 1_555 -0.764 -1.571 3.589 -3.076 -11.167 29.344 -0.397 0.719 3.967 -21.039 5.795 31.501 2 AA_G2U3:A19C20_AA A 2 ? A 20 ? A 3 ? A 19 ? 1 A U 3 1_555 A A 19 1_555 A G 4 1_555 A C 18 1_555 0.870 -1.179 3.877 2.878 15.757 37.138 -3.720 -0.895 3.197 23.449 -4.283 40.333 3 AA_U3G4:C18A19_AA A 3 ? A 19 ? A 4 ? A 18 ? 1 A G 4 1_555 A C 18 1_555 A C 5 1_555 A G 17 1_555 -0.094 -1.007 3.565 0.867 -2.839 31.763 -1.262 0.345 3.635 -5.173 -1.580 31.898 4 AA_G4C5:G17C18_AA A 4 ? A 18 ? A 5 ? A 17 ? 1 A C 5 1_555 A G 17 1_555 A C 6 1_555 A G 16 1_555 0.381 -1.003 4.689 -0.290 -13.181 30.375 1.584 -0.743 4.706 -23.797 0.524 33.051 5 AA_C5C6:G16G17_AA A 5 ? A 17 ? A 6 ? A 16 ? 1 A C 6 1_555 A G 16 1_555 A U 7 1_555 A A 15 1_555 -0.076 -1.622 4.210 0.678 2.440 27.297 -4.185 0.373 4.049 5.156 -1.433 27.412 6 AA_C6U7:A15G16_AA A 6 ? A 16 ? A 7 ? A 15 ? 1 A U 7 1_555 A A 15 1_555 A A 8 1_555 A U 14 1_555 -0.008 -1.024 3.426 -0.781 -5.517 32.002 -0.793 -0.132 3.547 -9.913 1.403 32.471 7 AA_U7A8:U14A15_AA A 7 ? A 15 ? A 8 ? A 14 ? 1 A A 8 1_555 A U 14 1_555 A A 9 1_555 A U 13 1_555 0.613 -0.563 3.763 2.273 7.613 32.991 -2.358 -0.636 3.581 13.169 -3.932 33.908 8 AA_A8A9:U13U14_AA A 8 ? A 14 ? A 9 ? A 13 ? # _pdbx_audit_support.funding_organization 'German Research Foundation (DFG)' _pdbx_audit_support.country Germany _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? #