data_7D82 # _entry.id 7D82 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.336 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code PDB 7D82 WWPDB D_1300018917 # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7D82 _pdbx_database_status.recvd_initial_deposition_date 2020-10-06 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Chen, H.' 1 0000-0001-7436-5895 'Ren, A.M.' 2 0000-0002-5420-4899 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 48 _citation.language ? _citation.page_first 12394 _citation.page_last 12406 _citation.title 'Structural distinctions between NAD+ riboswitch domains 1 and 2 determine differential folding and ligand binding.' _citation.year 2020 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkaa1029 _citation.pdbx_database_id_PubMed 33170270 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Chen, H.' 1 ? primary 'Egger, M.' 2 ? primary 'Xu, X.' 3 ? primary 'Flemmich, L.' 4 ? primary 'Krasheninina, O.' 5 ? primary 'Sun, A.' 6 ? primary 'Micura, R.' 7 ? primary 'Ren, A.' 8 ? # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 7D82 _cell.details ? _cell.formula_units_Z ? _cell.length_a 75.916 _cell.length_a_esd ? _cell.length_b 75.916 _cell.length_b_esd ? _cell.length_c 50.289 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 6 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7D82 _symmetry.cell_setting ? _symmetry.Int_Tables_number 154 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 32 2 1' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man '832GAAA (50-MER)' 16103.608 1 ? 'C2G, A27G, G49C' ? ? 2 non-polymer syn 'MANGANESE (II) ION' 54.938 7 ? ? ? ? 3 non-polymer syn NICOTINAMIDE-ADENINE-DINUCLEOTIDE 663.425 1 ? ? ? ? 4 non-polymer syn 'MAGNESIUM ION' 24.305 7 ? ? ? ? 5 water nat water 18.015 36 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGUUUCAACAUCCCCGUUCGGCGCUCGAAAGAGGUGGCCGGACUGAAGCC _entity_poly.pdbx_seq_one_letter_code_can GGUUUCAACAUCCCCGUUCGGCGCUCGAAAGAGGUGGCCGGACUGAAGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 U n 1 4 U n 1 5 U n 1 6 C n 1 7 A n 1 8 A n 1 9 C n 1 10 A n 1 11 U n 1 12 C n 1 13 C n 1 14 C n 1 15 C n 1 16 G n 1 17 U n 1 18 U n 1 19 C n 1 20 G n 1 21 G n 1 22 C n 1 23 G n 1 24 C n 1 25 U n 1 26 C n 1 27 G n 1 28 A n 1 29 A n 1 30 A n 1 31 G n 1 32 A n 1 33 G n 1 34 G n 1 35 U n 1 36 G n 1 37 G n 1 38 C n 1 39 C n 1 40 G n 1 41 G n 1 42 A n 1 43 C n 1 44 U n 1 45 G n 1 46 A n 1 47 A n 1 48 G n 1 49 C n 1 50 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 50 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Acidobacteriaceae bacterium KBS 83' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 1267533 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7D82 _struct_ref.pdbx_db_accession 7D82 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7D82 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 50 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7D82 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 50 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 50 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 MN non-polymer . 'MANGANESE (II) ION' ? 'Mn 2' 54.938 NAD non-polymer . NICOTINAMIDE-ADENINE-DINUCLEOTIDE ? 'C21 H27 N7 O14 P2' 663.425 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7D82 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.60 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 52.65 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 289 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.2 M NaCl, 0.1 M CHES pH 9.5, 50% PEG400 ; _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS3 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2020-05-12 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.2398 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL19U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.2398 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL19U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 7D82 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.4890 _reflns.d_resolution_low 30.000 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 11307 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.500 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 19.200 _reflns.pdbx_Rmerge_I_obs 0.204 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 2.300 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 0.547 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.210 _reflns.pdbx_Rpim_I_all 0.047 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half ? _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_all _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split 2.500 2.540 ? ? ? ? ? ? 304 96.800 ? ? ? ? 1.869 ? ? ? ? ? ? ? ? 16.200 ? 0.437 ? ? 1.930 0.474 ? 1 1 0.773 ? ? 2.540 2.590 ? ? ? ? ? ? 282 100.000 ? ? ? ? 2.065 ? ? ? ? ? ? ? ? 19.800 ? 0.397 ? ? 2.120 0.473 ? 2 1 0.694 ? ? 2.590 2.640 ? ? ? ? ? ? 308 100.000 ? ? ? ? 1.435 ? ? ? ? ? ? ? ? 20.400 ? 0.412 ? ? 1.471 0.324 ? 3 1 0.852 ? ? 2.640 2.690 ? ? ? ? ? ? 306 100.000 ? ? ? ? 1.378 ? ? ? ? ? ? ? ? 20.100 ? 0.411 ? ? 1.414 0.313 ? 4 1 0.902 ? ? 2.690 2.750 ? ? ? ? ? ? 285 100.000 ? ? ? ? 1.372 ? ? ? ? ? ? ? ? 20.200 ? 0.413 ? ? 1.408 0.312 ? 5 1 0.855 ? ? 2.750 2.820 ? ? ? ? ? ? 307 100.000 ? ? ? ? 1.145 ? ? ? ? ? ? ? ? 20.100 ? 0.411 ? ? 1.175 0.261 ? 6 1 0.903 ? ? 2.820 2.890 ? ? ? ? ? ? 292 100.000 ? ? ? ? 0.871 ? ? ? ? ? ? ? ? 20.000 ? 0.448 ? ? 0.894 0.199 ? 7 1 0.944 ? ? 2.890 2.960 ? ? ? ? ? ? 305 100.000 ? ? ? ? 0.633 ? ? ? ? ? ? ? ? 19.900 ? 0.449 ? ? 0.650 0.145 ? 8 1 0.957 ? ? 2.960 3.050 ? ? ? ? ? ? 304 100.000 ? ? ? ? 0.497 ? ? ? ? ? ? ? ? 19.800 ? 0.496 ? ? 0.510 0.114 ? 9 1 0.967 ? ? 3.050 3.150 ? ? ? ? ? ? 305 100.000 ? ? ? ? 0.386 ? ? ? ? ? ? ? ? 19.600 ? 0.536 ? ? 0.397 0.088 ? 10 1 0.977 ? ? 3.150 3.260 ? ? ? ? ? ? 292 100.000 ? ? ? ? 0.344 ? ? ? ? ? ? ? ? 19.200 ? 0.569 ? ? 0.353 0.080 ? 11 1 0.982 ? ? 3.260 3.390 ? ? ? ? ? ? 310 100.000 ? ? ? ? 0.287 ? ? ? ? ? ? ? ? 18.300 ? 0.567 ? ? 0.295 0.068 ? 12 1 0.985 ? ? 3.390 3.550 ? ? ? ? ? ? 286 97.900 ? ? ? ? 0.266 ? ? ? ? ? ? ? ? 16.100 ? 0.616 ? ? 0.275 0.068 ? 13 1 0.979 ? ? 3.550 3.730 ? ? ? ? ? ? 296 96.700 ? ? ? ? 0.203 ? ? ? ? ? ? ? ? 18.500 ? 0.653 ? ? 0.209 0.048 ? 14 1 0.993 ? ? 3.730 3.970 ? ? ? ? ? ? 316 100.000 ? ? ? ? 0.173 ? ? ? ? ? ? ? ? 20.300 ? 0.687 ? ? 0.177 0.039 ? 15 1 0.995 ? ? 3.970 4.270 ? ? ? ? ? ? 294 100.000 ? ? ? ? 0.144 ? ? ? ? ? ? ? ? 20.200 ? 0.652 ? ? 0.147 0.033 ? 16 1 0.995 ? ? 4.270 4.700 ? ? ? ? ? ? 318 100.000 ? ? ? ? 0.123 ? ? ? ? ? ? ? ? 20.000 ? 0.699 ? ? 0.126 0.028 ? 17 1 0.997 ? ? 4.700 5.380 ? ? ? ? ? ? 311 100.000 ? ? ? ? 0.094 ? ? ? ? ? ? ? ? 19.100 ? 0.658 ? ? 0.096 0.022 ? 18 1 0.999 ? ? 5.380 6.760 ? ? ? ? ? ? 310 98.400 ? ? ? ? 0.082 ? ? ? ? ? ? ? ? 17.100 ? 0.562 ? ? 0.085 0.020 ? 19 1 0.998 ? ? 6.760 30.000 ? ? ? ? ? ? 344 99.700 ? ? ? ? 0.082 ? ? ? ? ? ? ? ? 18.600 ? 0.839 ? ? 0.084 0.019 ? 20 1 0.998 ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max 116.680 _refine.B_iso_mean 59.5885 _refine.B_iso_min 30.800 _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7D82 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.4890 _refine.ls_d_res_low 27.5160 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 11307 _refine.ls_number_reflns_R_free 550 _refine.ls_number_reflns_R_work 10757 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.2700 _refine.ls_percent_reflns_R_free 4.8600 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2238 _refine.ls_R_factor_R_free 0.2713 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2213 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.360 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 7D7V _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 30.2500 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.3600 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id final _refine_hist.details ? _refine_hist.d_res_high 2.4890 _refine_hist.d_res_low 27.5160 _refine_hist.number_atoms_solvent 36 _refine_hist.number_atoms_total 1162 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total 50 _refine_hist.pdbx_B_iso_mean_ligand 59.97 _refine_hist.pdbx_B_iso_mean_solvent 50.43 _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1068 _refine_hist.pdbx_number_atoms_ligand 58 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 2.4890 2.7390 . . 140 2670 98.0000 . . . 0.3397 0.0000 0.2997 . . . . . . . . . . . 'X-RAY DIFFRACTION' 2.7390 3.1349 . . 139 2721 100.0000 . . . 0.3220 0.0000 0.2404 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.1349 3.9478 . . 120 2689 99.0000 . . . 0.2536 0.0000 0.1978 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.9478 27.5160 . . 151 2677 100.0000 . . . 0.2554 0.0000 0.2153 . . . . . . . . . . . # _struct.entry_id 7D82 _struct.title 'Crystal Structure of the Domain2 of NAD+ Riboswitch with nicotinamide adenine dinucleotide (NAD+), soaked in Mn2+' _struct.pdbx_descriptor '832GAAA (50-MER)' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7D82 _struct_keywords.text 'riboswitch, RNA structure, RNA folding, RNA-ligand interactions, RNA crystallography, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 2 ? E N N 2 ? F N N 2 ? G N N 2 ? H N N 2 ? I N N 3 ? J N N 4 ? K N N 4 ? L N N 4 ? M N N 4 ? N N N 4 ? O N N 4 ? P N N 4 ? Q N N 5 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A A 7 OP2 ? ? ? 1_555 D MN . MN ? ? A A 7 A MN 103 1_555 ? ? ? ? ? ? ? 2.149 ? ? metalc2 metalc ? ? A A 8 OP1 ? ? ? 1_555 B MN . MN ? ? A A 8 A MN 101 1_555 ? ? ? ? ? ? ? 2.103 ? ? metalc3 metalc ? ? A A 8 OP2 ? ? ? 1_555 C MN . MN ? ? A A 8 A MN 102 1_555 ? ? ? ? ? ? ? 2.128 ? ? metalc4 metalc ? ? A C 9 OP2 ? ? ? 1_555 C MN . MN ? ? A C 9 A MN 102 1_555 ? ? ? ? ? ? ? 1.973 ? ? metalc5 metalc ? ? A A 10 N7 ? ? ? 1_555 C MN . MN ? ? A A 10 A MN 102 1_555 ? ? ? ? ? ? ? 2.298 ? ? metalc6 metalc ? ? A G 27 O6 ? ? ? 1_555 H MN . MN ? ? A G 27 A MN 107 1_555 ? ? ? ? ? ? ? 2.009 ? ? metalc7 metalc ? ? A A 28 OP2 ? ? ? 1_555 M MG . MG ? ? A A 28 A MG 112 1_555 ? ? ? ? ? ? ? 2.279 ? ? metalc8 metalc ? ? A G 34 O6 ? ? ? 1_555 L MG . MG ? ? A G 34 A MG 111 1_555 ? ? ? ? ? ? ? 2.109 ? ? metalc9 metalc ? ? A G 36 OP2 ? ? ? 1_555 F MN . MN ? ? A G 36 A MN 105 1_555 ? ? ? ? ? ? ? 2.105 ? ? metalc10 metalc ? ? A G 37 N7 ? ? ? 1_555 F MN . MN ? ? A G 37 A MN 105 1_555 ? ? ? ? ? ? ? 2.244 ? ? metalc11 metalc ? ? A G 40 O6 ? ? ? 1_555 G MN . MN ? ? A G 40 A MN 106 1_555 ? ? ? ? ? ? ? 2.537 ? ? metalc12 metalc ? ? A A 46 OP1 ? ? ? 1_555 H MN . MN ? ? A A 46 A MN 107 2_545 ? ? ? ? ? ? ? 2.525 ? ? metalc13 metalc ? ? A A 47 OP1 ? ? ? 1_555 M MG . MG ? ? A A 47 A MG 112 2_545 ? ? ? ? ? ? ? 2.076 ? ? metalc14 metalc ? ? B MN . MN ? ? ? 1_555 I NAD . O1A ? ? A MN 101 A NAD 108 1_555 ? ? ? ? ? ? ? 2.110 ? ? metalc15 metalc ? ? B MN . MN ? ? ? 1_555 I NAD . O1N ? ? A MN 101 A NAD 108 1_555 ? ? ? ? ? ? ? 2.021 ? ? metalc16 metalc ? ? B MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 101 A HOH 206 1_555 ? ? ? ? ? ? ? 2.078 ? ? metalc17 metalc ? ? B MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 101 A HOH 211 1_555 ? ? ? ? ? ? ? 2.198 ? ? metalc18 metalc ? ? B MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 101 A HOH 232 1_555 ? ? ? ? ? ? ? 2.681 ? ? metalc19 metalc ? ? C MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 102 A HOH 217 1_555 ? ? ? ? ? ? ? 2.016 ? ? metalc20 metalc ? ? C MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 102 A HOH 222 1_555 ? ? ? ? ? ? ? 2.224 ? ? metalc21 metalc ? ? C MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 102 A HOH 225 1_555 ? ? ? ? ? ? ? 2.185 ? ? metalc22 metalc ? ? D MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 103 A HOH 201 1_555 ? ? ? ? ? ? ? 2.211 ? ? metalc23 metalc ? ? D MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 103 A HOH 210 1_555 ? ? ? ? ? ? ? 2.271 ? ? metalc24 metalc ? ? D MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 103 A HOH 215 1_555 ? ? ? ? ? ? ? 2.420 ? ? metalc25 metalc ? ? D MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 103 A HOH 219 1_555 ? ? ? ? ? ? ? 2.339 ? ? metalc26 metalc ? ? E MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 104 A HOH 208 1_555 ? ? ? ? ? ? ? 2.176 ? ? metalc27 metalc ? ? E MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 104 A HOH 212 1_555 ? ? ? ? ? ? ? 2.771 ? ? metalc28 metalc ? ? E MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 104 A HOH 213 1_555 ? ? ? ? ? ? ? 2.741 ? ? metalc29 metalc ? ? E MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 104 A HOH 214 1_555 ? ? ? ? ? ? ? 2.044 ? ? metalc30 metalc ? ? E MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 104 A HOH 230 1_555 ? ? ? ? ? ? ? 2.244 ? ? metalc31 metalc ? ? F MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 105 A HOH 216 1_555 ? ? ? ? ? ? ? 2.383 ? ? metalc32 metalc ? ? F MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 105 A HOH 221 1_555 ? ? ? ? ? ? ? 2.403 ? ? metalc33 metalc ? ? G MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 106 A HOH 204 1_555 ? ? ? ? ? ? ? 2.259 ? ? metalc34 metalc ? ? G MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 106 A HOH 205 1_555 ? ? ? ? ? ? ? 2.056 ? ? metalc35 metalc ? ? G MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 106 A HOH 209 1_555 ? ? ? ? ? ? ? 2.383 ? ? metalc36 metalc ? ? H MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 107 A HOH 202 1_555 ? ? ? ? ? ? ? 2.393 ? ? metalc37 metalc ? ? H MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 107 A HOH 203 1_555 ? ? ? ? ? ? ? 2.261 ? ? metalc38 metalc ? ? H MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 107 A HOH 207 1_555 ? ? ? ? ? ? ? 2.435 ? ? metalc39 metalc ? ? H MN . MN ? ? ? 1_555 Q HOH . O ? ? A MN 107 A HOH 218 3_654 ? ? ? ? ? ? ? 2.393 ? ? metalc40 metalc ? ? J MG . MG ? ? ? 1_555 Q HOH . O ? ? A MG 109 A HOH 220 1_555 ? ? ? ? ? ? ? 2.078 ? ? metalc41 metalc ? ? J MG . MG ? ? ? 1_555 Q HOH . O ? ? A MG 109 A HOH 228 1_555 ? ? ? ? ? ? ? 2.785 ? ? metalc42 metalc ? ? J MG . MG ? ? ? 1_555 Q HOH . O ? ? A MG 109 A HOH 228 5_554 ? ? ? ? ? ? ? 2.697 ? ? metalc43 metalc ? ? J MG . MG ? ? ? 1_555 Q HOH . O ? ? A MG 109 A HOH 229 1_555 ? ? ? ? ? ? ? 1.813 ? ? metalc44 metalc ? ? J MG . MG ? ? ? 1_555 Q HOH . O ? ? A MG 109 A HOH 229 5_554 ? ? ? ? ? ? ? 2.570 ? ? metalc45 metalc ? ? J MG . MG ? ? ? 1_555 Q HOH . O ? ? A MG 109 A HOH 231 1_555 ? ? ? ? ? ? ? 2.310 ? ? metalc46 metalc ? ? J MG . MG ? ? ? 1_555 Q HOH . O ? ? A MG 109 A HOH 231 5_554 ? ? ? ? ? ? ? 2.001 ? ? metalc47 metalc ? ? K MG . MG ? ? ? 1_555 Q HOH . O ? ? A MG 110 A HOH 236 1_555 ? ? ? ? ? ? ? 2.505 ? ? hydrog1 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 50 N4 ? ? A G 1 A C 50 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog2 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 49 N3 ? ? A G 2 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 49 O2 ? ? A G 2 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 49 N4 ? ? A G 2 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A U 3 N3 ? ? ? 1_555 A G 48 O6 ? ? A U 3 A G 48 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog6 hydrog ? ? A U 3 O2 ? ? ? 1_555 A G 48 N1 ? ? A U 3 A G 48 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog7 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 47 N1 ? ? A U 4 A A 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 47 N6 ? ? A U 4 A A 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 46 N1 ? ? A U 5 A A 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 46 N6 ? ? A U 5 A A 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 45 N1 ? ? A C 6 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 45 O6 ? ? A C 6 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 45 N2 ? ? A C 6 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A A 7 N1 ? ? ? 1_555 A U 44 N3 ? ? A A 7 A U 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 7 N6 ? ? ? 1_555 A U 44 O4 ? ? A A 7 A U 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 16 N1 ? ? ? 1_555 A C 43 N3 ? ? A G 16 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 16 N2 ? ? ? 1_555 A C 43 O2 ? ? A G 16 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 16 O6 ? ? ? 1_555 A C 43 N4 ? ? A G 16 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 17 N3 ? ? ? 1_555 A A 42 N1 ? ? A U 17 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A U 17 O4 ? ? ? 1_555 A A 42 N6 ? ? A U 17 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A U 18 N3 ? ? ? 1_555 A G 41 O6 ? ? A U 18 A G 41 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog22 hydrog ? ? A U 18 O2 ? ? ? 1_555 A G 41 N1 ? ? A U 18 A G 41 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog23 hydrog ? ? A C 19 N3 ? ? ? 1_555 A G 40 N1 ? ? A C 19 A G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 19 N4 ? ? ? 1_555 A G 40 O6 ? ? A C 19 A G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 19 O2 ? ? ? 1_555 A G 40 N2 ? ? A C 19 A G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 20 N1 ? ? ? 1_555 A C 39 N3 ? ? A G 20 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 20 N2 ? ? ? 1_555 A C 39 O2 ? ? A G 20 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 20 O6 ? ? ? 1_555 A C 39 N4 ? ? A G 20 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 21 N1 ? ? ? 1_555 A C 38 N3 ? ? A G 21 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 21 N2 ? ? ? 1_555 A C 38 O2 ? ? A G 21 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 21 O6 ? ? ? 1_555 A C 38 N4 ? ? A G 21 A C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 22 N3 ? ? ? 1_555 A G 37 N1 ? ? A C 22 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 22 N4 ? ? ? 1_555 A G 37 O6 ? ? A C 22 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 22 O2 ? ? ? 1_555 A G 37 N2 ? ? A C 22 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 23 O6 ? ? ? 1_555 A G 34 N2 ? ? A G 23 A G 34 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog36 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 33 N1 ? ? A C 24 A G 33 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog37 hydrog ? ? A C 24 N3 ? ? ? 1_555 A G 34 N2 ? ? A C 24 A G 34 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog38 hydrog ? ? A U 25 N3 ? ? ? 1_555 A A 32 N1 ? ? A U 25 A A 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 25 O4 ? ? ? 1_555 A A 32 N6 ? ? A U 25 A A 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 26 N3 ? ? ? 1_555 A G 31 N1 ? ? A C 26 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 26 N4 ? ? ? 1_555 A G 31 O6 ? ? A C 26 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 26 O2 ? ? ? 1_555 A G 31 N2 ? ? A C 26 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 27 N2 ? ? ? 1_555 A A 30 N7 ? ? A G 27 A A 30 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # _atom_sites.entry_id 7D82 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.013172 _atom_sites.fract_transf_matrix[1][2] 0.007605 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.015210 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.019885 _atom_sites.fract_transf_vector[1] 0.000000 _atom_sites.fract_transf_vector[2] 0.000000 _atom_sites.fract_transf_vector[3] 0.000000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG MN N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 U 3 3 3 U U A . n A 1 4 U 4 4 4 U U A . n A 1 5 U 5 5 5 U U A . n A 1 6 C 6 6 6 C C A . n A 1 7 A 7 7 7 A A A . n A 1 8 A 8 8 8 A A A . n A 1 9 C 9 9 9 C C A . n A 1 10 A 10 10 10 A A A . n A 1 11 U 11 11 11 U U A . n A 1 12 C 12 12 12 C C A . n A 1 13 C 13 13 13 C C A . n A 1 14 C 14 14 14 C C A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 U 17 17 17 U U A . n A 1 18 U 18 18 18 U U A . n A 1 19 C 19 19 19 C C A . n A 1 20 G 20 20 20 G G A . n A 1 21 G 21 21 21 G G A . n A 1 22 C 22 22 22 C C A . n A 1 23 G 23 23 23 G G A . n A 1 24 C 24 24 24 C C A . n A 1 25 U 25 25 25 U U A . n A 1 26 C 26 26 26 C C A . n A 1 27 G 27 27 27 G G A . n A 1 28 A 28 28 28 A A A . n A 1 29 A 29 29 29 A A A . n A 1 30 A 30 30 30 A A A . n A 1 31 G 31 31 31 G G A . n A 1 32 A 32 32 32 A A A . n A 1 33 G 33 33 33 G G A . n A 1 34 G 34 34 34 G G A . n A 1 35 U 35 35 35 U U A . n A 1 36 G 36 36 36 G G A . n A 1 37 G 37 37 37 G G A . n A 1 38 C 38 38 38 C C A . n A 1 39 C 39 39 39 C C A . n A 1 40 G 40 40 40 G G A . n A 1 41 G 41 41 41 G G A . n A 1 42 A 42 42 42 A A A . n A 1 43 C 43 43 43 C C A . n A 1 44 U 44 44 44 U U A . n A 1 45 G 45 45 45 G G A . n A 1 46 A 46 46 46 A A A . n A 1 47 A 47 47 47 A A A . n A 1 48 G 48 48 48 G G A . n A 1 49 C 49 49 49 C C A . n A 1 50 C 50 50 50 C C A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 MN 1 101 1 MN MN A . C 2 MN 1 102 2 MN MN A . D 2 MN 1 103 3 MN MN A . E 2 MN 1 104 4 MN MN A . F 2 MN 1 105 5 MN MN A . G 2 MN 1 106 6 MN MN A . H 2 MN 1 107 7 MN MN A . I 3 NAD 1 108 1 NAD NAD A . J 4 MG 1 109 1 MG MG A . K 4 MG 1 110 2 MG MG A . L 4 MG 1 111 3 MG MG A . M 4 MG 1 112 4 MG MG A . N 4 MG 1 113 5 MG MG A . O 4 MG 1 114 6 MG MG A . P 4 MG 1 115 7 MG MG A . Q 5 HOH 1 201 6 HOH HOH A . Q 5 HOH 2 202 37 HOH HOH A . Q 5 HOH 3 203 36 HOH HOH A . Q 5 HOH 4 204 22 HOH HOH A . Q 5 HOH 5 205 21 HOH HOH A . Q 5 HOH 6 206 2 HOH HOH A . Q 5 HOH 7 207 34 HOH HOH A . Q 5 HOH 8 208 12 HOH HOH A . Q 5 HOH 9 209 20 HOH HOH A . Q 5 HOH 10 210 9 HOH HOH A . Q 5 HOH 11 211 7 HOH HOH A . Q 5 HOH 12 212 17 HOH HOH A . Q 5 HOH 13 213 16 HOH HOH A . Q 5 HOH 14 214 14 HOH HOH A . Q 5 HOH 15 215 10 HOH HOH A . Q 5 HOH 16 216 19 HOH HOH A . Q 5 HOH 17 217 4 HOH HOH A . Q 5 HOH 18 218 35 HOH HOH A . Q 5 HOH 19 219 11 HOH HOH A . Q 5 HOH 20 220 26 HOH HOH A . Q 5 HOH 21 221 18 HOH HOH A . Q 5 HOH 22 222 3 HOH HOH A . Q 5 HOH 23 223 38 HOH HOH A . Q 5 HOH 24 224 8 HOH HOH A . Q 5 HOH 25 225 5 HOH HOH A . Q 5 HOH 26 226 15 HOH HOH A . Q 5 HOH 27 227 24 HOH HOH A . Q 5 HOH 28 228 27 HOH HOH A . Q 5 HOH 29 229 25 HOH HOH A . Q 5 HOH 30 230 13 HOH HOH A . Q 5 HOH 31 231 28 HOH HOH A . Q 5 HOH 32 232 1 HOH HOH A . Q 5 HOH 33 233 31 HOH HOH A . Q 5 HOH 34 234 23 HOH HOH A . Q 5 HOH 35 235 39 HOH HOH A . Q 5 HOH 36 236 30 HOH HOH A . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J,K,L,M,N,O,P,Q # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 90 ? 1 MORE -6 ? 1 'SSA (A^2)' 8650 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 OP2 ? A A 7 ? A A 7 ? 1_555 MN ? D MN . ? A MN 103 ? 1_555 O ? Q HOH . ? A HOH 201 ? 1_555 104.8 ? 2 OP2 ? A A 7 ? A A 7 ? 1_555 MN ? D MN . ? A MN 103 ? 1_555 O ? Q HOH . ? A HOH 210 ? 1_555 159.6 ? 3 O ? Q HOH . ? A HOH 201 ? 1_555 MN ? D MN . ? A MN 103 ? 1_555 O ? Q HOH . ? A HOH 210 ? 1_555 94.9 ? 4 OP2 ? A A 7 ? A A 7 ? 1_555 MN ? D MN . ? A MN 103 ? 1_555 O ? Q HOH . ? A HOH 215 ? 1_555 86.3 ? 5 O ? Q HOH . ? A HOH 201 ? 1_555 MN ? D MN . ? A MN 103 ? 1_555 O ? Q HOH . ? A HOH 215 ? 1_555 80.4 ? 6 O ? Q HOH . ? A HOH 210 ? 1_555 MN ? D MN . ? A MN 103 ? 1_555 O ? Q HOH . ? A HOH 215 ? 1_555 102.6 ? 7 OP2 ? A A 7 ? A A 7 ? 1_555 MN ? D MN . ? A MN 103 ? 1_555 O ? Q HOH . ? A HOH 219 ? 1_555 75.4 ? 8 O ? Q HOH . ? A HOH 201 ? 1_555 MN ? D MN . ? A MN 103 ? 1_555 O ? Q HOH . ? A HOH 219 ? 1_555 102.7 ? 9 O ? Q HOH . ? A HOH 210 ? 1_555 MN ? D MN . ? A MN 103 ? 1_555 O ? Q HOH . ? A HOH 219 ? 1_555 95.2 ? 10 O ? Q HOH . ? A HOH 215 ? 1_555 MN ? D MN . ? A MN 103 ? 1_555 O ? Q HOH . ? A HOH 219 ? 1_555 161.6 ? 11 OP1 ? A A 8 ? A A 8 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O1A ? I NAD . ? A NAD 108 ? 1_555 93.4 ? 12 OP1 ? A A 8 ? A A 8 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O1N ? I NAD . ? A NAD 108 ? 1_555 100.0 ? 13 O1A ? I NAD . ? A NAD 108 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O1N ? I NAD . ? A NAD 108 ? 1_555 78.9 ? 14 OP1 ? A A 8 ? A A 8 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O ? Q HOH . ? A HOH 206 ? 1_555 87.5 ? 15 O1A ? I NAD . ? A NAD 108 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O ? Q HOH . ? A HOH 206 ? 1_555 176.2 ? 16 O1N ? I NAD . ? A NAD 108 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O ? Q HOH . ? A HOH 206 ? 1_555 97.4 ? 17 OP1 ? A A 8 ? A A 8 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O ? Q HOH . ? A HOH 211 ? 1_555 87.1 ? 18 O1A ? I NAD . ? A NAD 108 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O ? Q HOH . ? A HOH 211 ? 1_555 81.8 ? 19 O1N ? I NAD . ? A NAD 108 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O ? Q HOH . ? A HOH 211 ? 1_555 159.7 ? 20 O ? Q HOH . ? A HOH 206 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O ? Q HOH . ? A HOH 211 ? 1_555 101.9 ? 21 OP1 ? A A 8 ? A A 8 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O ? Q HOH . ? A HOH 232 ? 1_555 164.4 ? 22 O1A ? I NAD . ? A NAD 108 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O ? Q HOH . ? A HOH 232 ? 1_555 93.4 ? 23 O1N ? I NAD . ? A NAD 108 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O ? Q HOH . ? A HOH 232 ? 1_555 95.1 ? 24 O ? Q HOH . ? A HOH 206 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O ? Q HOH . ? A HOH 232 ? 1_555 86.7 ? 25 O ? Q HOH . ? A HOH 211 ? 1_555 MN ? B MN . ? A MN 101 ? 1_555 O ? Q HOH . ? A HOH 232 ? 1_555 79.9 ? 26 OP2 ? A A 8 ? A A 8 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 OP2 ? A C 9 ? A C 9 ? 1_555 86.8 ? 27 OP2 ? A A 8 ? A A 8 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 N7 ? A A 10 ? A A 10 ? 1_555 85.5 ? 28 OP2 ? A C 9 ? A C 9 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 N7 ? A A 10 ? A A 10 ? 1_555 89.3 ? 29 OP2 ? A A 8 ? A A 8 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 O ? Q HOH . ? A HOH 217 ? 1_555 163.3 ? 30 OP2 ? A C 9 ? A C 9 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 O ? Q HOH . ? A HOH 217 ? 1_555 89.5 ? 31 N7 ? A A 10 ? A A 10 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 O ? Q HOH . ? A HOH 217 ? 1_555 78.2 ? 32 OP2 ? A A 8 ? A A 8 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 O ? Q HOH . ? A HOH 222 ? 1_555 91.7 ? 33 OP2 ? A C 9 ? A C 9 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 O ? Q HOH . ? A HOH 222 ? 1_555 166.7 ? 34 N7 ? A A 10 ? A A 10 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 O ? Q HOH . ? A HOH 222 ? 1_555 77.4 ? 35 O ? Q HOH . ? A HOH 217 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 O ? Q HOH . ? A HOH 222 ? 1_555 88.1 ? 36 OP2 ? A A 8 ? A A 8 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 O ? Q HOH . ? A HOH 225 ? 1_555 90.1 ? 37 OP2 ? A C 9 ? A C 9 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 O ? Q HOH . ? A HOH 225 ? 1_555 101.3 ? 38 N7 ? A A 10 ? A A 10 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 O ? Q HOH . ? A HOH 225 ? 1_555 168.2 ? 39 O ? Q HOH . ? A HOH 217 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 O ? Q HOH . ? A HOH 225 ? 1_555 106.6 ? 40 O ? Q HOH . ? A HOH 222 ? 1_555 MN ? C MN . ? A MN 102 ? 1_555 O ? Q HOH . ? A HOH 225 ? 1_555 91.8 ? 41 O6 ? A G 27 ? A G 27 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 OP1 ? A A 46 ? A A 46 ? 1_555 28.3 ? 42 O6 ? A G 27 ? A G 27 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 O ? Q HOH . ? A HOH 202 ? 1_555 123.7 ? 43 OP1 ? A A 46 ? A A 46 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 O ? Q HOH . ? A HOH 202 ? 1_555 106.4 ? 44 O6 ? A G 27 ? A G 27 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 O ? Q HOH . ? A HOH 203 ? 1_555 66.0 ? 45 OP1 ? A A 46 ? A A 46 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 O ? Q HOH . ? A HOH 203 ? 1_555 41.7 ? 46 O ? Q HOH . ? A HOH 202 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 O ? Q HOH . ? A HOH 203 ? 1_555 65.4 ? 47 O6 ? A G 27 ? A G 27 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 O ? Q HOH . ? A HOH 207 ? 1_555 66.6 ? 48 OP1 ? A A 46 ? A A 46 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 O ? Q HOH . ? A HOH 207 ? 1_555 80.3 ? 49 O ? Q HOH . ? A HOH 202 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 O ? Q HOH . ? A HOH 207 ? 1_555 168.1 ? 50 O ? Q HOH . ? A HOH 203 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 O ? Q HOH . ? A HOH 207 ? 1_555 119.2 ? 51 O6 ? A G 27 ? A G 27 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 O ? Q HOH . ? A HOH 218 ? 3_654 117.7 ? 52 OP1 ? A A 46 ? A A 46 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 O ? Q HOH . ? A HOH 218 ? 3_654 145.4 ? 53 O ? Q HOH . ? A HOH 202 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 O ? Q HOH . ? A HOH 218 ? 3_654 103.3 ? 54 O ? Q HOH . ? A HOH 203 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 O ? Q HOH . ? A HOH 218 ? 3_654 165.0 ? 55 O ? Q HOH . ? A HOH 207 ? 1_555 MN ? H MN . ? A MN 107 ? 1_555 O ? Q HOH . ? A HOH 218 ? 3_654 74.0 ? 56 OP2 ? A A 28 ? A A 28 ? 1_555 MG ? M MG . ? A MG 112 ? 1_555 OP1 ? A A 47 ? A A 47 ? 1_555 69.7 ? 57 OP2 ? A G 36 ? A G 36 ? 1_555 MN ? F MN . ? A MN 105 ? 1_555 N7 ? A G 37 ? A G 37 ? 1_555 110.4 ? 58 OP2 ? A G 36 ? A G 36 ? 1_555 MN ? F MN . ? A MN 105 ? 1_555 O ? Q HOH . ? A HOH 216 ? 1_555 98.2 ? 59 N7 ? A G 37 ? A G 37 ? 1_555 MN ? F MN . ? A MN 105 ? 1_555 O ? Q HOH . ? A HOH 216 ? 1_555 106.7 ? 60 OP2 ? A G 36 ? A G 36 ? 1_555 MN ? F MN . ? A MN 105 ? 1_555 O ? Q HOH . ? A HOH 221 ? 1_555 120.3 ? 61 N7 ? A G 37 ? A G 37 ? 1_555 MN ? F MN . ? A MN 105 ? 1_555 O ? Q HOH . ? A HOH 221 ? 1_555 105.8 ? 62 O ? Q HOH . ? A HOH 216 ? 1_555 MN ? F MN . ? A MN 105 ? 1_555 O ? Q HOH . ? A HOH 221 ? 1_555 114.8 ? 63 O6 ? A G 40 ? A G 40 ? 1_555 MN ? G MN . ? A MN 106 ? 1_555 O ? Q HOH . ? A HOH 204 ? 1_555 88.9 ? 64 O6 ? A G 40 ? A G 40 ? 1_555 MN ? G MN . ? A MN 106 ? 1_555 O ? Q HOH . ? A HOH 205 ? 1_555 85.4 ? 65 O ? Q HOH . ? A HOH 204 ? 1_555 MN ? G MN . ? A MN 106 ? 1_555 O ? Q HOH . ? A HOH 205 ? 1_555 174.2 ? 66 O6 ? A G 40 ? A G 40 ? 1_555 MN ? G MN . ? A MN 106 ? 1_555 O ? Q HOH . ? A HOH 209 ? 1_555 89.5 ? 67 O ? Q HOH . ? A HOH 204 ? 1_555 MN ? G MN . ? A MN 106 ? 1_555 O ? Q HOH . ? A HOH 209 ? 1_555 91.7 ? 68 O ? Q HOH . ? A HOH 205 ? 1_555 MN ? G MN . ? A MN 106 ? 1_555 O ? Q HOH . ? A HOH 209 ? 1_555 86.8 ? 69 O ? Q HOH . ? A HOH 208 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 O ? Q HOH . ? A HOH 212 ? 1_555 129.3 ? 70 O ? Q HOH . ? A HOH 208 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 O ? Q HOH . ? A HOH 213 ? 1_555 62.8 ? 71 O ? Q HOH . ? A HOH 212 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 O ? Q HOH . ? A HOH 213 ? 1_555 74.5 ? 72 O ? Q HOH . ? A HOH 208 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 O ? Q HOH . ? A HOH 214 ? 1_555 97.4 ? 73 O ? Q HOH . ? A HOH 212 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 O ? Q HOH . ? A HOH 214 ? 1_555 66.8 ? 74 O ? Q HOH . ? A HOH 213 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 O ? Q HOH . ? A HOH 214 ? 1_555 104.0 ? 75 O ? Q HOH . ? A HOH 208 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 O ? Q HOH . ? A HOH 230 ? 1_555 88.7 ? 76 O ? Q HOH . ? A HOH 212 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 O ? Q HOH . ? A HOH 230 ? 1_555 122.2 ? 77 O ? Q HOH . ? A HOH 213 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 O ? Q HOH . ? A HOH 230 ? 1_555 149.3 ? 78 O ? Q HOH . ? A HOH 214 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 O ? Q HOH . ? A HOH 230 ? 1_555 66.5 ? 79 O ? Q HOH . ? A HOH 220 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 228 ? 1_555 165.7 ? 80 O ? Q HOH . ? A HOH 220 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 228 ? 5_554 130.7 ? 81 O ? Q HOH . ? A HOH 228 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 228 ? 5_554 61.0 ? 82 O ? Q HOH . ? A HOH 220 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 229 ? 1_555 65.6 ? 83 O ? Q HOH . ? A HOH 228 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 229 ? 1_555 110.9 ? 84 O ? Q HOH . ? A HOH 228 ? 5_554 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 229 ? 1_555 142.2 ? 85 O ? Q HOH . ? A HOH 220 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 229 ? 5_554 82.9 ? 86 O ? Q HOH . ? A HOH 228 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 229 ? 5_554 105.9 ? 87 O ? Q HOH . ? A HOH 228 ? 5_554 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 229 ? 5_554 93.2 ? 88 O ? Q HOH . ? A HOH 229 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 229 ? 5_554 51.6 ? 89 O ? Q HOH . ? A HOH 220 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 231 ? 1_555 127.9 ? 90 O ? Q HOH . ? A HOH 228 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 231 ? 1_555 46.7 ? 91 O ? Q HOH . ? A HOH 228 ? 5_554 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 231 ? 1_555 98.3 ? 92 O ? Q HOH . ? A HOH 229 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 231 ? 1_555 64.2 ? 93 O ? Q HOH . ? A HOH 229 ? 5_554 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 231 ? 1_555 77.1 ? 94 O ? Q HOH . ? A HOH 220 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 231 ? 5_554 90.4 ? 95 O ? Q HOH . ? A HOH 228 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 231 ? 5_554 103.7 ? 96 O ? Q HOH . ? A HOH 228 ? 5_554 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 231 ? 5_554 49.4 ? 97 O ? Q HOH . ? A HOH 229 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 231 ? 5_554 105.9 ? 98 O ? Q HOH . ? A HOH 229 ? 5_554 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 231 ? 5_554 56.8 ? 99 O ? Q HOH . ? A HOH 231 ? 1_555 MG ? J MG . ? A MG 109 ? 1_555 O ? Q HOH . ? A HOH 231 ? 5_554 115.9 ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2020-11-25 2 'Structure model' 1 1 2020-12-02 3 'Structure model' 1 2 2020-12-23 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' citation # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.pdbx_database_id_PubMed' 2 2 'Structure model' '_citation_author.identifier_ORCID' 3 3 'Structure model' '_citation.journal_volume' 4 3 'Structure model' '_citation.page_first' 5 3 'Structure model' '_citation.page_last' # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-3000 ? ? ? . 1 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.14_3260 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? 3.25 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-3000 ? ? ? . 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 5 # _pdbx_entry_details.entry_id 7D82 _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 MN A MN 103 ? ? O A HOH 224 ? ? 1.70 2 1 O A HOH 228 ? ? O A HOH 231 ? ? 2.06 3 1 O A HOH 220 ? ? O A HOH 229 ? ? 2.12 4 1 N3 A G 27 ? ? N6 A A 30 ? ? 2.14 5 1 O A HOH 215 ? ? O A HOH 224 ? ? 2.16 # _pdbx_validate_symm_contact.id 1 _pdbx_validate_symm_contact.PDB_model_num 1 _pdbx_validate_symm_contact.auth_atom_id_1 O _pdbx_validate_symm_contact.auth_asym_id_1 A _pdbx_validate_symm_contact.auth_comp_id_1 HOH _pdbx_validate_symm_contact.auth_seq_id_1 229 _pdbx_validate_symm_contact.PDB_ins_code_1 ? _pdbx_validate_symm_contact.label_alt_id_1 ? _pdbx_validate_symm_contact.site_symmetry_1 1_555 _pdbx_validate_symm_contact.auth_atom_id_2 O _pdbx_validate_symm_contact.auth_asym_id_2 A _pdbx_validate_symm_contact.auth_comp_id_2 HOH _pdbx_validate_symm_contact.auth_seq_id_2 229 _pdbx_validate_symm_contact.PDB_ins_code_2 ? _pdbx_validate_symm_contact.label_alt_id_2 ? _pdbx_validate_symm_contact.site_symmetry_2 5_554 _pdbx_validate_symm_contact.dist 2.02 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7D82 'double helix' 7D82 'a-form double helix' 7D82 tetraloop 7D82 'bulge loop' 7D82 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 50 1_555 -0.203 0.016 -0.267 -2.123 -4.682 -18.650 1 A_G1:C50_A A 1 ? A 50 ? ? 1 1 A G 2 1_555 A C 49 1_555 -1.007 -0.603 0.218 1.789 -17.040 -10.620 2 A_G2:C49_A A 2 ? A 49 ? 19 1 1 A U 3 1_555 A G 48 1_555 1.658 -0.056 0.259 -3.418 -8.812 8.585 3 A_U3:G48_A A 3 ? A 48 ? 28 1 1 A U 4 1_555 A A 47 1_555 0.383 0.406 0.045 -8.303 -21.127 7.382 4 A_U4:A47_A A 4 ? A 47 ? 20 1 1 A U 5 1_555 A A 46 1_555 0.066 -0.321 0.175 0.641 -10.047 -4.260 5 A_U5:A46_A A 5 ? A 46 ? 20 1 1 A C 6 1_555 A G 45 1_555 -0.312 0.081 0.088 8.116 -25.091 2.441 6 A_C6:G45_A A 6 ? A 45 ? 19 1 1 A A 7 1_555 A U 44 1_555 -0.128 -0.128 0.160 2.390 -3.321 -1.179 7 A_A7:U44_A A 7 ? A 44 ? 20 1 1 A G 16 1_555 A C 43 1_555 -0.179 -0.415 -0.413 -12.429 -17.294 4.758 8 A_G16:C43_A A 16 ? A 43 ? 19 1 1 A U 17 1_555 A A 42 1_555 -0.379 -0.230 0.221 -17.655 -8.337 -2.631 9 A_U17:A42_A A 17 ? A 42 ? 20 1 1 A U 18 1_555 A G 41 1_555 2.262 -0.506 -0.224 -0.079 -4.752 0.658 10 A_U18:G41_A A 18 ? A 41 ? 28 1 1 A C 19 1_555 A G 40 1_555 0.224 -0.030 -0.265 7.421 -12.961 5.647 11 A_C19:G40_A A 19 ? A 40 ? 19 1 1 A G 20 1_555 A C 39 1_555 -0.415 -0.175 0.070 0.955 -7.716 0.115 12 A_G20:C39_A A 20 ? A 39 ? 19 1 1 A G 21 1_555 A C 38 1_555 -0.217 -0.290 -0.131 6.348 -10.605 -0.048 13 A_G21:C38_A A 21 ? A 38 ? 19 1 1 A C 22 1_555 A G 37 1_555 0.520 -0.016 -0.291 6.630 -11.194 7.474 14 A_C22:G37_A A 22 ? A 37 ? 19 1 1 A C 24 1_555 A G 34 1_555 -1.117 1.617 1.699 -3.507 14.519 59.432 15 A_C24:G34_A A 24 ? A 34 ? ? 1 1 A U 25 1_555 A A 32 1_555 0.960 -0.333 -0.356 4.495 3.136 10.279 16 A_U25:A32_A A 25 ? A 32 ? 20 1 1 A C 26 1_555 A G 31 1_555 0.077 -0.702 -0.144 4.515 3.503 -0.881 17 A_C26:G31_A A 26 ? A 31 ? 19 1 1 A G 27 1_555 A A 30 1_555 6.128 -3.515 0.323 17.884 11.596 25.353 18 A_G27:A30_A A 27 ? A 30 ? ? 5 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 50 1_555 A G 2 1_555 A C 49 1_555 0.078 -1.977 3.038 -11.178 7.913 38.900 -3.560 -1.166 2.493 11.459 16.186 41.152 1 AA_G1G2:C49C50_AA A 1 ? A 50 ? A 2 ? A 49 ? 1 A G 2 1_555 A C 49 1_555 A U 3 1_555 A G 48 1_555 0.810 -1.271 3.229 2.433 2.450 47.631 -1.763 -0.810 3.199 3.029 -3.008 47.749 2 AA_G2U3:G48C49_AA A 2 ? A 49 ? A 3 ? A 48 ? 1 A U 3 1_555 A G 48 1_555 A U 4 1_555 A A 47 1_555 -0.403 -1.837 2.981 4.762 14.262 28.067 -5.382 1.413 1.774 27.087 -9.044 31.769 3 AA_U3U4:A47G48_AA A 3 ? A 48 ? A 4 ? A 47 ? 1 A U 4 1_555 A A 47 1_555 A U 5 1_555 A A 46 1_555 -0.415 -0.876 3.009 -4.222 7.581 28.725 -3.095 0.022 2.726 14.857 8.275 29.981 4 AA_U4U5:A46A47_AA A 4 ? A 47 ? A 5 ? A 46 ? 1 A U 5 1_555 A A 46 1_555 A C 6 1_555 A G 45 1_555 1.353 -1.982 2.826 4.475 11.024 26.869 -5.769 -1.917 2.064 22.383 -9.086 29.341 5 AA_U5C6:G45A46_AA A 5 ? A 46 ? A 6 ? A 45 ? 1 A C 6 1_555 A G 45 1_555 A A 7 1_555 A U 44 1_555 -0.877 -1.704 3.297 -4.525 16.453 34.450 -4.483 0.817 2.365 25.905 7.125 38.330 6 AA_C6A7:U44G45_AA A 6 ? A 45 ? A 7 ? A 44 ? 1 A A 7 1_555 A U 44 1_555 A G 16 1_555 A C 43 1_555 0.605 -2.798 3.485 5.103 17.398 33.749 -6.218 -0.355 1.934 27.632 -8.104 38.186 7 AA_A7G16:C43U44_AA A 7 ? A 44 ? A 16 ? A 43 ? 1 A G 16 1_555 A C 43 1_555 A U 17 1_555 A A 42 1_555 -0.901 -2.013 3.342 -3.555 11.237 29.211 -5.667 1.044 2.505 21.224 6.715 31.451 8 AA_G16U17:A42C43_AA A 16 ? A 43 ? A 17 ? A 42 ? 1 A U 17 1_555 A A 42 1_555 A U 18 1_555 A G 41 1_555 0.147 -1.102 2.845 2.712 3.664 40.052 -1.954 0.049 2.742 5.328 -3.945 40.300 9 AA_U17U18:G41A42_AA A 17 ? A 42 ? A 18 ? A 41 ? 1 A U 18 1_555 A G 41 1_555 A C 19 1_555 A G 40 1_555 0.177 -1.703 2.844 4.065 12.496 23.342 -6.111 0.408 1.730 28.200 -9.174 26.742 10 AA_U18C19:G40G41_AA A 18 ? A 41 ? A 19 ? A 40 ? 1 A C 19 1_555 A G 40 1_555 A G 20 1_555 A C 39 1_555 -0.685 -1.496 3.315 -4.044 16.761 26.183 -5.642 0.578 2.085 32.853 7.926 31.268 11 AA_C19G20:C39G40_AA A 19 ? A 40 ? A 20 ? A 39 ? 1 A G 20 1_555 A C 39 1_555 A G 21 1_555 A C 38 1_555 0.190 -1.162 3.223 1.972 10.592 31.989 -3.611 -0.028 2.718 18.573 -3.458 33.709 12 AA_G20G21:C38C39_AA A 20 ? A 39 ? A 21 ? A 38 ? 1 A G 21 1_555 A C 38 1_555 A C 22 1_555 A G 37 1_555 1.266 -1.274 3.147 3.449 8.318 35.459 -3.107 -1.573 2.891 13.392 -5.553 36.549 13 AA_G21C22:G37C38_AA A 21 ? A 38 ? A 22 ? A 37 ? 1 A C 24 1_555 A G 34 1_555 A U 25 1_555 A A 32 1_555 -0.553 -1.040 4.774 -6.350 18.705 54.770 -2.500 0.086 4.278 19.633 6.665 57.963 14 AA_C24U25:A32G34_AA A 24 ? A 34 ? A 25 ? A 32 ? 1 A U 25 1_555 A A 32 1_555 A C 26 1_555 A G 31 1_555 -0.721 -1.377 3.359 0.426 11.471 30.898 -4.298 1.343 2.682 20.657 -0.768 32.913 15 AA_U25C26:G31A32_AA A 25 ? A 32 ? A 26 ? A 31 ? 1 A C 26 1_555 A G 31 1_555 A G 27 1_555 A A 30 1_555 -0.292 -0.439 2.941 -6.382 6.093 44.465 -1.057 -0.130 2.873 7.958 8.336 45.288 16 AA_C26G27:A30G31_AA A 26 ? A 31 ? A 27 ? A 30 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # loop_ _pdbx_entity_instance_feature.ordinal _pdbx_entity_instance_feature.comp_id _pdbx_entity_instance_feature.asym_id _pdbx_entity_instance_feature.seq_num _pdbx_entity_instance_feature.auth_comp_id _pdbx_entity_instance_feature.auth_asym_id _pdbx_entity_instance_feature.auth_seq_num _pdbx_entity_instance_feature.feature_type _pdbx_entity_instance_feature.details 1 MN ? ? MN ? ? 'SUBJECT OF INVESTIGATION' ? 2 NAD ? ? NAD ? ? 'SUBJECT OF INVESTIGATION' ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'MANGANESE (II) ION' MN 3 NICOTINAMIDE-ADENINE-DINUCLEOTIDE NAD 4 'MAGNESIUM ION' MG 5 water HOH # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'isothermal titration calorimetry' _pdbx_struct_assembly_auth_evidence.details ? #