data_7EDM # _entry.id 7EDM # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7EDM pdb_00007edm 10.2210/pdb7edm/pdb WWPDB D_1300021228 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7EDM _pdbx_database_status.recvd_initial_deposition_date 2021-03-16 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kondo, J.' 1 0000-0002-5682-3685 'Suzuki, C.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Crystal structure of the eukaryotic ribosomal decoding site in complex with G418 and Hg(II)' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Kondo, J.' 1 0000-0002-5682-3685 primary 'Suzuki, C.' 2 ? # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 7EDM _cell.details ? _cell.formula_units_Z ? _cell.length_a 31.429 _cell.length_a_esd ? _cell.length_b 97.487 _cell.length_b_esd ? _cell.length_c 47.548 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7EDM _symmetry.cell_setting ? _symmetry.Int_Tables_number 18 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 21 21 2' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;RNA (5'-R(P*UP*GP*CP*GP*UP*CP*GP*CP*GP*UP*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3') ; 7371.408 2 ? ? ? ? 2 non-polymer syn 'MERCURY (II) ION' 200.590 2 ? ? ? ? 3 non-polymer syn GENETICIN 496.552 2 ? ? ? ? 4 water nat water 18.015 11 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code UUGCGUCGCGUCGACGAAGUCGC _entity_poly.pdbx_seq_one_letter_code_can UUGCGUCGCGUCGACGAAGUCGC _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 U n 1 2 U n 1 3 G n 1 4 C n 1 5 G n 1 6 U n 1 7 C n 1 8 G n 1 9 C n 1 10 G n 1 11 U n 1 12 C n 1 13 G n 1 14 A n 1 15 C n 1 16 G n 1 17 A n 1 18 A n 1 19 G n 1 20 U n 1 21 C n 1 22 G n 1 23 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 23 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7EDM _struct_ref.pdbx_db_accession 7EDM _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 7EDM A 1 ? 23 ? 7EDM 1 ? 23 ? 1 23 2 1 7EDM B 1 ? 23 ? 7EDM 24 ? 46 ? 24 46 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GET non-polymer . GENETICIN G418 'C20 H40 N4 O10' 496.552 HG non-polymer . 'MERCURY (II) ION' ? 'Hg 2' 200.590 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7EDM _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.47 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 50.21 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'sodium cacodylate, MPD, spermine tetrahydrochloride, potassium chloride, G418, mercury(II) perchlorate' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER X 4M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2017-12-23 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.1 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'PHOTON FACTORY BEAMLINE BL-1A' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.1 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL-1A _diffrn_source.pdbx_synchrotron_site 'Photon Factory' # _reflns.B_iso_Wilson_estimate 38.895 _reflns.entry_id 7EDM _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.810 _reflns.d_resolution_low 48.740 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 6827 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.500 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 3.522 _reflns.pdbx_Rmerge_I_obs 0.099 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 9.860 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 0.979 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.117 _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all 24046 _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.992 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_all _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split 2.810 2.890 ? 3.740 ? 1705 505 ? 493 97.600 ? ? ? ? 0.332 ? ? ? ? ? ? ? ? 3.458 ? ? ? ? 0.389 ? ? 1 1 0.909 ? ? 2.890 2.960 ? 4.370 ? 1753 483 ? 483 100.000 ? ? ? ? 0.304 ? ? ? ? ? ? ? ? 3.629 ? ? ? ? 0.357 ? ? 2 1 0.913 ? ? 2.960 3.050 ? 5.570 ? 1791 494 ? 494 100.000 ? ? ? ? 0.223 ? ? ? ? ? ? ? ? 3.626 ? ? ? ? 0.262 ? ? 3 1 0.965 ? ? 3.050 3.140 ? 6.850 ? 1702 480 ? 480 100.000 ? ? ? ? 0.152 ? ? ? ? ? ? ? ? 3.546 ? ? ? ? 0.180 ? ? 4 1 0.989 ? ? 3.140 3.250 ? 8.110 ? 1485 425 ? 421 99.100 ? ? ? ? 0.122 ? ? ? ? ? ? ? ? 3.527 ? ? ? ? 0.144 ? ? 5 1 0.990 ? ? 3.250 3.360 ? 8.600 ? 1541 441 ? 439 99.500 ? ? ? ? 0.124 ? ? ? ? ? ? ? ? 3.510 ? ? ? ? 0.147 ? ? 6 1 0.986 ? ? 3.360 3.490 ? 8.890 ? 1498 447 ? 446 99.800 ? ? ? ? 0.122 ? ? ? ? ? ? ? ? 3.359 ? ? ? ? 0.145 ? ? 7 1 0.989 ? ? 3.490 3.630 ? 9.930 ? 1197 381 ? 378 99.200 ? ? ? ? 0.100 ? ? ? ? ? ? ? ? 3.167 ? ? ? ? 0.120 ? ? 8 1 0.990 ? ? 3.630 3.790 ? 9.670 ? 1312 404 ? 397 98.300 ? ? ? ? 0.104 ? ? ? ? ? ? ? ? 3.305 ? ? ? ? 0.124 ? ? 9 1 0.989 ? ? 3.790 3.980 ? 10.730 ? 1336 378 ? 378 100.000 ? ? ? ? 0.095 ? ? ? ? ? ? ? ? 3.534 ? ? ? ? 0.112 ? ? 10 1 0.994 ? ? 3.980 4.190 ? 11.880 ? 1139 346 ? 345 99.700 ? ? ? ? 0.086 ? ? ? ? ? ? ? ? 3.301 ? ? ? ? 0.103 ? ? 11 1 0.990 ? ? 4.190 4.450 ? 11.970 ? 1218 339 ? 337 99.400 ? ? ? ? 0.099 ? ? ? ? ? ? ? ? 3.614 ? ? ? ? 0.116 ? ? 12 1 0.988 ? ? 4.450 4.750 ? 12.970 ? 1195 313 ? 313 100.000 ? ? ? ? 0.092 ? ? ? ? ? ? ? ? 3.818 ? ? ? ? 0.107 ? ? 13 1 0.987 ? ? 4.750 5.130 ? 13.690 ? 1131 297 ? 297 100.000 ? ? ? ? 0.081 ? ? ? ? ? ? ? ? 3.808 ? ? ? ? 0.094 ? ? 14 1 0.994 ? ? 5.130 5.620 ? 15.090 ? 1019 272 ? 272 100.000 ? ? ? ? 0.064 ? ? ? ? ? ? ? ? 3.746 ? ? ? ? 0.075 ? ? 15 1 0.995 ? ? 5.620 6.290 ? 15.200 ? 917 249 ? 249 100.000 ? ? ? ? 0.068 ? ? ? ? ? ? ? ? 3.683 ? ? ? ? 0.079 ? ? 16 1 0.993 ? ? 6.290 7.260 ? 16.330 ? 737 202 ? 202 100.000 ? ? ? ? 0.064 ? ? ? ? ? ? ? ? 3.649 ? ? ? ? 0.075 ? ? 17 1 0.994 ? ? 7.260 8.890 ? 17.140 ? 653 183 ? 183 100.000 ? ? ? ? 0.060 ? ? ? ? ? ? ? ? 3.568 ? ? ? ? 0.070 ? ? 18 1 0.994 ? ? 8.890 12.580 ? 17.670 ? 474 143 ? 141 98.600 ? ? ? ? 0.054 ? ? ? ? ? ? ? ? 3.362 ? ? ? ? 0.064 ? ? 19 1 0.996 ? ? 12.580 48.740 ? 18.160 ? 243 80 ? 79 98.800 ? ? ? ? 0.056 ? ? ? ? ? ? ? ? 3.076 ? ? ? ? 0.068 ? ? 20 1 0.992 ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max 73.830 _refine.B_iso_mean 30.5739 _refine.B_iso_min 12.790 _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details 'The SF file contains friedel pairs under F_plus and F_minus columns.' _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7EDM _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.8100 _refine.ls_d_res_low 48.7400 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 6812 _refine.ls_number_reflns_R_free 666 _refine.ls_number_reflns_R_work 6146 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.2600 _refine.ls_percent_reflns_R_free 9.7800 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.1702 _refine.ls_R_factor_R_free 0.2287 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1644 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.410 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 4k32 _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 21.8100 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.3500 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id final _refine_hist.details ? _refine_hist.d_res_high 2.8100 _refine_hist.d_res_low 48.7400 _refine_hist.number_atoms_solvent 11 _refine_hist.number_atoms_total 1001 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total 43 _refine_hist.pdbx_B_iso_mean_ligand 25.41 _refine_hist.pdbx_B_iso_mean_solvent 26.48 _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 920 _refine_hist.pdbx_number_atoms_ligand 70 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 2.8100 3.0300 1360 . 136 1224 99.0000 . . . 0.3710 0.0000 0.2603 . . . . . . . 5 . . . 'X-RAY DIFFRACTION' 3.0300 3.3300 1352 . 137 1215 99.0000 . . . 0.2355 0.0000 0.1859 . . . . . . . 5 . . . 'X-RAY DIFFRACTION' 3.3300 3.8200 1354 . 131 1223 99.0000 . . . 0.2299 0.0000 0.1556 . . . . . . . 5 . . . 'X-RAY DIFFRACTION' 3.8200 4.8100 1373 . 133 1240 100.0000 . . . 0.2210 0.0000 0.1346 . . . . . . . 5 . . . 'X-RAY DIFFRACTION' 4.8100 48.7400 1373 . 129 1244 100.0000 . . . 0.1824 0.0000 0.1498 . . . . . . . 5 . . . # _struct.entry_id 7EDM _struct.title 'Crystal structure of the eukaryotic ribosomal decoding site in complex with G418 and Hg(II)' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7EDM _struct_keywords.text 'Metal-mediated base pair, Mercury, Decoding site, Ribosomal RNA, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 2 ? E N N 3 ? F N N 3 ? G N N 4 ? H N N 4 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A U 6 N3 ? ? ? 1_555 D HG . HG ? ? A U 6 A HG 202 1_555 ? ? ? ? ? ? ? 2.261 ? ? metalc2 metalc ? ? A U 6 O4 ? ? ? 1_555 D HG . HG ? ? A U 6 A HG 202 1_555 ? ? ? ? ? ? ? 2.665 ? ? metalc3 metalc ? ? A U 20 O2 ? ? ? 1_555 C HG . HG ? ? A U 20 A HG 201 1_555 ? ? ? ? ? ? ? 3.148 ? ? metalc4 metalc ? ? A U 20 N3 ? ? ? 1_555 C HG . HG ? ? A U 20 A HG 201 1_555 ? ? ? ? ? ? ? 2.238 ? ? metalc5 metalc ? ? A U 20 O4 ? ? ? 1_555 C HG . HG ? ? A U 20 A HG 201 1_555 ? ? ? ? ? ? ? 3.116 ? ? metalc6 metalc ? ? C HG . HG ? ? ? 1_555 B U 6 O2 ? ? A HG 201 B U 29 1_555 ? ? ? ? ? ? ? 3.187 ? ? metalc7 metalc ? ? C HG . HG ? ? ? 1_555 B U 6 N3 ? ? A HG 201 B U 29 1_555 ? ? ? ? ? ? ? 2.174 ? ? metalc8 metalc ? ? C HG . HG ? ? ? 1_555 B U 6 O4 ? ? A HG 201 B U 29 1_555 ? ? ? ? ? ? ? 2.976 ? ? metalc9 metalc ? ? D HG . HG ? ? ? 1_555 B U 20 O2 ? ? A HG 202 B U 43 1_555 ? ? ? ? ? ? ? 3.122 ? ? metalc10 metalc ? ? D HG . HG ? ? ? 1_555 B U 20 N3 ? ? A HG 202 B U 43 1_555 ? ? ? ? ? ? ? 2.152 ? ? metalc11 metalc ? ? D HG . HG ? ? ? 1_555 B U 20 O4 ? ? A HG 202 B U 43 1_555 ? ? ? ? ? ? ? 3.064 ? ? hydrog1 hydrog ? ? A G 3 N1 ? ? ? 1_555 B C 23 N3 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 3 N2 ? ? ? 1_555 B C 23 O2 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 3 O6 ? ? ? 1_555 B C 23 N4 ? ? A G 3 B C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 4 N3 ? ? ? 1_555 B G 22 N1 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 4 N4 ? ? ? 1_555 B G 22 O6 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 4 O2 ? ? ? 1_555 B G 22 N2 ? ? A C 4 B G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 5 N1 ? ? ? 1_555 B C 21 N3 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 5 N2 ? ? ? 1_555 B C 21 O2 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 5 O6 ? ? ? 1_555 B C 21 N4 ? ? A G 5 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 7 N3 ? ? ? 1_555 B G 19 N1 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 7 N4 ? ? ? 1_555 B G 19 O6 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 7 O2 ? ? ? 1_555 B G 19 N2 ? ? A C 7 B G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 9 N3 ? ? ? 1_555 B G 16 N1 ? ? A C 9 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 9 N4 ? ? ? 1_555 B G 16 O6 ? ? A C 9 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 9 O2 ? ? ? 1_555 B G 16 N2 ? ? A C 9 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 10 N1 ? ? ? 1_555 B C 15 N3 ? ? A G 10 B C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 10 N2 ? ? ? 1_555 B C 15 O2 ? ? A G 10 B C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 10 O6 ? ? ? 1_555 B C 15 N4 ? ? A G 10 B C 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 11 N3 ? ? ? 1_555 B A 14 N1 ? ? A U 11 B A 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A U 11 O4 ? ? ? 1_555 B A 14 N6 ? ? A U 11 B A 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 12 N3 ? ? ? 1_555 B G 13 N1 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 12 N4 ? ? ? 1_555 B G 13 O6 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 12 O2 ? ? ? 1_555 B G 13 N2 ? ? A C 12 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 12 N3 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 12 O2 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 12 N4 ? ? A G 13 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 14 N1 ? ? ? 1_555 B U 11 N3 ? ? A A 14 B U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A A 14 N6 ? ? ? 1_555 B U 11 O4 ? ? A A 14 B U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 15 N3 ? ? ? 1_555 B G 10 N1 ? ? A C 15 B G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 15 N4 ? ? ? 1_555 B G 10 O6 ? ? A C 15 B G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 15 O2 ? ? ? 1_555 B G 10 N2 ? ? A C 15 B G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 16 N1 ? ? ? 1_555 B C 9 N3 ? ? A G 16 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 16 N2 ? ? ? 1_555 B C 9 O2 ? ? A G 16 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 16 O6 ? ? ? 1_555 B C 9 N4 ? ? A G 16 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 19 N1 ? ? ? 1_555 B C 7 N3 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 19 N2 ? ? ? 1_555 B C 7 O2 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 19 O6 ? ? ? 1_555 B C 7 N4 ? ? A G 19 B C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 21 N3 ? ? ? 1_555 B G 5 N1 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 21 N4 ? ? ? 1_555 B G 5 O6 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 21 O2 ? ? ? 1_555 B G 5 N2 ? ? A C 21 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 22 N1 ? ? ? 1_555 B C 4 N3 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 22 N2 ? ? ? 1_555 B C 4 O2 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 22 O6 ? ? ? 1_555 B C 4 N4 ? ? A G 22 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 23 N3 ? ? ? 1_555 B G 3 N1 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 23 N4 ? ? ? 1_555 B G 3 O6 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 23 O2 ? ? ? 1_555 B G 3 N2 ? ? A C 23 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # _atom_sites.entry_id 7EDM _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.031818 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.010258 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.021031 _atom_sites.fract_transf_vector[1] 0.000000 _atom_sites.fract_transf_vector[2] 0.000000 _atom_sites.fract_transf_vector[3] 0.000000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C HG N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 U 1 1 ? ? ? A . n A 1 2 U 2 2 2 U U A . n A 1 3 G 3 3 3 G G A . n A 1 4 C 4 4 4 C C A . n A 1 5 G 5 5 5 G G A . n A 1 6 U 6 6 6 U U A . n A 1 7 C 7 7 7 C C A . n A 1 8 G 8 8 8 G G A . n A 1 9 C 9 9 9 C C A . n A 1 10 G 10 10 10 G G A . n A 1 11 U 11 11 11 U U A . n A 1 12 C 12 12 12 C C A . n A 1 13 G 13 13 13 G G A . n A 1 14 A 14 14 14 A A A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 A 17 17 17 A A A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 U 20 20 20 U U A . n A 1 21 C 21 21 21 C C A . n A 1 22 G 22 22 22 G G A . n A 1 23 C 23 23 23 C C A . n B 1 1 U 1 24 ? ? ? B . n B 1 2 U 2 25 ? ? ? B . n B 1 3 G 3 26 26 G G B . n B 1 4 C 4 27 27 C C B . n B 1 5 G 5 28 28 G G B . n B 1 6 U 6 29 29 U U B . n B 1 7 C 7 30 30 C C B . n B 1 8 G 8 31 31 G G B . n B 1 9 C 9 32 32 C C B . n B 1 10 G 10 33 33 G G B . n B 1 11 U 11 34 34 U U B . n B 1 12 C 12 35 35 C C B . n B 1 13 G 13 36 36 G G B . n B 1 14 A 14 37 37 A A B . n B 1 15 C 15 38 38 C C B . n B 1 16 G 16 39 39 G G B . n B 1 17 A 17 40 40 A A B . n B 1 18 A 18 41 41 A A B . n B 1 19 G 19 42 42 G G B . n B 1 20 U 20 43 43 U U B . n B 1 21 C 21 44 44 C C B . n B 1 22 G 22 45 45 G G B . n B 1 23 C 23 46 46 C C B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 HG 1 201 201 HG HG A . D 2 HG 1 202 202 HG HG A . E 3 GET 1 101 51 GET GET B . F 3 GET 1 102 52 GET GET B . G 4 HOH 1 301 7 HOH HOH A . G 4 HOH 2 302 9 HOH HOH A . G 4 HOH 3 303 11 HOH HOH A . G 4 HOH 4 304 3 HOH HOH A . G 4 HOH 5 305 8 HOH HOH A . H 4 HOH 1 201 2 HOH HOH B . H 4 HOH 2 202 1 HOH HOH B . H 4 HOH 3 203 10 HOH HOH B . H 4 HOH 4 204 4 HOH HOH B . H 4 HOH 5 205 5 HOH HOH B . H 4 HOH 6 206 6 HOH HOH B . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 4300 ? 1 MORE -107 ? 1 'SSA (A^2)' 7870 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 N3 ? A U 6 ? A U 6 ? 1_555 HG ? D HG . ? A HG 202 ? 1_555 O4 ? A U 6 ? A U 6 ? 1_555 54.4 ? 2 N3 ? A U 6 ? A U 6 ? 1_555 HG ? D HG . ? A HG 202 ? 1_555 O2 ? B U 20 ? B U 43 ? 1_555 131.0 ? 3 O4 ? A U 6 ? A U 6 ? 1_555 HG ? D HG . ? A HG 202 ? 1_555 O2 ? B U 20 ? B U 43 ? 1_555 172.1 ? 4 N3 ? A U 6 ? A U 6 ? 1_555 HG ? D HG . ? A HG 202 ? 1_555 N3 ? B U 20 ? B U 43 ? 1_555 178.6 ? 5 O4 ? A U 6 ? A U 6 ? 1_555 HG ? D HG . ? A HG 202 ? 1_555 N3 ? B U 20 ? B U 43 ? 1_555 127.0 ? 6 O2 ? B U 20 ? B U 43 ? 1_555 HG ? D HG . ? A HG 202 ? 1_555 N3 ? B U 20 ? B U 43 ? 1_555 47.6 ? 7 N3 ? A U 6 ? A U 6 ? 1_555 HG ? D HG . ? A HG 202 ? 1_555 O4 ? B U 20 ? B U 43 ? 1_555 133.5 ? 8 O4 ? A U 6 ? A U 6 ? 1_555 HG ? D HG . ? A HG 202 ? 1_555 O4 ? B U 20 ? B U 43 ? 1_555 79.4 ? 9 O2 ? B U 20 ? B U 43 ? 1_555 HG ? D HG . ? A HG 202 ? 1_555 O4 ? B U 20 ? B U 43 ? 1_555 95.5 ? 10 N3 ? B U 20 ? B U 43 ? 1_555 HG ? D HG . ? A HG 202 ? 1_555 O4 ? B U 20 ? B U 43 ? 1_555 47.9 ? 11 O2 ? A U 20 ? A U 20 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 N3 ? A U 20 ? A U 20 ? 1_555 45.8 ? 12 O2 ? A U 20 ? A U 20 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 O4 ? A U 20 ? A U 20 ? 1_555 92.0 ? 13 N3 ? A U 20 ? A U 20 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 O4 ? A U 20 ? A U 20 ? 1_555 46.2 ? 14 O2 ? A U 20 ? A U 20 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 O2 ? B U 6 ? B U 29 ? 1_555 95.3 ? 15 N3 ? A U 20 ? A U 20 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 O2 ? B U 6 ? B U 29 ? 1_555 140.8 ? 16 O4 ? A U 20 ? A U 20 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 O2 ? B U 6 ? B U 29 ? 1_555 171.1 ? 17 O2 ? A U 20 ? A U 20 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 N3 ? B U 6 ? B U 29 ? 1_555 140.4 ? 18 N3 ? A U 20 ? A U 20 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 N3 ? B U 6 ? B U 29 ? 1_555 173.8 ? 19 O4 ? A U 20 ? A U 20 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 N3 ? B U 6 ? B U 29 ? 1_555 127.6 ? 20 O2 ? B U 6 ? B U 29 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 N3 ? B U 6 ? B U 29 ? 1_555 45.3 ? 21 O2 ? A U 20 ? A U 20 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 O4 ? B U 6 ? B U 29 ? 1_555 169.2 ? 22 N3 ? A U 20 ? A U 20 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 O4 ? B U 6 ? B U 29 ? 1_555 124.9 ? 23 O4 ? A U 20 ? A U 20 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 O4 ? B U 6 ? B U 29 ? 1_555 78.9 ? 24 O2 ? B U 6 ? B U 29 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 O4 ? B U 6 ? B U 29 ? 1_555 94.3 ? 25 N3 ? B U 6 ? B U 29 ? 1_555 HG ? C HG . ? A HG 201 ? 1_555 O4 ? B U 6 ? B U 29 ? 1_555 49.0 ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2022-03-16 2 'Structure model' 1 1 2023-11-29 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' chem_comp_atom 2 2 'Structure model' chem_comp_bond 3 2 'Structure model' pdbx_initial_refinement_model # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? . 1 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.17.1 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _pdbx_entry_details.entry_id 7EDM _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _pdbx_unobs_or_zero_occ_residues.id _pdbx_unobs_or_zero_occ_residues.PDB_model_num _pdbx_unobs_or_zero_occ_residues.polymer_flag _pdbx_unobs_or_zero_occ_residues.occupancy_flag _pdbx_unobs_or_zero_occ_residues.auth_asym_id _pdbx_unobs_or_zero_occ_residues.auth_comp_id _pdbx_unobs_or_zero_occ_residues.auth_seq_id _pdbx_unobs_or_zero_occ_residues.PDB_ins_code _pdbx_unobs_or_zero_occ_residues.label_asym_id _pdbx_unobs_or_zero_occ_residues.label_comp_id _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 1 Y 1 A U 1 ? A U 1 2 1 Y 1 B U 24 ? B U 1 3 1 Y 1 B U 25 ? B U 2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GET C11 C N S 111 GET O11 O N N 112 GET C21 C N R 113 GET N21 N N N 114 GET C31 C N R 115 GET O31 O N N 116 GET C41 C N S 117 GET O41 O N N 118 GET C51 C N R 119 GET O51 O N N 120 GET C61 C N R 121 GET O61 O N N 122 GET C71 C N N 123 GET C12 C N R 124 GET N12 N N N 125 GET C22 C N N 126 GET C32 C N S 127 GET N32 N N N 128 GET C42 C N R 129 GET C52 C N S 130 GET O52 O N N 131 GET C62 C N S 132 GET O62 O N N 133 GET C13 C N R 134 GET C23 C N R 135 GET O23 O N N 136 GET C33 C N R 137 GET N33 N N N 138 GET C93 C N N 139 GET C43 C N R 140 GET O43 O N N 141 GET C83 C N N 142 GET C53 C N N 143 GET O53 O N N 144 GET H111 H N N 145 GET H21 H N N 146 GET H211 H N N 147 GET H212 H N N 148 GET H311 H N N 149 GET H31 H N N 150 GET H411 H N N 151 GET H41 H N N 152 GET H511 H N N 153 GET H611 H N N 154 GET H61 H N N 155 GET H711 H N N 156 GET H712 H N N 157 GET H713 H N N 158 GET H12 H N N 159 GET H121 H N N 160 GET H122 H N N 161 GET H221 H N N 162 GET H222 H N N 163 GET H32 H N N 164 GET H321 H N N 165 GET H322 H N N 166 GET H421 H N N 167 GET H521 H N N 168 GET H52 H N N 169 GET H621 H N N 170 GET H131 H N N 171 GET H231 H N N 172 GET H23 H N N 173 GET H331 H N N 174 GET H33 H N N 175 GET H931 H N N 176 GET H932 H N N 177 GET H933 H N N 178 GET H43 H N N 179 GET H831 H N N 180 GET H832 H N N 181 GET H833 H N N 182 GET H531 H N N 183 GET H532 H N N 184 HG HG HG N N 185 HOH O O N N 186 HOH H1 H N N 187 HOH H2 H N N 188 U OP3 O N N 189 U P P N N 190 U OP1 O N N 191 U OP2 O N N 192 U "O5'" O N N 193 U "C5'" C N N 194 U "C4'" C N R 195 U "O4'" O N N 196 U "C3'" C N S 197 U "O3'" O N N 198 U "C2'" C N R 199 U "O2'" O N N 200 U "C1'" C N R 201 U N1 N N N 202 U C2 C N N 203 U O2 O N N 204 U N3 N N N 205 U C4 C N N 206 U O4 O N N 207 U C5 C N N 208 U C6 C N N 209 U HOP3 H N N 210 U HOP2 H N N 211 U "H5'" H N N 212 U "H5''" H N N 213 U "H4'" H N N 214 U "H3'" H N N 215 U "HO3'" H N N 216 U "H2'" H N N 217 U "HO2'" H N N 218 U "H1'" H N N 219 U H3 H N N 220 U H5 H N N 221 U H6 H N N 222 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GET C11 O11 sing N N 116 GET C11 C21 sing N N 117 GET C11 O51 sing N N 118 GET C11 H111 sing N N 119 GET O11 C42 sing N N 120 GET C21 N21 sing N N 121 GET C21 C31 sing N N 122 GET C21 H21 sing N N 123 GET N21 H211 sing N N 124 GET N21 H212 sing N N 125 GET C31 O31 sing N N 126 GET C31 C41 sing N N 127 GET C31 H311 sing N N 128 GET O31 H31 sing N N 129 GET C41 O41 sing N N 130 GET C41 C51 sing N N 131 GET C41 H411 sing N N 132 GET O41 H41 sing N N 133 GET C51 O51 sing N N 134 GET C51 C61 sing N N 135 GET C51 H511 sing N N 136 GET C61 O61 sing N N 137 GET C61 C71 sing N N 138 GET C61 H611 sing N N 139 GET O61 H61 sing N N 140 GET C71 H711 sing N N 141 GET C71 H712 sing N N 142 GET C71 H713 sing N N 143 GET C12 N12 sing N N 144 GET C12 C22 sing N N 145 GET C12 C62 sing N N 146 GET C12 H12 sing N N 147 GET N12 H121 sing N N 148 GET N12 H122 sing N N 149 GET C22 C32 sing N N 150 GET C22 H221 sing N N 151 GET C22 H222 sing N N 152 GET C32 N32 sing N N 153 GET C32 C42 sing N N 154 GET C32 H32 sing N N 155 GET N32 H321 sing N N 156 GET N32 H322 sing N N 157 GET C42 C52 sing N N 158 GET C42 H421 sing N N 159 GET C52 O52 sing N N 160 GET C52 C62 sing N N 161 GET C52 H521 sing N N 162 GET O52 H52 sing N N 163 GET C62 O62 sing N N 164 GET C62 H621 sing N N 165 GET O62 C13 sing N N 166 GET C13 C23 sing N N 167 GET C13 O53 sing N N 168 GET C13 H131 sing N N 169 GET C23 O23 sing N N 170 GET C23 C33 sing N N 171 GET C23 H231 sing N N 172 GET O23 H23 sing N N 173 GET C33 N33 sing N N 174 GET C33 C43 sing N N 175 GET C33 H331 sing N N 176 GET N33 C93 sing N N 177 GET N33 H33 sing N N 178 GET C93 H931 sing N N 179 GET C93 H932 sing N N 180 GET C93 H933 sing N N 181 GET C43 O43 sing N N 182 GET C43 C83 sing N N 183 GET C43 C53 sing N N 184 GET O43 H43 sing N N 185 GET C83 H831 sing N N 186 GET C83 H832 sing N N 187 GET C83 H833 sing N N 188 GET C53 O53 sing N N 189 GET C53 H531 sing N N 190 GET C53 H532 sing N N 191 HOH O H1 sing N N 192 HOH O H2 sing N N 193 U OP3 P sing N N 194 U OP3 HOP3 sing N N 195 U P OP1 doub N N 196 U P OP2 sing N N 197 U P "O5'" sing N N 198 U OP2 HOP2 sing N N 199 U "O5'" "C5'" sing N N 200 U "C5'" "C4'" sing N N 201 U "C5'" "H5'" sing N N 202 U "C5'" "H5''" sing N N 203 U "C4'" "O4'" sing N N 204 U "C4'" "C3'" sing N N 205 U "C4'" "H4'" sing N N 206 U "O4'" "C1'" sing N N 207 U "C3'" "O3'" sing N N 208 U "C3'" "C2'" sing N N 209 U "C3'" "H3'" sing N N 210 U "O3'" "HO3'" sing N N 211 U "C2'" "O2'" sing N N 212 U "C2'" "C1'" sing N N 213 U "C2'" "H2'" sing N N 214 U "O2'" "HO2'" sing N N 215 U "C1'" N1 sing N N 216 U "C1'" "H1'" sing N N 217 U N1 C2 sing N N 218 U N1 C6 sing N N 219 U C2 O2 doub N N 220 U C2 N3 sing N N 221 U N3 C4 sing N N 222 U N3 H3 sing N N 223 U C4 O4 doub N N 224 U C4 C5 sing N N 225 U C5 C6 doub N N 226 U C5 H5 sing N N 227 U C6 H6 sing N N 228 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7EDM 'double helix' 7EDM 'a-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 3 1_555 B C 23 1_555 -0.315 -0.298 -0.156 -6.437 -0.392 0.351 1 A_G3:C46_B A 3 ? B 46 ? 19 1 1 A C 4 1_555 B G 22 1_555 0.205 -0.192 -0.017 -3.387 -0.532 0.707 2 A_C4:G45_B A 4 ? B 45 ? 19 1 1 A G 5 1_555 B C 21 1_555 -0.393 -0.088 0.045 -3.052 -8.406 0.360 3 A_G5:C44_B A 5 ? B 44 ? 19 1 1 A C 7 1_555 B G 19 1_555 0.037 -0.211 -0.069 -0.303 2.906 -2.532 4 A_C7:G42_B A 7 ? B 42 ? 19 1 1 A C 9 1_555 B G 16 1_555 -0.043 -0.111 0.156 2.885 -10.756 1.268 5 A_C9:G39_B A 9 ? B 39 ? 19 1 1 A G 10 1_555 B C 15 1_555 -0.804 0.039 0.001 -4.918 -17.279 3.938 6 A_G10:C38_B A 10 ? B 38 ? 19 1 1 A U 11 1_555 B A 14 1_555 0.046 -0.151 0.075 -1.755 -21.300 -2.840 7 A_U11:A37_B A 11 ? B 37 ? 20 1 1 A C 12 1_555 B G 13 1_555 0.268 -0.143 0.314 -3.345 -10.015 -5.121 8 A_C12:G36_B A 12 ? B 36 ? 19 1 1 A G 13 1_555 B C 12 1_555 -0.288 -0.256 0.393 1.686 -10.293 2.103 9 A_G13:C35_B A 13 ? B 35 ? 19 1 1 A A 14 1_555 B U 11 1_555 0.469 -0.263 0.358 3.996 -13.156 1.267 10 A_A14:U34_B A 14 ? B 34 ? 20 1 1 A C 15 1_555 B G 10 1_555 0.806 -0.283 0.005 7.849 -19.327 1.665 11 A_C15:G33_B A 15 ? B 33 ? 19 1 1 A G 16 1_555 B C 9 1_555 -0.263 -0.224 -0.016 -6.223 -15.884 -1.393 12 A_G16:C32_B A 16 ? B 32 ? 19 1 1 A G 19 1_555 B C 7 1_555 -0.292 -0.285 -0.048 -2.513 3.573 3.529 13 A_G19:C30_B A 19 ? B 30 ? 19 1 1 A C 21 1_555 B G 5 1_555 0.286 -0.111 -0.056 4.073 -6.050 2.653 14 A_C21:G28_B A 21 ? B 28 ? 19 1 1 A G 22 1_555 B C 4 1_555 -0.051 -0.141 0.237 4.757 2.443 -3.102 15 A_G22:C27_B A 22 ? B 27 ? 19 1 1 A C 23 1_555 B G 3 1_555 0.184 -0.118 -0.495 11.258 2.677 2.655 16 A_C23:G26_B A 23 ? B 26 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 3 1_555 B C 23 1_555 A C 4 1_555 B G 22 1_555 -0.445 -2.107 3.243 -1.109 2.940 30.835 -4.490 0.627 3.047 5.511 2.079 30.991 1 AA_G3C4:G45C46_BB A 3 ? B 46 ? A 4 ? B 45 ? 1 A C 4 1_555 B G 22 1_555 A G 5 1_555 B C 21 1_555 0.621 -1.935 3.217 0.926 4.324 29.009 -4.700 -1.037 2.922 8.568 -1.834 29.337 2 AA_C4G5:C44G45_BB A 4 ? B 45 ? A 5 ? B 44 ? 1 A G 5 1_555 B C 21 1_555 A C 7 1_555 B G 19 1_555 0.374 -3.480 6.548 1.118 -1.583 66.409 -3.049 -0.252 6.625 -1.445 -1.020 66.434 3 AA_G5C7:G42C44_BB A 5 ? B 44 ? A 7 ? B 42 ? 1 A C 9 1_555 B G 16 1_555 A G 10 1_555 B C 15 1_555 0.105 -1.740 3.195 -0.195 13.794 29.767 -5.146 -0.215 2.195 25.216 0.357 32.742 4 AA_C9G10:C38G39_BB A 9 ? B 39 ? A 10 ? B 38 ? 1 A G 10 1_555 B C 15 1_555 A U 11 1_555 B A 14 1_555 -0.418 -1.240 3.138 -1.385 4.034 36.703 -2.469 0.484 3.003 6.380 2.190 36.941 5 AA_G10U11:A37C38_BB A 10 ? B 38 ? A 11 ? B 37 ? 1 A U 11 1_555 B A 14 1_555 A C 12 1_555 B G 13 1_555 -0.025 -1.125 3.340 -3.130 5.284 35.476 -2.570 -0.404 3.137 8.592 5.090 35.987 6 AA_U11C12:G36A37_BB A 11 ? B 37 ? A 12 ? B 36 ? 1 A C 12 1_555 B G 13 1_555 A G 13 1_555 B C 12 1_555 0.268 -1.840 2.802 -0.080 9.893 27.856 -5.215 -0.540 2.042 19.777 0.160 29.528 7 AA_C12G13:C35G36_BB A 12 ? B 36 ? A 13 ? B 35 ? 1 A G 13 1_555 B C 12 1_555 A A 14 1_555 B U 11 1_555 -0.107 -1.229 3.089 1.010 3.308 36.914 -2.344 0.294 2.968 5.209 -1.590 37.070 8 AA_G13A14:U34C35_BB A 13 ? B 35 ? A 14 ? B 34 ? 1 A A 14 1_555 B U 11 1_555 A C 15 1_555 B G 10 1_555 0.276 -1.306 3.045 4.432 6.276 34.201 -3.020 0.143 2.782 10.507 -7.420 35.028 9 AA_A14C15:G33U34_BB A 14 ? B 34 ? A 15 ? B 33 ? 1 A C 15 1_555 B G 10 1_555 A G 16 1_555 B C 9 1_555 -0.283 -1.840 3.410 0.058 14.608 28.506 -5.760 0.524 2.225 27.501 -0.109 31.962 10 AA_C15G16:C32G33_BB A 15 ? B 33 ? A 16 ? B 32 ? 1 A G 19 1_555 B C 7 1_555 A C 21 1_555 B G 5 1_555 -0.307 -3.399 6.450 -0.233 -0.987 63.944 -3.125 0.270 6.498 -0.932 0.220 63.951 11 AA_G19C21:G28C30_BB A 19 ? B 30 ? A 21 ? B 28 ? 1 A C 21 1_555 B G 5 1_555 A G 22 1_555 B C 4 1_555 -1.255 -2.367 3.279 -3.277 -0.590 24.869 -5.269 1.887 3.467 -1.363 7.565 25.087 12 AA_C21G22:C27G28_BB A 21 ? B 28 ? A 22 ? B 27 ? 1 A G 22 1_555 B C 4 1_555 A C 23 1_555 B G 3 1_555 0.848 -1.850 3.144 6.531 5.124 31.750 -4.109 -0.441 2.930 9.171 -11.689 32.790 13 AA_G22C23:G26C27_BB A 22 ? B 27 ? A 23 ? B 26 ? # _pdbx_audit_support.funding_organization 'Ministry of Education, Culture, Sports, Science and Technology (Japan)' _pdbx_audit_support.country Japan _pdbx_audit_support.grant_number 24245037 _pdbx_audit_support.ordinal 1 # loop_ _pdbx_entity_instance_feature.ordinal _pdbx_entity_instance_feature.comp_id _pdbx_entity_instance_feature.asym_id _pdbx_entity_instance_feature.seq_num _pdbx_entity_instance_feature.auth_comp_id _pdbx_entity_instance_feature.auth_asym_id _pdbx_entity_instance_feature.auth_seq_num _pdbx_entity_instance_feature.feature_type _pdbx_entity_instance_feature.details 1 GET ? ? GET ? ? 'SUBJECT OF INVESTIGATION' ? 2 HG ? ? HG ? ? 'SUBJECT OF INVESTIGATION' ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'MERCURY (II) ION' HG 3 GENETICIN GET 4 water HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 4K32 _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? #