data_7CV3 # _entry.id 7CV3 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.370 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7CV3 pdb_00007cv3 10.2210/pdb7cv3/pdb WWPDB D_1300018300 ? ? BMRB 36374 ? ? # _pdbx_database_related.db_name BMRB _pdbx_database_related.details 'Quadruplex-duplex hybrid structure in the PIM1 gene, Form 1' _pdbx_database_related.db_id 36374 _pdbx_database_related.content_type unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.entry_id 7CV3 _pdbx_database_status.recvd_initial_deposition_date 2020-08-25 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs REL _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Winnerdy, F.R.' 1 0000-0002-5010-4719 'Tan, D.J.Y.' 2 0000-0002-8332-7257 'Lim, K.W.' 3 0000-0003-3066-1494 'Phan, A.T.' 4 0000-0002-4970-3861 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 48 _citation.language ? _citation.page_first 11162 _citation.page_last 11171 _citation.title 'Coexistence of two quadruplex-duplex hybrids in the PIM1 gene.' _citation.year 2020 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkaa752 _citation.pdbx_database_id_PubMed 32976598 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Tan, D.J.Y.' 1 ? primary 'Winnerdy, F.R.' 2 ? primary 'Lim, K.W.' 3 ? primary 'Phan, A.T.' 4 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'PIM1 promoter, Form 1' _entity.formula_weight 8506.419 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;(DG)(DC)(DG)(DG)(DG)(DA)(DG)(DG)(DG)(DC)(DG)(DC)(DG)(DC)(DC)(DA)(DG)(DC)(DG)(DG) (DG)(DG)(DT)(DC)(DG)(DG)(DG) ; _entity_poly.pdbx_seq_one_letter_code_can GCGGGAGGGCGCGCCAGCGGGGTCGGG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DC n 1 3 DG n 1 4 DG n 1 5 DG n 1 6 DA n 1 7 DG n 1 8 DG n 1 9 DG n 1 10 DC n 1 11 DG n 1 12 DC n 1 13 DG n 1 14 DC n 1 15 DC n 1 16 DA n 1 17 DG n 1 18 DC n 1 19 DG n 1 20 DG n 1 21 DG n 1 22 DG n 1 23 DT n 1 24 DC n 1 25 DG n 1 26 DG n 1 27 DG n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 27 _pdbx_entity_src_syn.organism_scientific 'Homo sapiens' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 9606 _pdbx_entity_src_syn.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7CV3 _struct_ref.pdbx_db_accession 7CV3 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7CV3 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 27 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7CV3 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 27 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 27 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 1H-1H NOESY' 1 isotropic 2 1 2 '2D 1H-1H NOESY' 1 isotropic 3 1 2 '2D 1H-1H TOCSY' 1 isotropic # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 7 _pdbx_nmr_exptl_sample_conditions.ionic_strength 100 _pdbx_nmr_exptl_sample_conditions.details ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_err ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_units mM _pdbx_nmr_exptl_sample_conditions.label condition1 _pdbx_nmr_exptl_sample_conditions.pH_err ? _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.pressure_err ? _pdbx_nmr_exptl_sample_conditions.temperature_err ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 '2 mM GC-PIM1, 70 mM KCl, 20 mM potassium phosphate, 50 uM DSS, 90% H2O/10% D2O' '90% H2O/10% D2O' sample_H2O solution ? 2 '2 mM GC-PIM1, 70 mM KCl, 20 mM potassium phosphate, 50 uM DSS, 100% D2O' '100% D2O' sample_D2O solution ? # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.model 'AVANCE II' _pdbx_nmr_spectrometer.type ? _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.field_strength 600 _pdbx_nmr_spectrometer.details ? # loop_ _pdbx_nmr_refine.entry_id _pdbx_nmr_refine.method _pdbx_nmr_refine.details _pdbx_nmr_refine.software_ordinal 7CV3 'DGSA-distance geometry simulated annealing' ? 6 7CV3 'molecular dynamics' ? 5 # _pdbx_nmr_ensemble.entry_id 7CV3 _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 7CV3 _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 collection TopSpin 2.1 'Bruker Biospin' 2 processing TopSpin 4.0 'Bruker Biospin' 3 'peak picking' NMRFAM-SPARKY ? 'Lee, Tonelli, Markley' 4 'chemical shift assignment' NMRFAM-SPARKY ? 'Lee, Tonelli, Markley' 5 'structure calculation' 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' 6 refinement 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7CV3 _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 7CV3 _struct.title 'Quadruplex-duplex hybrid structure in the PIM1 gene, Form 1' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7CV3 _struct_keywords.text 'G-quadruplex, duplex, PIM1, quadruplex-duplex hybrid, DNA' _struct_keywords.pdbx_keywords DNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 3 N7 ? ? ? 1_555 A DG 7 N2 ? ? A DG 3 A DG 7 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog2 hydrog ? ? A DG 3 O6 ? ? ? 1_555 A DG 7 N1 ? ? A DG 3 A DG 7 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog3 hydrog ? ? A DG 3 N1 ? ? ? 1_555 A DG 25 O6 ? ? A DG 3 A DG 25 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog4 hydrog ? ? A DG 3 N2 ? ? ? 1_555 A DG 25 N7 ? ? A DG 3 A DG 25 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog5 hydrog ? ? A DG 4 N1 ? ? ? 1_555 A DG 8 O6 ? ? A DG 4 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog6 hydrog ? ? A DG 4 N2 ? ? ? 1_555 A DG 8 N7 ? ? A DG 4 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A DG 4 N7 ? ? ? 1_555 A DG 26 N2 ? ? A DG 4 A DG 26 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A DG 4 O6 ? ? ? 1_555 A DG 26 N1 ? ? A DG 4 A DG 26 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A DG 5 N1 ? ? ? 1_555 A DG 9 O6 ? ? A DG 5 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog10 hydrog ? ? A DG 5 N2 ? ? ? 1_555 A DG 9 N7 ? ? A DG 5 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog11 hydrog ? ? A DG 5 N7 ? ? ? 1_555 A DG 27 N2 ? ? A DG 5 A DG 27 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog12 hydrog ? ? A DG 5 O6 ? ? ? 1_555 A DG 27 N1 ? ? A DG 5 A DG 27 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog13 hydrog ? ? A DG 7 N7 ? ? ? 1_555 A DG 22 N2 ? ? A DG 7 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog14 hydrog ? ? A DG 7 O6 ? ? ? 1_555 A DG 22 N1 ? ? A DG 7 A DG 22 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog15 hydrog ? ? A DG 8 N1 ? ? ? 1_555 A DG 21 O6 ? ? A DG 8 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog16 hydrog ? ? A DG 8 N2 ? ? ? 1_555 A DG 21 N7 ? ? A DG 8 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog17 hydrog ? ? A DG 9 N1 ? ? ? 1_555 A DG 20 O6 ? ? A DG 9 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog18 hydrog ? ? A DG 9 N2 ? ? ? 1_555 A DG 20 N7 ? ? A DG 9 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog19 hydrog ? ? A DC 10 N3 ? ? ? 1_555 A DG 19 N1 ? ? A DC 10 A DG 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DC 10 N4 ? ? ? 1_555 A DG 19 O6 ? ? A DC 10 A DG 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DC 10 O2 ? ? ? 1_555 A DG 19 N2 ? ? A DC 10 A DG 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DG 11 N1 ? ? ? 1_555 A DC 18 N3 ? ? A DG 11 A DC 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DG 11 N2 ? ? ? 1_555 A DC 18 O2 ? ? A DG 11 A DC 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DG 11 O6 ? ? ? 1_555 A DC 18 N4 ? ? A DG 11 A DC 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DC 12 N3 ? ? ? 1_555 A DG 17 N1 ? ? A DC 12 A DG 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DC 12 N4 ? ? ? 1_555 A DG 17 O6 ? ? A DC 12 A DG 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DC 12 O2 ? ? ? 1_555 A DG 17 N2 ? ? A DC 12 A DG 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DG 13 N7 ? ? ? 1_555 A DG 17 N2 ? ? A DG 13 A DG 17 1_555 ? ? ? ? ? ? 'DG-DG MISPAIR' ? ? ? hydrog29 hydrog ? ? A DG 20 N1 ? ? ? 1_555 A DG 27 O6 ? ? A DG 20 A DG 27 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog30 hydrog ? ? A DG 20 N2 ? ? ? 1_555 A DG 27 N7 ? ? A DG 20 A DG 27 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog31 hydrog ? ? A DG 21 N1 ? ? ? 1_555 A DG 26 O6 ? ? A DG 21 A DG 26 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog32 hydrog ? ? A DG 21 N2 ? ? ? 1_555 A DG 26 N7 ? ? A DG 21 A DG 26 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog33 hydrog ? ? A DG 22 N7 ? ? ? 1_555 A DG 25 N2 ? ? A DG 22 A DG 25 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog34 hydrog ? ? A DG 22 O6 ? ? ? 1_555 A DG 25 N1 ? ? A DG 22 A DG 25 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 7CV3 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DC 2 2 2 DC DC A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DG 4 4 4 DG DG A . n A 1 5 DG 5 5 5 DG DG A . n A 1 6 DA 6 6 6 DA DA A . n A 1 7 DG 7 7 7 DG DG A . n A 1 8 DG 8 8 8 DG DG A . n A 1 9 DG 9 9 9 DG DG A . n A 1 10 DC 10 10 10 DC DC A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DC 12 12 12 DC DC A . n A 1 13 DG 13 13 13 DG DG A . n A 1 14 DC 14 14 14 DC DC A . n A 1 15 DC 15 15 15 DC DC A . n A 1 16 DA 16 16 16 DA DA A . n A 1 17 DG 17 17 17 DG DG A . n A 1 18 DC 18 18 18 DC DC A . n A 1 19 DG 19 19 19 DG DG A . n A 1 20 DG 20 20 20 DG DG A . n A 1 21 DG 21 21 21 DG DG A . n A 1 22 DG 22 22 22 DG DG A . n A 1 23 DT 23 23 23 DT DT A . n A 1 24 DC 24 24 24 DC DC A . n A 1 25 DG 25 25 25 DG DG A . n A 1 26 DG 26 26 26 DG DG A . n A 1 27 DG 27 27 27 DG DG A . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2020-10-07 2 'Structure model' 1 1 2020-11-18 3 'Structure model' 1 2 2023-06-14 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' 3 3 'Structure model' Other # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 3 'Structure model' database_2 3 3 'Structure model' pdbx_database_status # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 3 'Structure model' '_database_2.pdbx_DOI' 5 3 'Structure model' '_database_2.pdbx_database_accession' 6 3 'Structure model' '_pdbx_database_status.status_code_nmr_data' # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 GC-PIM1 2 ? mM 'natural abundance' 1 KCl 70 ? mM 'natural abundance' 1 'potassium phosphate' 20 ? mM 'natural abundance' 1 DSS 50 ? uM 'natural abundance' 2 GC-PIM1 2 ? mM 'natural abundance' 2 KCl 70 ? mM 'natural abundance' 2 'potassium phosphate' 20 ? mM 'natural abundance' 2 DSS 50 ? uM 'natural abundance' # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "H4'" A DA 6 ? ? OP2 A DG 8 ? ? 1.52 2 4 "H4'" A DA 6 ? ? OP2 A DG 8 ? ? 1.57 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7CV3 'double helix' 7CV3 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 17 1_555 A DC 12 1_555 -0.780 -0.370 -0.464 -2.255 5.186 -1.509 1 A_DG17:DC12_A A 17 ? A 12 ? 19 1 1 A DC 18 1_555 A DG 11 1_555 0.693 -0.243 -0.326 2.608 -2.126 -4.367 2 A_DC18:DG11_A A 18 ? A 11 ? 19 1 1 A DG 19 1_555 A DC 10 1_555 -1.073 -0.262 -0.213 -0.654 -0.844 -3.126 3 A_DG19:DC10_A A 19 ? A 10 ? 19 1 1 A DG 20 1_555 A DG 9 1_555 -0.428 -3.821 0.338 -0.634 -5.007 90.169 4 A_DG20:DG9_A A 20 ? A 9 ? 6 3 1 A DG 21 1_555 A DG 26 1_555 0.601 3.843 0.438 -3.220 -7.186 -90.483 5 A_DG21:DG26_A A 21 ? A 26 ? 6 3 1 A DG 3 1_555 A DG 25 1_555 0.492 3.525 0.097 -2.802 -0.717 -99.027 6 A_DG3:DG25_A A 3 ? A 25 ? 6 3 1 A DG 7 1_555 A DG 22 1_555 -0.561 -3.781 0.493 -0.090 -6.599 97.111 7 A_DG7:DG22_A A 7 ? A 22 ? 6 3 1 A DG 8 1_555 A DG 4 1_555 -0.795 -3.889 0.121 -0.493 1.344 90.679 8 A_DG8:DG4_A A 8 ? A 4 ? 6 3 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 17 1_555 A DC 12 1_555 A DC 18 1_555 A DG 11 1_555 -0.334 -1.737 3.497 -2.076 -3.296 33.297 -2.418 0.204 3.661 -5.727 3.607 33.518 1 AA_DG17DC18:DG11DC12_AA A 17 ? A 12 ? A 18 ? A 11 ? 1 A DC 18 1_555 A DG 11 1_555 A DG 19 1_555 A DC 10 1_555 0.055 -1.971 3.319 1.306 1.230 23.808 -5.166 0.294 3.213 2.977 -3.161 23.874 2 AA_DC18DG19:DC10DG11_AA A 18 ? A 11 ? A 19 ? A 10 ? 1 A DG 19 1_555 A DC 10 1_555 A DG 20 1_555 A DG 9 1_555 -1.738 -4.147 1.143 -168.637 2.085 -139.711 2.073 -1.014 0.496 -1.047 -84.664 -176.097 3 AA_DG19DG20:DG9DC10_AA A 19 ? A 10 ? A 20 ? A 9 ? 1 A DG 20 1_555 A DG 9 1_555 A DG 21 1_555 A DG 26 1_555 -0.662 -1.337 -3.549 -2.160 0.458 61.483 -1.284 0.757 -3.535 0.448 2.112 61.519 4 AA_DG20DG21:DG26DG9_AA A 20 ? A 9 ? A 21 ? A 26 ? 1 A DG 21 1_555 A DG 26 1_555 A DG 3 1_555 A DG 25 1_555 0.111 3.817 -0.586 -170.810 49.722 110.700 1.931 0.023 0.064 24.913 85.584 178.806 5 AA_DG21DG3:DG25DG26_AA A 21 ? A 26 ? A 3 ? A 25 ? 1 A DG 7 1_555 A DG 22 1_555 A DG 8 1_555 A DG 4 1_555 -1.324 -3.574 0.441 170.813 -48.375 76.375 -1.756 0.774 0.037 -24.316 -85.860 178.060 6 AA_DG7DG8:DG4DG22_AA A 7 ? A 22 ? A 8 ? A 4 ? # _pdbx_audit_support.funding_organization 'National Research Foundation (NRF, Singapore)' _pdbx_audit_support.country Singapore _pdbx_audit_support.grant_number NRF-NRFI2017-09 _pdbx_audit_support.ordinal 1 # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? #