data_7EEM # _entry.id 7EEM # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7EEM pdb_00007eem 10.2210/pdb7eem/pdb WWPDB D_1300021303 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7EEM _pdbx_database_status.recvd_initial_deposition_date 2021-03-19 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kondo, J.' 1 0000-0002-5682-3685 'Sekiguchi, S.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'RNA bulged-G motif' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Kondo, J.' 1 0000-0002-5682-3685 primary 'Sekiguchi, S.' 2 ? # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 7EEM _cell.details ? _cell.formula_units_Z ? _cell.length_a 25.132 _cell.length_a_esd ? _cell.length_b 53.316 _cell.length_b_esd ? _cell.length_c 105.639 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7EEM _symmetry.cell_setting ? _symmetry.Int_Tables_number 20 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'C 2 2 21' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (27-MER)' 8744.255 1 ? ? ? ? 2 non-polymer syn 'IRIDIUM ION' 192.217 6 ? ? ? ? 3 water nat water 18.015 4 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code UGCUCCUAGUACGAGAGGACCGGAGUG _entity_poly.pdbx_seq_one_letter_code_can UGCUCCUAGUACGAGAGGACCGGAGUG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 U n 1 2 G n 1 3 C n 1 4 U n 1 5 C n 1 6 C n 1 7 U n 1 8 A n 1 9 G n 1 10 U n 1 11 A n 1 12 C n 1 13 G n 1 14 A n 1 15 G n 1 16 A n 1 17 G n 1 18 G n 1 19 A n 1 20 C n 1 21 C n 1 22 G n 1 23 G n 1 24 A n 1 25 G n 1 26 U n 1 27 G n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 27 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7EEM _struct_ref.pdbx_db_accession 7EEM _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7EEM _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 27 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7EEM _struct_ref_seq.db_align_beg 2647 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 2673 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 2647 _struct_ref_seq.pdbx_auth_seq_align_end 2673 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 IR non-polymer . 'IRIDIUM ION' ? 'Ir 4' 192.217 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7EEM _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.02 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 39.21 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'sodium cacodylate, MPD, hexammine cobalt, potassium chloride' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER X 16M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2018-07-02 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.10567 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'PHOTON FACTORY BEAMLINE BL-17A' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.10567 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL-17A _diffrn_source.pdbx_synchrotron_site 'Photon Factory' # _reflns.B_iso_Wilson_estimate 34.870 _reflns.entry_id 7EEM _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.590 _reflns.d_resolution_low 26.658 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 4239 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.100 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 3.397 _reflns.pdbx_Rmerge_I_obs 0.089 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 10.870 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 1.747 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.106 _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.992 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_all _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split 2.590 2.660 ? 3.970 ? 1054 342 ? 330 96.500 ? ? ? ? 0.374 ? ? ? ? ? ? ? ? 3.194 ? ? ? ? 0.448 ? ? 1 1 0.894 ? ? 2.660 2.730 ? 5.130 ? 987 296 ? 293 99.000 ? ? ? ? 0.278 ? ? ? ? ? ? ? ? 3.369 ? ? ? ? 0.333 ? ? 2 1 0.895 ? ? 2.730 2.810 ? 6.040 ? 1029 298 ? 298 100.000 ? ? ? ? 0.242 ? ? ? ? ? ? ? ? 3.453 ? ? ? ? 0.288 ? ? 3 1 0.941 ? ? 2.810 2.900 ? 6.180 ? 949 288 ? 288 100.000 ? ? ? ? 0.213 ? ? ? ? ? ? ? ? 3.295 ? ? ? ? 0.257 ? ? 4 1 0.955 ? ? 2.900 2.990 ? 7.630 ? 879 283 ? 282 99.600 ? ? ? ? 0.158 ? ? ? ? ? ? ? ? 3.117 ? ? ? ? 0.191 ? ? 5 1 0.970 ? ? 2.990 3.100 ? 8.970 ? 877 270 ? 270 100.000 ? ? ? ? 0.144 ? ? ? ? ? ? ? ? 3.248 ? ? ? ? 0.172 ? ? 6 1 0.977 ? ? 3.100 3.220 ? 10.080 ? 864 257 ? 252 98.100 ? ? ? ? 0.103 ? ? ? ? ? ? ? ? 3.429 ? ? ? ? 0.124 ? ? 7 1 0.988 ? ? 3.220 3.350 ? 11.430 ? 921 257 ? 257 100.000 ? ? ? ? 0.094 ? ? ? ? ? ? ? ? 3.584 ? ? ? ? 0.111 ? ? 8 1 0.992 ? ? 3.350 3.500 ? 12.530 ? 870 239 ? 238 99.600 ? ? ? ? 0.085 ? ? ? ? ? ? ? ? 3.655 ? ? ? ? 0.100 ? ? 9 1 0.993 ? ? 3.500 3.670 ? 12.830 ? 868 245 ? 243 99.200 ? ? ? ? 0.083 ? ? ? ? ? ? ? ? 3.572 ? ? ? ? 0.099 ? ? 10 1 0.990 ? ? 3.670 3.870 ? 14.610 ? 736 205 ? 204 99.500 ? ? ? ? 0.081 ? ? ? ? ? ? ? ? 3.608 ? ? ? ? 0.095 ? ? 11 1 0.992 ? ? 3.870 4.100 ? 14.620 ? 723 211 ? 210 99.500 ? ? ? ? 0.084 ? ? ? ? ? ? ? ? 3.443 ? ? ? ? 0.100 ? ? 12 1 0.985 ? ? 4.100 4.380 ? 15.220 ? 657 193 ? 191 99.000 ? ? ? ? 0.082 ? ? ? ? ? ? ? ? 3.440 ? ? ? ? 0.098 ? ? 13 1 0.984 ? ? 4.380 4.730 ? 15.290 ? 624 182 ? 181 99.500 ? ? ? ? 0.067 ? ? ? ? ? ? ? ? 3.448 ? ? ? ? 0.079 ? ? 14 1 0.993 ? ? 4.730 5.190 ? 16.230 ? 591 177 ? 176 99.400 ? ? ? ? 0.065 ? ? ? ? ? ? ? ? 3.358 ? ? ? ? 0.077 ? ? 15 1 0.989 ? ? 5.190 5.800 ? 15.710 ? 448 154 ? 148 96.100 ? ? ? ? 0.070 ? ? ? ? ? ? ? ? 3.027 ? ? ? ? 0.084 ? ? 16 1 0.985 ? ? 5.800 6.700 ? 16.430 ? 421 127 ? 127 100.000 ? ? ? ? 0.055 ? ? ? ? ? ? ? ? 3.315 ? ? ? ? 0.065 ? ? 17 1 0.991 ? ? 6.700 8.200 ? 17.870 ? 411 112 ? 112 100.000 ? ? ? ? 0.057 ? ? ? ? ? ? ? ? 3.670 ? ? ? ? 0.066 ? ? 18 1 0.993 ? ? 8.200 11.600 ? 18.210 ? 321 89 ? 89 100.000 ? ? ? ? 0.052 ? ? ? ? ? ? ? ? 3.607 ? ? ? ? 0.061 ? ? 19 1 0.994 ? ? 11.600 26.658 ? 18.400 ? 158 48 ? 47 97.900 ? ? ? ? 0.031 ? ? ? ? ? ? ? ? 3.362 ? ? ? ? 0.038 ? ? 20 1 0.998 ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max 228.250 _refine.B_iso_mean 24.1093 _refine.B_iso_min 5.140 _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details 'The Sf file contains friedel pairs under F_plus and F_minus columns.' _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7EEM _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.5930 _refine.ls_d_res_low 26.6580 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 4239 _refine.ls_number_reflns_R_free 417 _refine.ls_number_reflns_R_work 3822 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.0000 _refine.ls_percent_reflns_R_free 9.8400 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.1861 _refine.ls_R_factor_R_free 0.2435 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1796 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.420 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 1Q9A _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 28.4800 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.2300 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id final _refine_hist.details ? _refine_hist.d_res_high 2.5930 _refine_hist.d_res_low 26.6580 _refine_hist.number_atoms_solvent 4 _refine_hist.number_atoms_total 566 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total 26 _refine_hist.pdbx_B_iso_mean_ligand 129.21 _refine_hist.pdbx_B_iso_mean_solvent 23.01 _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 556 _refine_hist.pdbx_number_atoms_ligand 6 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.005 ? 622 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.934 ? 969 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.038 ? 129 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.006 ? 26 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 13.463 ? 308 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 2.5930 2.9675 . . 140 1286 99.0000 . . . 0.3634 0.0000 0.2699 . . . . . . . . . . . 'X-RAY DIFFRACTION' 2.9675 3.7371 . . 144 1256 99.0000 . . . 0.2189 0.0000 0.1568 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.7371 26.6580 . . 133 1280 99.0000 . . . 0.2127 0.0000 0.1614 . . . . . . . . . . . # _struct.entry_id 7EEM _struct.title 'RNA bulged-G motif' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7EEM _struct_keywords.text 'Bulged-G motif, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 2 ? E N N 2 ? F N N 2 ? G N N 2 ? H N N 3 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 A U 26 O2 ? ? A G 2648 A U 2672 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog2 hydrog ? ? A G 2 O6 ? ? ? 1_555 A U 26 N3 ? ? A G 2648 A U 2672 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog3 hydrog ? ? A C 3 N3 A ? ? 1_555 A G 25 N1 A ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 3 N4 A ? ? 1_555 A G 25 O6 A ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 3 O2 A ? ? 1_555 A G 25 N2 A ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A U 4 N3 A ? ? 1_555 A A 24 N1 ? ? A U 2650 A A 2670 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 4 O4 A ? ? 1_555 A A 24 N6 ? ? A U 2650 A A 2670 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 23 N1 ? ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 23 O6 ? ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 23 N2 ? ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 22 N1 ? ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 22 O6 ? ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 22 N2 ? ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 7 O2 ? ? ? 1_555 A C 21 N4 ? ? A U 2653 A C 2667 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog15 hydrog ? ? A U 10 N3 ? ? ? 1_555 A A 19 N7 ? ? A U 2656 A A 2665 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog16 hydrog ? ? A U 10 O2 ? ? ? 1_555 A A 19 N6 ? ? A U 2656 A A 2665 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog17 hydrog ? ? A A 11 N6 ? ? ? 1_555 A G 18 N3 ? ? A A 2657 A G 2664 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog18 hydrog ? ? A A 11 N7 ? ? ? 1_555 A G 18 N2 ? ? A A 2657 A G 2664 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog19 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 2658 A G 2663 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 2658 A G 2663 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 2658 A G 2663 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 13 N2 ? ? ? 1_555 A A 16 N7 ? ? A G 2659 A A 2662 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 7EEM _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.039790 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.018756 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.009466 _atom_sites.fract_transf_vector[1] 0.000000 _atom_sites.fract_transf_vector[2] 0.000000 _atom_sites.fract_transf_vector[3] 0.000000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C IR N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 U 1 2647 2647 U U A . n A 1 2 G 2 2648 2648 G G A . n A 1 3 C 3 2649 2649 C C A . n A 1 4 U 4 2650 2650 U U A . n A 1 5 C 5 2651 2651 C C A . n A 1 6 C 6 2652 2652 C C A . n A 1 7 U 7 2653 2653 U U A . n A 1 8 A 8 2654 2654 A A A . n A 1 9 G 9 2655 2655 G G A . n A 1 10 U 10 2656 2656 U U A . n A 1 11 A 11 2657 2657 A A A . n A 1 12 C 12 2658 2658 C C A . n A 1 13 G 13 2659 2659 G G A . n A 1 14 A 14 2660 2660 A A A . n A 1 15 G 15 2661 2661 G G A . n A 1 16 A 16 2662 2662 A A A . n A 1 17 G 17 2663 2663 G G A . n A 1 18 G 18 2664 2664 G G A . n A 1 19 A 19 2665 2665 A A A . n A 1 20 C 20 2666 2666 C C A . n A 1 21 C 21 2667 2667 C C A . n A 1 22 G 22 2668 2668 G G A . n A 1 23 G 23 2669 2669 G G A . n A 1 24 A 24 2670 2670 A A A . n A 1 25 G 25 2671 2671 G G A . n A 1 26 U 26 2672 2672 U U A . n A 1 27 G 27 2673 ? ? ? A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 IR 1 2701 1 IR IR A . C 2 IR 1 2702 2 IR IR A . D 2 IR 1 2703 3 IR IR A . E 2 IR 1 2704 4 IR IR A . F 2 IR 1 2705 5 IR IR A . G 2 IR 1 2706 6 IR IR A . H 3 HOH 1 2801 1 HOH HOH A . H 3 HOH 2 2802 4 HOH HOH A . H 3 HOH 3 2803 8 HOH HOH A . H 3 HOH 4 2804 7 HOH HOH A . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 140 ? 1 MORE -6 ? 1 'SSA (A^2)' 4580 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2022-03-23 2 'Structure model' 1 1 2023-11-29 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' chem_comp_atom 2 2 'Structure model' chem_comp_bond 3 2 'Structure model' pdbx_initial_refinement_model # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? . 1 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.17.1 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _pdbx_entry_details.entry_id 7EEM _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # _pdbx_unobs_or_zero_occ_residues.id 1 _pdbx_unobs_or_zero_occ_residues.PDB_model_num 1 _pdbx_unobs_or_zero_occ_residues.polymer_flag Y _pdbx_unobs_or_zero_occ_residues.occupancy_flag 1 _pdbx_unobs_or_zero_occ_residues.auth_asym_id A _pdbx_unobs_or_zero_occ_residues.auth_comp_id G _pdbx_unobs_or_zero_occ_residues.auth_seq_id 2673 _pdbx_unobs_or_zero_occ_residues.PDB_ins_code ? _pdbx_unobs_or_zero_occ_residues.label_asym_id A _pdbx_unobs_or_zero_occ_residues.label_comp_id G _pdbx_unobs_or_zero_occ_residues.label_seq_id 27 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 IR IR IR N N 114 U OP3 O N N 115 U P P N N 116 U OP1 O N N 117 U OP2 O N N 118 U "O5'" O N N 119 U "C5'" C N N 120 U "C4'" C N R 121 U "O4'" O N N 122 U "C3'" C N S 123 U "O3'" O N N 124 U "C2'" C N R 125 U "O2'" O N N 126 U "C1'" C N R 127 U N1 N N N 128 U C2 C N N 129 U O2 O N N 130 U N3 N N N 131 U C4 C N N 132 U O4 O N N 133 U C5 C N N 134 U C6 C N N 135 U HOP3 H N N 136 U HOP2 H N N 137 U "H5'" H N N 138 U "H5''" H N N 139 U "H4'" H N N 140 U "H3'" H N N 141 U "HO3'" H N N 142 U "H2'" H N N 143 U "HO2'" H N N 144 U "H1'" H N N 145 U H3 H N N 146 U H5 H N N 147 U H6 H N N 148 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 U OP3 P sing N N 118 U OP3 HOP3 sing N N 119 U P OP1 doub N N 120 U P OP2 sing N N 121 U P "O5'" sing N N 122 U OP2 HOP2 sing N N 123 U "O5'" "C5'" sing N N 124 U "C5'" "C4'" sing N N 125 U "C5'" "H5'" sing N N 126 U "C5'" "H5''" sing N N 127 U "C4'" "O4'" sing N N 128 U "C4'" "C3'" sing N N 129 U "C4'" "H4'" sing N N 130 U "O4'" "C1'" sing N N 131 U "C3'" "O3'" sing N N 132 U "C3'" "C2'" sing N N 133 U "C3'" "H3'" sing N N 134 U "O3'" "HO3'" sing N N 135 U "C2'" "O2'" sing N N 136 U "C2'" "C1'" sing N N 137 U "C2'" "H2'" sing N N 138 U "O2'" "HO2'" sing N N 139 U "C1'" N1 sing N N 140 U "C1'" "H1'" sing N N 141 U N1 C2 sing N N 142 U N1 C6 sing N N 143 U C2 O2 doub N N 144 U C2 N3 sing N N 145 U N3 C4 sing N N 146 U N3 H3 sing N N 147 U C4 O4 doub N N 148 U C4 C5 sing N N 149 U C5 C6 doub N N 150 U C5 H5 sing N N 151 U C6 H6 sing N N 152 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7EEM 'double helix' 7EEM 'a-form double helix' 7EEM tetraloop 7EEM 'mismatched base pair' 7EEM 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 A U 26 1_555 -1.840 -0.362 -0.133 1.590 -6.756 -3.875 1 A_G2648:U2672_A A 2648 ? A 2672 ? 28 1 1 A C 3 1_555 A G 25 1_555 -0.118 -0.434 0.147 10.102 -16.918 -3.066 2 A_C2649:G2671_A A 2649 ? A 2671 ? 19 1 1 A U 4 1_555 A A 24 1_555 -0.190 -0.060 0.038 10.672 -15.111 -0.510 3 A_U2650:A2670_A A 2650 ? A 2670 ? 20 1 1 A C 5 1_555 A G 23 1_555 0.539 -0.111 -0.097 9.221 -16.097 3.621 4 A_C2651:G2669_A A 2651 ? A 2669 ? 19 1 1 A C 6 1_555 A G 22 1_555 0.107 -0.339 0.164 -4.770 -10.046 -4.265 5 A_C2652:G2668_A A 2652 ? A 2668 ? 19 1 1 A U 7 1_555 A C 21 1_555 5.923 -1.982 -0.323 -8.750 -5.034 -19.282 6 A_U2653:C2667_A A 2653 ? A 2667 ? ? ? 1 A U 10 1_555 A A 19 1_555 4.159 -2.056 -0.949 5.505 -14.731 -103.346 7 A_U2656:A2665_A A 2656 ? A 2665 ? 24 4 1 A A 11 1_555 A G 18 1_555 -6.853 -4.000 -0.125 -0.675 -0.987 -3.691 8 A_A2657:G2664_A A 2657 ? A 2664 ? 11 10 1 A C 12 1_555 A G 17 1_555 -0.227 -0.516 -0.140 3.625 -1.032 -5.082 9 A_C2658:G2663_A A 2658 ? A 2663 ? 19 1 1 A G 13 1_555 A A 16 1_555 7.084 -5.050 0.650 21.136 -4.159 -18.174 10 A_G2659:A2662_A A 2659 ? A 2662 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 A U 26 1_555 A C 3 1_555 A G 25 1_555 -0.160 -1.452 3.013 -7.101 6.304 37.743 -2.865 -0.529 2.730 9.561 10.769 38.877 1 AA_G2648C2649:G2671U2672_AA A 2648 ? A 2672 ? A 2649 ? A 2671 ? 1 A C 3 1_555 A G 25 1_555 A U 4 1_555 A A 24 1_555 -0.552 -1.607 3.093 -3.710 9.357 33.590 -3.925 0.419 2.610 15.757 6.248 35.025 2 AA_C2649U2650:A2670G2671_AA A 2649 ? A 2671 ? A 2650 ? A 2670 ? 1 A U 4 1_555 A A 24 1_555 A C 5 1_555 A G 23 1_555 0.179 -1.065 3.308 1.975 5.730 38.867 -2.257 -0.033 3.131 8.548 -2.946 39.319 3 AA_U2650C2651:G2669A2670_AA A 2650 ? A 2670 ? A 2651 ? A 2669 ? 1 A C 5 1_555 A G 23 1_555 A C 6 1_555 A G 22 1_555 -0.534 -1.880 3.496 -0.838 9.583 32.049 -4.839 0.792 2.844 16.888 1.476 33.426 4 AA_C2651C2652:G2668G2669_AA A 2651 ? A 2669 ? A 2652 ? A 2668 ? 1 A C 6 1_555 A G 22 1_555 A U 7 1_555 A C 21 1_555 -0.691 -1.536 3.625 8.629 6.914 54.305 -2.088 1.285 3.286 7.487 -9.346 55.335 5 AA_C2652U2653:C2667G2668_AA A 2652 ? A 2668 ? A 2653 ? A 2667 ? 1 A U 7 1_555 A C 21 1_555 A U 10 1_555 A A 19 1_555 0.958 -0.995 6.057 7.600 -6.727 34.466 0.229 0.527 6.203 -11.059 -12.494 35.886 6 AA_U2653U2656:A2665C2667_AA A 2653 ? A 2667 ? A 2656 ? A 2665 ? 1 A U 10 1_555 A A 19 1_555 A A 11 1_555 A G 18 1_555 5.251 -1.575 3.464 -1.259 3.988 -10.267 0.600 24.803 4.369 -21.169 -6.683 -11.084 7 AA_U2656A2657:G2664A2665_AA A 2656 ? A 2665 ? A 2657 ? A 2664 ? 1 A A 11 1_555 A G 18 1_555 A C 12 1_555 A G 17 1_555 -0.535 -1.250 3.306 -2.326 3.463 54.978 -1.556 0.440 3.246 3.745 2.516 55.124 8 AA_A2657C2658:G2663G2664_AA A 2657 ? A 2664 ? A 2658 ? A 2663 ? 1 A C 12 1_555 A G 17 1_555 A G 13 1_555 A A 16 1_555 -2.373 -0.964 2.876 -5.630 5.857 51.941 -1.434 2.349 2.983 6.641 6.384 52.529 9 AA_C2658G2659:A2662G2663_AA A 2658 ? A 2663 ? A 2659 ? A 2662 ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'IRIDIUM ION' IR 3 water HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 1Q9A _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? #