data_7JJU # _entry.id 7JJU # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.387 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7JJU pdb_00007jju 10.2210/pdb7jju/pdb WWPDB D_1000250957 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2020-09-09 2 'Structure model' 1 1 2020-11-25 3 'Structure model' 1 2 2024-03-06 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 3 'Structure model' chem_comp_atom 3 3 'Structure model' chem_comp_bond 4 3 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 3 'Structure model' '_database_2.pdbx_DOI' 5 3 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7JJU _pdbx_database_status.recvd_initial_deposition_date 2020-07-27 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Steckelberg, A.-L.' 1 ? 'Vicens, Q.' 2 ? 'Auffinger, P.' 3 ? 'Costantino, D.C.' 4 ? 'Nix, J.C.' 5 ? 'Kieft, J.S.' 6 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Rna _citation.journal_id_ASTM RNARFU _citation.journal_id_CSD 2122 _citation.journal_id_ISSN 1469-9001 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 26 _citation.language ? _citation.page_first 1767 _citation.page_last 1776 _citation.title ;The crystal structure of a Polerovirus exoribonuclease-resistant RNA shows how diverse sequences are integrated into a conserved fold. ; _citation.year 2020 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1261/rna.076224.120 _citation.pdbx_database_id_PubMed 32848042 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Steckelberg, A.L.' 1 0000-0001-7988-9946 primary 'Vicens, Q.' 2 0000-0003-3751-530X primary 'Costantino, D.A.' 3 0000-0001-5158-1798 primary 'Nix, J.C.' 4 0000-0002-4041-4975 primary 'Kieft, J.S.' 5 0000-0002-3718-1891 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'Potato leafroll virus xrRNA' 16671.771 2 ? ? ? ? 2 non-polymer syn Guanidinium 60.078 8 ? ? ? ? 3 non-polymer syn 'CACODYLATE ION' 136.989 6 ? ? ? ? 4 non-polymer syn 'IRIDIUM HEXAMMINE ION' 294.400 10 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GTP)GAACUAGCUCAGCAUACACGAGUUGCAAGCAUGGGAAGUUCAAGCCUCG(U23)' _entity_poly.pdbx_seq_one_letter_code_can GGAACUAGCUCAGCAUACACGAGUUGCAAGCAUGGGAAGUUCAAGCCUCGU _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 Guanidinium GZ6 3 'CACODYLATE ION' CAC 4 'IRIDIUM HEXAMMINE ION' IRI # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 A n 1 4 A n 1 5 C n 1 6 U n 1 7 A n 1 8 G n 1 9 C n 1 10 U n 1 11 C n 1 12 A n 1 13 G n 1 14 C n 1 15 A n 1 16 U n 1 17 A n 1 18 C n 1 19 A n 1 20 C n 1 21 G n 1 22 A n 1 23 G n 1 24 U n 1 25 U n 1 26 G n 1 27 C n 1 28 A n 1 29 A n 1 30 G n 1 31 C n 1 32 A n 1 33 U n 1 34 G n 1 35 G n 1 36 G n 1 37 A n 1 38 A n 1 39 G n 1 40 U n 1 41 U n 1 42 C n 1 43 A n 1 44 A n 1 45 G n 1 46 C n 1 47 C n 1 48 U n 1 49 C n 1 50 G n 1 51 U23 n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 51 _pdbx_entity_src_syn.organism_scientific 'Potato leafroll virus' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 12045 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 CAC non-polymer . 'CACODYLATE ION' dimethylarsinate 'C2 H6 As O2 -1' 136.989 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 GZ6 non-polymer . Guanidinium ? 'C H6 N3 1' 60.078 IRI non-polymer . 'IRIDIUM HEXAMMINE ION' ? 'H18 Ir N6 3' 294.400 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 U23 'RNA linking' n ;URIDINE-5'-MONOPHOSPHATE-2',3'-CYCLIC PHOSPHATE ; ? 'C9 H12 N2 O11 P2' 386.146 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 A 4 4 4 A A A . n A 1 5 C 5 5 5 C C A . n A 1 6 U 6 6 6 U U A . n A 1 7 A 7 7 7 A A A . n A 1 8 G 8 8 8 G G A . n A 1 9 C 9 9 9 C C A . n A 1 10 U 10 10 10 U U A . n A 1 11 C 11 11 11 C C A . n A 1 12 A 12 12 12 A A A . n A 1 13 G 13 13 13 G G A . n A 1 14 C 14 14 14 C C A . n A 1 15 A 15 15 15 A A A . n A 1 16 U 16 16 16 U U A . n A 1 17 A 17 17 17 A A A . n A 1 18 C 18 18 18 C C A . n A 1 19 A 19 19 19 A A A . n A 1 20 C 20 20 20 C C A . n A 1 21 G 21 21 21 G G A . n A 1 22 A 22 22 22 A A A . n A 1 23 G 23 23 23 G G A . n A 1 24 U 24 24 24 U U A . n A 1 25 U 25 25 25 U U A . n A 1 26 G 26 26 26 G G A . n A 1 27 C 27 27 27 C C A . n A 1 28 A 28 28 28 A A A . n A 1 29 A 29 29 29 A A A . n A 1 30 G 30 30 30 G G A . n A 1 31 C 31 31 31 C C A . n A 1 32 A 32 32 32 A A A . n A 1 33 U 33 33 33 U U A . n A 1 34 G 34 34 34 G G A . n A 1 35 G 35 35 35 G G A . n A 1 36 G 36 36 36 G G A . n A 1 37 A 37 37 37 A A A . n A 1 38 A 38 38 38 A A A . n A 1 39 G 39 39 39 G G A . n A 1 40 U 40 40 40 U U A . n A 1 41 U 41 41 41 U U A . n A 1 42 C 42 42 42 C C A . n A 1 43 A 43 43 43 A A A . n A 1 44 A 44 44 44 A A A . n A 1 45 G 45 45 45 G G A . n A 1 46 C 46 46 46 C C A . n A 1 47 C 47 47 47 C C A . n A 1 48 U 48 48 48 U U A . n A 1 49 C 49 49 49 C C A . n A 1 50 G 50 50 50 G G A . n A 1 51 U23 51 51 51 U23 UCP A . n B 1 1 GTP 1 1 1 GTP GTP B . n B 1 2 G 2 2 2 G G B . n B 1 3 A 3 3 3 A A B . n B 1 4 A 4 4 4 A A B . n B 1 5 C 5 5 5 C C B . n B 1 6 U 6 6 6 U U B . n B 1 7 A 7 7 7 A A B . n B 1 8 G 8 8 8 G G B . n B 1 9 C 9 9 9 C C B . n B 1 10 U 10 10 10 U U B . n B 1 11 C 11 11 11 C C B . n B 1 12 A 12 12 12 A A B . n B 1 13 G 13 13 13 G G B . n B 1 14 C 14 14 14 C C B . n B 1 15 A 15 15 15 A A B . n B 1 16 U 16 16 16 U U B . n B 1 17 A 17 17 17 A A B . n B 1 18 C 18 18 18 C C B . n B 1 19 A 19 19 19 A A B . n B 1 20 C 20 20 20 C C B . n B 1 21 G 21 21 21 G G B . n B 1 22 A 22 22 22 A A B . n B 1 23 G 23 23 23 G G B . n B 1 24 U 24 24 24 U U B . n B 1 25 U 25 25 25 U U B . n B 1 26 G 26 26 26 G G B . n B 1 27 C 27 27 27 C C B . n B 1 28 A 28 28 28 A A B . n B 1 29 A 29 29 29 A A B . n B 1 30 G 30 30 30 G G B . n B 1 31 C 31 31 31 C C B . n B 1 32 A 32 32 32 A A B . n B 1 33 U 33 33 33 U U B . n B 1 34 G 34 34 34 G G B . n B 1 35 G 35 35 35 G G B . n B 1 36 G 36 36 36 G G B . n B 1 37 A 37 37 37 A A B . n B 1 38 A 38 38 38 A A B . n B 1 39 G 39 39 39 G G B . n B 1 40 U 40 40 40 U U B . n B 1 41 U 41 41 41 U U B . n B 1 42 C 42 42 42 C C B . n B 1 43 A 43 43 43 A A B . n B 1 44 A 44 44 44 A A B . n B 1 45 G 45 45 45 G G B . n B 1 46 C 46 46 46 C C B . n B 1 47 C 47 47 47 C C B . n B 1 48 U 48 48 48 U U B . n B 1 49 C 49 49 49 C C B . n B 1 50 G 50 50 50 G G B . n B 1 51 U23 51 51 51 U23 UCP B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 GZ6 1 101 101 GZ6 GZ6 A . D 2 GZ6 1 102 201 GZ6 GZ6 A . E 2 GZ6 1 103 301 GZ6 GZ6 A . F 2 GZ6 1 104 401 GZ6 GZ6 A . G 3 CAC 1 105 101 CAC CAC A . H 3 CAC 1 106 301 CAC CAC A . I 4 IRI 1 107 101 IRI IR7 A . J 4 IRI 1 108 201 IRI IR7 A . K 4 IRI 1 109 401 IRI IR7 A . L 4 IRI 1 110 801 IRI IR7 A . M 4 IRI 1 111 1001 IRI IR7 A . N 2 GZ6 1 501 501 GZ6 GZ6 B . O 2 GZ6 1 502 601 GZ6 GZ6 B . P 2 GZ6 1 503 701 GZ6 GZ6 B . Q 2 GZ6 1 504 801 GZ6 GZ6 B . R 3 CAC 1 505 201 CAC CAC B . S 3 CAC 1 506 401 CAC CAC B . T 3 CAC 1 507 501 CAC CAC B . U 3 CAC 1 508 601 CAC CAC B . V 4 IRI 1 509 301 IRI IR7 B . W 4 IRI 1 510 501 IRI IR7 B . X 4 IRI 1 511 601 IRI IR7 B . Y 4 IRI 1 512 701 IRI IR7 B . Z 4 IRI 1 513 901 IRI IR7 B . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? 'data processing' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? 20191015 1 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? dev_3885 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? 20191015 3 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? 20191015 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.13_2998 5 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 7JJU _cell.details ? _cell.formula_units_Z ? _cell.length_a 72.190 _cell.length_a_esd ? _cell.length_b 72.190 _cell.length_b_esd ? _cell.length_c 137.140 _cell.length_c_esd ? _cell.volume 714690.861 _cell.volume_esd ? _cell.Z_PDB 16 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7JJU _symmetry.cell_setting ? _symmetry.Int_Tables_number 96 _symmetry.space_group_name_Hall 'P 4nw 2abw' _symmetry.space_group_name_H-M 'P 43 21 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7JJU _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.61 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 52.87 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;1 microL RNA solution (5 mg/mL RNA in 30 mM HEPES pH 7.5, 20 mM MgCl2, 100 mM KCl) + 1 microL crystallization solution (10% 2-methyl-2,4-pentanediol, 40 mM Sodium Cacodylate (pH 6.0), 12 mM Spermine, 150 mM KCl, 100 mM Guanidinium HCl) over a reservoir of 500 microL of 30% 2-methyl-2,4-pentanediol and 100mM Guanidinium HCl. ; _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector CMOS _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'RDI CMOS_8M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2019-09-13 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.9234 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'ALS BEAMLINE 4.2.2' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.9234 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 4.2.2 _diffrn_source.pdbx_synchrotron_site ALS # _reflns.B_iso_Wilson_estimate 63.33 _reflns.entry_id 7JJU _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.604 _reflns.d_resolution_low 49.72 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 11689 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.64 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 41.3 _reflns.pdbx_Rmerge_I_obs 0.09956 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 30.86 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.1008 _reflns.pdbx_Rpim_I_all 0.01561 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 1 _reflns.pdbx_CC_star 1 _reflns.pdbx_R_split ? # _reflns_shell.d_res_high 2.604 _reflns_shell.d_res_low 2.697 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 2.53 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 1135 _reflns_shell.percent_possible_all 99.56 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 1.663 _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 38.0 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all 1.685 _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.914 _reflns_shell.pdbx_CC_star 0.977 _reflns_shell.pdbx_R_split ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 62.95 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7JJU _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.604 _refine.ls_d_res_low 49.72 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 11669 _refine.ls_number_reflns_R_free 1097 _refine.ls_number_reflns_R_work 20043 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.66 _refine.ls_percent_reflns_R_free 5.19 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2261 _refine.ls_R_factor_R_free 0.2534 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2246 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.35 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct SAD _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 33.4161 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.4318 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_analyze.entry_id 7JJU _refine_analyze.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_analyze.Luzzati_coordinate_error_free ? _refine_analyze.Luzzati_coordinate_error_obs 0.43 _refine_analyze.Luzzati_d_res_low_free ? _refine_analyze.Luzzati_d_res_low_obs ? _refine_analyze.Luzzati_sigma_a_free ? _refine_analyze.Luzzati_sigma_a_free_details ? _refine_analyze.Luzzati_sigma_a_obs ? _refine_analyze.Luzzati_sigma_a_obs_details ? _refine_analyze.number_disordered_residues ? _refine_analyze.occupancy_sum_hydrogen ? _refine_analyze.occupancy_sum_non_hydrogen ? _refine_analyze.RG_d_res_high ? _refine_analyze.RG_d_res_low ? _refine_analyze.RG_free ? _refine_analyze.RG_work ? _refine_analyze.RG_free_work_ratio ? _refine_analyze.pdbx_Luzzati_d_res_high_obs ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.604 _refine_hist.d_res_low 49.72 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 2340 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 2162 _refine_hist.pdbx_number_atoms_ligand 178 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0012 ? 2576 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.4406 ? 4058 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0202 ? 504 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0018 ? 110 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 15.5962 ? 1274 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 2.60 2.72 . . 134 2491 99.36 . . . 0.3893 . 0.3792 . . . . . . . . . . . 'X-RAY DIFFRACTION' 2.72 2.87 . . 115 2543 99.77 . . . 0.4180 . 0.3834 . . . . . . . . . . . 'X-RAY DIFFRACTION' 2.87 3.04 . . 123 2521 99.77 . . . 0.3213 . 0.3195 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.05 3.28 . . 141 2512 99.85 . . . 0.2497 . 0.2305 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.28 3.61 . . 163 2483 99.85 . . . 0.2667 . 0.2359 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.61 4.13 . . 142 2488 99.85 . . . 0.2705 . 0.2054 . . . . . . . . . . . 'X-RAY DIFFRACTION' 4.13 5.21 . . 153 2508 99.92 . . . 0.2139 . 0.1868 . . . . . . . . . . . 'X-RAY DIFFRACTION' 5.21 49.72 . . 126 2497 98.87 . . . 0.2118 . 0.1858 . . . . . . . . . . . # _struct.entry_id 7JJU _struct.title 'Crystal structure of en exoribonuclease-resistant RNA (xrRNA) from Potato leafroll virus (PLRV)' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7JJU _struct_keywords.text 'RNA structure viral RNA exonuclease resistance RNA pseudoknot polerovirus plant virus, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 2 ? E N N 2 ? F N N 2 ? G N N 3 ? H N N 3 ? I N N 4 ? J N N 4 ? K N N 4 ? L N N 4 ? M N N 4 ? N N N 2 ? O N N 2 ? P N N 2 ? Q N N 2 ? R N N 3 ? S N N 3 ? T N N 3 ? U N N 3 ? V N N 4 ? W N N 4 ? X N N 4 ? Y N N 4 ? Z N N 4 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7JJU _struct_ref.pdbx_db_accession 7JJU _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 7JJU A 1 ? 51 ? 7JJU 1 ? 51 ? 1 51 2 1 7JJU B 1 ? 51 ? 7JJU 1 ? 51 ? 1 51 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 6930 ? 1 MORE -13 ? 1 'SSA (A^2)' 17760 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J,K,L,M,N,O,P,Q,R,S,T,U,V,W,X,Y,Z # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? A GTP 1 A G 2 1_555 ? ? ? ? ? ? ? 1.554 ? ? covale2 covale both ? A G 50 "O3'" ? ? ? 1_555 A U23 51 P ? ? A G 50 A U23 51 1_555 ? ? ? ? ? ? ? 1.607 ? ? covale3 covale both ? B GTP 1 "O3'" ? ? ? 1_555 B G 2 P ? ? B GTP 1 B G 2 1_555 ? ? ? ? ? ? ? 1.560 ? ? covale4 covale both ? B G 50 "O3'" ? ? ? 1_555 B U23 51 P ? ? B G 50 B U23 51 1_555 ? ? ? ? ? ? ? 1.607 ? ? hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 42 N3 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 42 O2 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 42 N4 ? ? A G 2 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 41 N3 ? ? A A 3 A U 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 41 O4 ? ? A A 3 A U 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 40 N3 ? ? A A 4 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 40 O4 ? ? A A 4 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 39 N1 ? ? A C 5 A G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 39 O6 ? ? A C 5 A G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 39 N2 ? ? A C 5 A G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 6 N3 ? ? ? 1_555 A A 38 N1 ? ? A U 6 A A 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 6 O4 ? ? ? 1_555 A A 38 N6 ? ? A U 6 A A 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 7 N1 ? ? ? 1_555 A G 26 N2 ? ? A A 7 A G 26 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog14 hydrog ? ? A A 7 N6 ? ? ? 1_555 A G 26 N3 ? ? A A 7 A G 26 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog15 hydrog ? ? A A 7 N6 ? ? ? 1_555 B A 44 N1 ? ? A A 7 B A 44 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog16 hydrog ? ? A A 7 N7 ? ? ? 1_555 B A 44 N6 ? ? A A 7 B A 44 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog17 hydrog ? ? A G 8 N1 ? ? ? 1_555 A C 27 N3 ? ? A G 8 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 27 O2 ? ? A G 8 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 8 O6 ? ? ? 1_555 A C 27 N4 ? ? A G 8 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 36 N1 ? ? A C 9 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 36 O6 ? ? A C 9 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 36 N2 ? ? A C 9 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A U 10 N3 ? ? ? 1_555 A G 35 O6 ? ? A U 10 A G 35 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog24 hydrog ? ? A U 10 O2 ? ? ? 1_555 A G 35 N1 ? ? A U 10 A G 35 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog25 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 34 N1 ? ? A C 11 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 34 O6 ? ? A C 11 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 34 N2 ? ? A C 11 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A A 12 N1 ? ? ? 1_555 A U 33 N3 ? ? A A 12 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A A 12 N6 ? ? ? 1_555 A U 33 O4 ? ? A A 12 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 13 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 13 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 13 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 13 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 13 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 13 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 30 N1 ? ? A C 14 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 30 O6 ? ? A C 14 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 30 N2 ? ? A C 14 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A A 19 N1 ? ? ? 1_555 B U23 51 N3 ? ? A A 19 B U23 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A A 19 N6 ? ? ? 1_555 B U23 51 O4 ? ? A A 19 B U23 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 20 N3 ? ? ? 1_555 B G 50 N1 ? ? A C 20 B G 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 20 N4 ? ? ? 1_555 B G 50 O6 ? ? A C 20 B G 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 20 O2 ? ? ? 1_555 B G 50 N2 ? ? A C 20 B G 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 21 N1 ? ? ? 1_555 B C 49 N3 ? ? A G 21 B C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 21 N2 ? ? ? 1_555 B C 49 O2 ? ? A G 21 B C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 21 O6 ? ? ? 1_555 B C 49 N4 ? ? A G 21 B C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A A 22 N1 ? ? ? 1_555 B U 48 N3 ? ? A A 22 B U 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A A 22 N6 ? ? ? 1_555 B U 48 O4 ? ? A A 22 B U 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 23 N1 ? ? ? 1_555 B C 47 N3 ? ? A G 23 B C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 23 N2 ? ? ? 1_555 B C 47 O2 ? ? A G 23 B C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 23 O6 ? ? ? 1_555 B C 47 N4 ? ? A G 23 B C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A U 24 O2 ? ? ? 1_555 A A 32 N6 ? ? A U 24 A A 32 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog50 hydrog ? ? A U 25 N3 ? ? ? 1_555 A A 29 N7 ? ? A U 25 A A 29 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog51 hydrog ? ? A U 25 O2 ? ? ? 1_555 A A 29 N6 ? ? A U 25 A A 29 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog52 hydrog ? ? A A 29 N1 ? ? ? 1_555 B G 45 N2 ? ? A A 29 B G 45 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog53 hydrog ? ? A A 29 N6 ? ? ? 1_555 B G 45 N3 ? ? A A 29 B G 45 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog54 hydrog ? ? A A 44 N1 ? ? ? 1_555 B A 7 N6 ? ? A A 44 B A 7 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog55 hydrog ? ? A A 44 N6 ? ? ? 1_555 B A 7 N7 ? ? A A 44 B A 7 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog56 hydrog ? ? A G 45 N2 ? ? ? 1_555 B A 29 N1 ? ? A G 45 B A 29 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog57 hydrog ? ? A G 45 N3 ? ? ? 1_555 B A 29 N6 ? ? A G 45 B A 29 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog58 hydrog ? ? A C 47 N3 ? ? ? 1_555 B G 23 N1 ? ? A C 47 B G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A C 47 N4 ? ? ? 1_555 B G 23 O6 ? ? A C 47 B G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A C 47 O2 ? ? ? 1_555 B G 23 N2 ? ? A C 47 B G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A U 48 N3 ? ? ? 1_555 B A 22 N1 ? ? A U 48 B A 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A U 48 O4 ? ? ? 1_555 B A 22 N6 ? ? A U 48 B A 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A C 49 N3 ? ? ? 1_555 B G 21 N1 ? ? A C 49 B G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A C 49 N4 ? ? ? 1_555 B G 21 O6 ? ? A C 49 B G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A C 49 O2 ? ? ? 1_555 B G 21 N2 ? ? A C 49 B G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 50 N1 ? ? ? 1_555 B C 20 N3 ? ? A G 50 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A G 50 N2 ? ? ? 1_555 B C 20 O2 ? ? A G 50 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A G 50 O6 ? ? ? 1_555 B C 20 N4 ? ? A G 50 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A U23 51 N3 ? ? ? 1_555 B A 19 N1 ? ? A U23 51 B A 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A U23 51 O4 ? ? ? 1_555 B A 19 N6 ? ? A U23 51 B A 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? B G 2 N1 ? ? ? 1_555 B C 42 N3 ? ? B G 2 B C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? B G 2 N2 ? ? ? 1_555 B C 42 O2 ? ? B G 2 B C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? B G 2 O6 ? ? ? 1_555 B C 42 N4 ? ? B G 2 B C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? B A 3 N1 ? ? ? 1_555 B U 41 N3 ? ? B A 3 B U 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? B A 3 N6 ? ? ? 1_555 B U 41 O4 ? ? B A 3 B U 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? B A 4 N1 ? ? ? 1_555 B U 40 N3 ? ? B A 4 B U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? B A 4 N6 ? ? ? 1_555 B U 40 O4 ? ? B A 4 B U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? B C 5 N3 ? ? ? 1_555 B G 39 N1 ? ? B C 5 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? B C 5 N4 ? ? ? 1_555 B G 39 O6 ? ? B C 5 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? B C 5 O2 ? ? ? 1_555 B G 39 N2 ? ? B C 5 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? B U 6 N3 ? ? ? 1_555 B A 38 N1 ? ? B U 6 B A 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? B U 6 O4 ? ? ? 1_555 B A 38 N6 ? ? B U 6 B A 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? B A 7 N1 ? ? ? 1_555 B G 26 N2 ? ? B A 7 B G 26 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog84 hydrog ? ? B A 7 N6 ? ? ? 1_555 B G 26 N3 ? ? B A 7 B G 26 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog85 hydrog ? ? B G 8 N1 ? ? ? 1_555 B C 27 N3 ? ? B G 8 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? B G 8 N2 ? ? ? 1_555 B C 27 O2 ? ? B G 8 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? B G 8 O6 ? ? ? 1_555 B C 27 N4 ? ? B G 8 B C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? B C 9 N3 ? ? ? 1_555 B G 36 N1 ? ? B C 9 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? B C 9 N4 ? ? ? 1_555 B G 36 O6 ? ? B C 9 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? B C 9 O2 ? ? ? 1_555 B G 36 N2 ? ? B C 9 B G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? B U 10 N3 ? ? ? 1_555 B G 35 O6 ? ? B U 10 B G 35 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog92 hydrog ? ? B U 10 O2 ? ? ? 1_555 B G 35 N1 ? ? B U 10 B G 35 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog93 hydrog ? ? B C 11 N3 ? ? ? 1_555 B G 34 N1 ? ? B C 11 B G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? B C 11 N4 ? ? ? 1_555 B G 34 O6 ? ? B C 11 B G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? B C 11 O2 ? ? ? 1_555 B G 34 N2 ? ? B C 11 B G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? B A 12 N1 ? ? ? 1_555 B U 33 N3 ? ? B A 12 B U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? B A 12 N6 ? ? ? 1_555 B U 33 O4 ? ? B A 12 B U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? B G 13 N1 ? ? ? 1_555 B C 31 N3 ? ? B G 13 B C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? B G 13 N2 ? ? ? 1_555 B C 31 O2 ? ? B G 13 B C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? B G 13 O6 ? ? ? 1_555 B C 31 N4 ? ? B G 13 B C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog101 hydrog ? ? B C 14 N3 ? ? ? 1_555 B G 30 N1 ? ? B C 14 B G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog102 hydrog ? ? B C 14 N4 ? ? ? 1_555 B G 30 O6 ? ? B C 14 B G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog103 hydrog ? ? B C 14 O2 ? ? ? 1_555 B G 30 N2 ? ? B C 14 B G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog104 hydrog ? ? B U 24 O2 ? ? ? 1_555 B A 32 N6 ? ? B U 24 B A 32 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog105 hydrog ? ? B U 25 N3 ? ? ? 1_555 B A 29 N7 ? ? B U 25 B A 29 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog106 hydrog ? ? B U 25 O2 ? ? ? 1_555 B A 29 N6 ? ? B U 25 B A 29 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C3'" A GTP 1 ? ? "O3'" A GTP 1 ? ? P A G 2 ? ? 97.58 119.70 -22.12 1.20 Y 2 1 "O3'" A GTP 1 ? ? P A G 2 ? ? "O5'" A G 2 ? ? 126.50 104.00 22.50 1.90 Y 3 1 "O3'" A GTP 1 ? ? P A G 2 ? ? OP2 A G 2 ? ? 117.60 110.50 7.10 1.10 Y 4 1 "O3'" A GTP 1 ? ? P A G 2 ? ? OP1 A G 2 ? ? 74.13 105.20 -31.07 2.20 Y 5 1 "C3'" B GTP 1 ? ? "O3'" B GTP 1 ? ? P B G 2 ? ? 147.75 119.70 28.05 1.20 Y # loop_ _pdbx_struct_special_symmetry.id _pdbx_struct_special_symmetry.PDB_model_num _pdbx_struct_special_symmetry.auth_asym_id _pdbx_struct_special_symmetry.auth_comp_id _pdbx_struct_special_symmetry.auth_seq_id _pdbx_struct_special_symmetry.PDB_ins_code _pdbx_struct_special_symmetry.label_asym_id _pdbx_struct_special_symmetry.label_comp_id _pdbx_struct_special_symmetry.label_seq_id 1 1 B IRI 511 ? X IRI . 2 1 B IRI 511 ? X IRI . 3 1 B IRI 511 ? X IRI . # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 -y+1/2,x+1/2,z+3/4 3 y+1/2,-x+1/2,z+1/4 4 x+1/2,-y+1/2,-z+1/4 5 -x+1/2,y+1/2,-z+3/4 6 -x,-y,z+1/2 7 y,x,-z 8 -y,-x,-z+1/2 # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x 36.2585465093 _pdbx_refine_tls.origin_y 34.4735384395 _pdbx_refine_tls.origin_z 50.0891628021 _pdbx_refine_tls.T[1][1] 0.371293507091 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] -0.0579352098153 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.0197157645462 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.57778040642 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] 0.0273952723862 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.424772021271 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 1.75714935257 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] -0.0473451211635 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] 2.03503727268 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 0.550821517128 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] 0.186423207295 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 1.22750660508 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] 0.249402707224 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] -0.0550833055514 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] -0.176059854106 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] 0.0172582673651 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] 0.0705787461172 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] 0.0255333603242 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] -0.0374251346067 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] 0.0093560229534 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] -0.376246256221 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id A _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id A _pdbx_refine_tls_group.beg_auth_seq_id 1 _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id A _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id I _pdbx_refine_tls_group.end_auth_seq_id 1001 _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # _pdbx_entry_details.entry_id 7JJU _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 CAC AS AS N N 73 CAC O1 O N N 74 CAC O2 O N N 75 CAC C1 C N N 76 CAC C2 C N N 77 CAC H11 H N N 78 CAC H12 H N N 79 CAC H13 H N N 80 CAC H21 H N N 81 CAC H22 H N N 82 CAC H23 H N N 83 G OP3 O N N 84 G P P N N 85 G OP1 O N N 86 G OP2 O N N 87 G "O5'" O N N 88 G "C5'" C N N 89 G "C4'" C N R 90 G "O4'" O N N 91 G "C3'" C N S 92 G "O3'" O N N 93 G "C2'" C N R 94 G "O2'" O N N 95 G "C1'" C N R 96 G N9 N Y N 97 G C8 C Y N 98 G N7 N Y N 99 G C5 C Y N 100 G C6 C N N 101 G O6 O N N 102 G N1 N N N 103 G C2 C N N 104 G N2 N N N 105 G N3 N N N 106 G C4 C Y N 107 G HOP3 H N N 108 G HOP2 H N N 109 G "H5'" H N N 110 G "H5''" H N N 111 G "H4'" H N N 112 G "H3'" H N N 113 G "HO3'" H N N 114 G "H2'" H N N 115 G "HO2'" H N N 116 G "H1'" H N N 117 G H8 H N N 118 G H1 H N N 119 G H21 H N N 120 G H22 H N N 121 GTP PG P N N 122 GTP O1G O N N 123 GTP O2G O N N 124 GTP O3G O N N 125 GTP O3B O N N 126 GTP PB P N N 127 GTP O1B O N N 128 GTP O2B O N N 129 GTP O3A O N N 130 GTP PA P N N 131 GTP O1A O N N 132 GTP O2A O N N 133 GTP "O5'" O N N 134 GTP "C5'" C N N 135 GTP "C4'" C N R 136 GTP "O4'" O N N 137 GTP "C3'" C N S 138 GTP "O3'" O N N 139 GTP "C2'" C N R 140 GTP "O2'" O N N 141 GTP "C1'" C N R 142 GTP N9 N Y N 143 GTP C8 C Y N 144 GTP N7 N Y N 145 GTP C5 C Y N 146 GTP C6 C N N 147 GTP O6 O N N 148 GTP N1 N N N 149 GTP C2 C N N 150 GTP N2 N N N 151 GTP N3 N N N 152 GTP C4 C Y N 153 GTP HOG2 H N N 154 GTP HOG3 H N N 155 GTP HOB2 H N N 156 GTP HOA2 H N N 157 GTP "H5'" H N N 158 GTP "H5''" H N N 159 GTP "H4'" H N N 160 GTP "H3'" H N N 161 GTP "HO3'" H N N 162 GTP "H2'" H N N 163 GTP "HO2'" H N N 164 GTP "H1'" H N N 165 GTP H8 H N N 166 GTP HN1 H N N 167 GTP HN21 H N N 168 GTP HN22 H N N 169 GZ6 C C N N 170 GZ6 N1 N N N 171 GZ6 N2 N N N 172 GZ6 N3 N N N 173 GZ6 H1 H N N 174 GZ6 H2 H N N 175 GZ6 H3 H N N 176 GZ6 H4 H N N 177 GZ6 H5 H N N 178 GZ6 H6 H N N 179 IRI IR IR N N 180 IRI N1 N N N 181 IRI N2 N N N 182 IRI N3 N N N 183 IRI N4 N N N 184 IRI N5 N N N 185 IRI N6 N N N 186 IRI HN11 H N N 187 IRI HN12 H N N 188 IRI HN13 H N N 189 IRI HN21 H N N 190 IRI HN22 H N N 191 IRI HN23 H N N 192 IRI HN31 H N N 193 IRI HN32 H N N 194 IRI HN33 H N N 195 IRI HN41 H N N 196 IRI HN42 H N N 197 IRI HN43 H N N 198 IRI HN51 H N N 199 IRI HN52 H N N 200 IRI HN53 H N N 201 IRI HN61 H N N 202 IRI HN62 H N N 203 IRI HN63 H N N 204 U OP3 O N N 205 U P P N N 206 U OP1 O N N 207 U OP2 O N N 208 U "O5'" O N N 209 U "C5'" C N N 210 U "C4'" C N R 211 U "O4'" O N N 212 U "C3'" C N S 213 U "O3'" O N N 214 U "C2'" C N R 215 U "O2'" O N N 216 U "C1'" C N R 217 U N1 N N N 218 U C2 C N N 219 U O2 O N N 220 U N3 N N N 221 U C4 C N N 222 U O4 O N N 223 U C5 C N N 224 U C6 C N N 225 U HOP3 H N N 226 U HOP2 H N N 227 U "H5'" H N N 228 U "H5''" H N N 229 U "H4'" H N N 230 U "H3'" H N N 231 U "HO3'" H N N 232 U "H2'" H N N 233 U "HO2'" H N N 234 U "H1'" H N N 235 U H3 H N N 236 U H5 H N N 237 U H6 H N N 238 U23 N1 N N N 239 U23 C2 C N N 240 U23 O2 O N N 241 U23 N3 N N N 242 U23 C4 C N N 243 U23 O4 O N N 244 U23 C5 C N N 245 U23 C6 C N N 246 U23 "C1'" C N R 247 U23 "C2'" C N R 248 U23 "C3'" C N R 249 U23 "O3'" O N N 250 U23 "C4'" C N R 251 U23 "O4'" O N N 252 U23 "C5'" C N N 253 U23 "O5'" O N N 254 U23 "O2'" O N N 255 U23 OP1 O N N 256 U23 OP2 O N N 257 U23 OP5 O N N 258 U23 OP4 O N N 259 U23 P P N N 260 U23 P2 P N N 261 U23 H1 H N N 262 U23 H2 H N N 263 U23 H3 H N N 264 U23 H4 H N N 265 U23 H5 H N N 266 U23 H6 H N N 267 U23 H7 H N N 268 U23 H9 H N N 269 U23 H11 H N N 270 U23 OP3 O N N 271 U23 H12 H N N 272 U23 H13 H N N 273 U23 H8 H N N 274 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 CAC AS O1 doub N N 76 CAC AS O2 sing N N 77 CAC AS C1 sing N N 78 CAC AS C2 sing N N 79 CAC C1 H11 sing N N 80 CAC C1 H12 sing N N 81 CAC C1 H13 sing N N 82 CAC C2 H21 sing N N 83 CAC C2 H22 sing N N 84 CAC C2 H23 sing N N 85 G OP3 P sing N N 86 G OP3 HOP3 sing N N 87 G P OP1 doub N N 88 G P OP2 sing N N 89 G P "O5'" sing N N 90 G OP2 HOP2 sing N N 91 G "O5'" "C5'" sing N N 92 G "C5'" "C4'" sing N N 93 G "C5'" "H5'" sing N N 94 G "C5'" "H5''" sing N N 95 G "C4'" "O4'" sing N N 96 G "C4'" "C3'" sing N N 97 G "C4'" "H4'" sing N N 98 G "O4'" "C1'" sing N N 99 G "C3'" "O3'" sing N N 100 G "C3'" "C2'" sing N N 101 G "C3'" "H3'" sing N N 102 G "O3'" "HO3'" sing N N 103 G "C2'" "O2'" sing N N 104 G "C2'" "C1'" sing N N 105 G "C2'" "H2'" sing N N 106 G "O2'" "HO2'" sing N N 107 G "C1'" N9 sing N N 108 G "C1'" "H1'" sing N N 109 G N9 C8 sing Y N 110 G N9 C4 sing Y N 111 G C8 N7 doub Y N 112 G C8 H8 sing N N 113 G N7 C5 sing Y N 114 G C5 C6 sing N N 115 G C5 C4 doub Y N 116 G C6 O6 doub N N 117 G C6 N1 sing N N 118 G N1 C2 sing N N 119 G N1 H1 sing N N 120 G C2 N2 sing N N 121 G C2 N3 doub N N 122 G N2 H21 sing N N 123 G N2 H22 sing N N 124 G N3 C4 sing N N 125 GTP PG O1G doub N N 126 GTP PG O2G sing N N 127 GTP PG O3G sing N N 128 GTP PG O3B sing N N 129 GTP O2G HOG2 sing N N 130 GTP O3G HOG3 sing N N 131 GTP O3B PB sing N N 132 GTP PB O1B doub N N 133 GTP PB O2B sing N N 134 GTP PB O3A sing N N 135 GTP O2B HOB2 sing N N 136 GTP O3A PA sing N N 137 GTP PA O1A doub N N 138 GTP PA O2A sing N N 139 GTP PA "O5'" sing N N 140 GTP O2A HOA2 sing N N 141 GTP "O5'" "C5'" sing N N 142 GTP "C5'" "C4'" sing N N 143 GTP "C5'" "H5'" sing N N 144 GTP "C5'" "H5''" sing N N 145 GTP "C4'" "O4'" sing N N 146 GTP "C4'" "C3'" sing N N 147 GTP "C4'" "H4'" sing N N 148 GTP "O4'" "C1'" sing N N 149 GTP "C3'" "O3'" sing N N 150 GTP "C3'" "C2'" sing N N 151 GTP "C3'" "H3'" sing N N 152 GTP "O3'" "HO3'" sing N N 153 GTP "C2'" "O2'" sing N N 154 GTP "C2'" "C1'" sing N N 155 GTP "C2'" "H2'" sing N N 156 GTP "O2'" "HO2'" sing N N 157 GTP "C1'" N9 sing N N 158 GTP "C1'" "H1'" sing N N 159 GTP N9 C8 sing Y N 160 GTP N9 C4 sing Y N 161 GTP C8 N7 doub Y N 162 GTP C8 H8 sing N N 163 GTP N7 C5 sing Y N 164 GTP C5 C6 sing N N 165 GTP C5 C4 doub Y N 166 GTP C6 O6 doub N N 167 GTP C6 N1 sing N N 168 GTP N1 C2 sing N N 169 GTP N1 HN1 sing N N 170 GTP C2 N2 sing N N 171 GTP C2 N3 doub N N 172 GTP N2 HN21 sing N N 173 GTP N2 HN22 sing N N 174 GTP N3 C4 sing N N 175 GZ6 N1 C doub N N 176 GZ6 C N3 sing N N 177 GZ6 C N2 sing N N 178 GZ6 N1 H1 sing N N 179 GZ6 N2 H2 sing N N 180 GZ6 N2 H3 sing N N 181 GZ6 N3 H4 sing N N 182 GZ6 N3 H5 sing N N 183 GZ6 N1 H6 sing N N 184 IRI IR N1 sing N N 185 IRI IR N2 sing N N 186 IRI IR N3 sing N N 187 IRI IR N4 sing N N 188 IRI IR N5 sing N N 189 IRI IR N6 sing N N 190 IRI N1 HN11 sing N N 191 IRI N1 HN12 sing N N 192 IRI N1 HN13 sing N N 193 IRI N2 HN21 sing N N 194 IRI N2 HN22 sing N N 195 IRI N2 HN23 sing N N 196 IRI N3 HN31 sing N N 197 IRI N3 HN32 sing N N 198 IRI N3 HN33 sing N N 199 IRI N4 HN41 sing N N 200 IRI N4 HN42 sing N N 201 IRI N4 HN43 sing N N 202 IRI N5 HN51 sing N N 203 IRI N5 HN52 sing N N 204 IRI N5 HN53 sing N N 205 IRI N6 HN61 sing N N 206 IRI N6 HN62 sing N N 207 IRI N6 HN63 sing N N 208 U OP3 P sing N N 209 U OP3 HOP3 sing N N 210 U P OP1 doub N N 211 U P OP2 sing N N 212 U P "O5'" sing N N 213 U OP2 HOP2 sing N N 214 U "O5'" "C5'" sing N N 215 U "C5'" "C4'" sing N N 216 U "C5'" "H5'" sing N N 217 U "C5'" "H5''" sing N N 218 U "C4'" "O4'" sing N N 219 U "C4'" "C3'" sing N N 220 U "C4'" "H4'" sing N N 221 U "O4'" "C1'" sing N N 222 U "C3'" "O3'" sing N N 223 U "C3'" "C2'" sing N N 224 U "C3'" "H3'" sing N N 225 U "O3'" "HO3'" sing N N 226 U "C2'" "O2'" sing N N 227 U "C2'" "C1'" sing N N 228 U "C2'" "H2'" sing N N 229 U "O2'" "HO2'" sing N N 230 U "C1'" N1 sing N N 231 U "C1'" "H1'" sing N N 232 U N1 C2 sing N N 233 U N1 C6 sing N N 234 U C2 O2 doub N N 235 U C2 N3 sing N N 236 U N3 C4 sing N N 237 U N3 H3 sing N N 238 U C4 O4 doub N N 239 U C4 C5 sing N N 240 U C5 C6 doub N N 241 U C5 H5 sing N N 242 U C6 H6 sing N N 243 U23 N1 C2 sing N N 244 U23 N1 C6 sing N N 245 U23 N1 "C1'" sing N N 246 U23 C2 O2 doub N N 247 U23 C2 N3 sing N N 248 U23 N3 C4 sing N N 249 U23 C4 O4 doub N N 250 U23 C4 C5 sing N N 251 U23 C5 C6 doub N N 252 U23 "C1'" "C2'" sing N N 253 U23 "C1'" "O4'" sing N N 254 U23 "C2'" "C3'" sing N N 255 U23 "C2'" "O2'" sing N N 256 U23 "C3'" "O3'" sing N N 257 U23 "C3'" "C4'" sing N N 258 U23 "O3'" P2 sing N N 259 U23 "C4'" "O4'" sing N N 260 U23 "C4'" "C5'" sing N N 261 U23 "C5'" "O5'" sing N N 262 U23 "O5'" P sing N N 263 U23 "O2'" P2 sing N N 264 U23 OP1 P doub N N 265 U23 OP2 P sing N N 266 U23 OP5 P2 doub N N 267 U23 OP4 P2 sing N N 268 U23 N3 H1 sing N N 269 U23 C5 H2 sing N N 270 U23 C6 H3 sing N N 271 U23 "C1'" H4 sing N N 272 U23 "C4'" H5 sing N N 273 U23 "C5'" H6 sing N N 274 U23 "C5'" H7 sing N N 275 U23 OP2 H9 sing N N 276 U23 OP4 H11 sing N N 277 U23 P OP3 sing N N 278 U23 "C2'" H12 sing N N 279 U23 "C3'" H13 sing N N 280 U23 OP3 H8 sing N N 281 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7JJU 'double helix' 7JJU 'a-form double helix' 7JJU 'parallel strands' 7JJU 'bulge loop' 7JJU 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 A C 42 1_555 0.011 0.234 0.035 0.628 -9.798 5.562 1 A_G2:C42_A A 2 ? A 42 ? 19 1 1 A A 3 1_555 A U 41 1_555 -0.150 0.141 0.080 -1.555 -10.601 7.522 2 A_A3:U41_A A 3 ? A 41 ? 20 1 1 A A 4 1_555 A U 40 1_555 -0.154 -0.060 0.306 0.184 -15.254 4.064 3 A_A4:U40_A A 4 ? A 40 ? 20 1 1 A C 5 1_555 A G 39 1_555 0.751 -0.529 0.188 2.663 -22.841 -4.893 4 A_C5:G39_A A 5 ? A 39 ? 19 1 1 A U 6 1_555 A A 38 1_555 0.056 0.023 0.039 -6.619 -16.331 -4.374 5 A_U6:A38_A A 6 ? A 38 ? 20 1 1 A C 9 1_555 A G 36 1_555 -0.337 -0.144 0.404 -3.238 -17.689 -3.983 6 A_C9:G36_A A 9 ? A 36 ? 19 1 1 A U 10 1_555 A G 35 1_555 2.700 -0.507 0.248 -1.354 -10.099 4.881 7 A_U10:G35_A A 10 ? A 35 ? 28 1 1 A C 11 1_555 A G 34 1_555 0.918 -0.370 -0.025 4.969 -11.906 3.623 8 A_C11:G34_A A 11 ? A 34 ? 19 1 1 A A 12 1_555 A U 33 1_555 0.096 -0.241 -0.227 -7.341 -8.204 1.317 9 A_A12:U33_A A 12 ? A 33 ? 20 1 1 A G 13 1_555 A C 31 1_555 -0.373 0.053 0.308 0.360 -7.294 4.267 10 A_G13:C31_A A 13 ? A 31 ? 19 1 1 A C 14 1_555 A G 30 1_555 0.608 -0.031 0.300 19.136 -1.658 2.027 11 A_C14:G30_A A 14 ? A 30 ? 19 1 1 A A 7 1_555 A G 26 1_555 -3.039 3.923 -0.054 -21.227 -7.130 72.449 12 A_A7:G26_A A 7 ? A 26 ? 10 6 1 A A 29 1_555 A U 25 1_555 -4.436 -2.613 0.309 -0.459 13.710 -91.676 13 A_A29:U25_A A 29 ? A 25 ? 24 4 1 A A 32 1_555 A U 24 1_555 -2.085 1.748 0.050 18.450 -9.688 120.433 14 A_A32:U24_A A 32 ? A 24 ? ? ? 1 B C 47 1_555 A G 23 1_555 -0.176 0.032 -0.494 15.551 -15.497 5.918 15 B_C47:G23_A B 47 ? A 23 ? 19 1 1 B U 48 1_555 A A 22 1_555 -0.266 0.097 -0.027 1.433 -4.690 12.024 16 B_U48:A22_A B 48 ? A 22 ? 20 1 1 B C 49 1_555 A G 21 1_555 0.242 0.162 -0.071 1.832 -5.063 9.625 17 B_C49:G21_A B 49 ? A 21 ? 19 1 1 B G 50 1_555 A C 20 1_555 0.111 -0.102 -0.179 -9.489 -12.914 6.941 18 B_G50:C20_A B 50 ? A 20 ? 19 1 1 B U23 51 1_555 A A 19 1_555 0.133 0.013 0.007 -4.285 -10.885 0.580 19 B_U2351:A19_A B 51 ? A 19 ? 20 1 1 A G 8 1_555 A C 27 1_555 0.138 0.091 -0.085 -21.894 -23.131 1.995 20 A_G8:C27_A A 8 ? A 27 ? 19 1 1 B A 7 1_555 B G 26 1_555 -2.988 4.043 0.041 -23.895 -7.203 73.782 21 B_A7:G26_B B 7 ? B 26 ? 10 6 1 B A 29 1_555 B U 25 1_555 -4.715 -2.855 0.423 -1.444 15.888 -89.519 22 B_A29:U25_B B 29 ? B 25 ? 24 4 1 B A 32 1_555 B U 24 1_555 -2.036 1.581 0.085 17.835 -7.268 120.321 23 B_A32:U24_B B 32 ? B 24 ? ? ? 1 A C 47 1_555 B G 23 1_555 -0.049 0.194 -0.337 16.908 -13.978 7.026 24 A_C47:G23_B A 47 ? B 23 ? 19 1 1 A U 48 1_555 B A 22 1_555 -0.509 0.156 -0.058 6.137 -6.772 10.243 25 A_U48:A22_B A 48 ? B 22 ? 20 1 1 A C 49 1_555 B G 21 1_555 0.249 0.163 -0.183 2.736 -5.946 10.337 26 A_C49:G21_B A 49 ? B 21 ? 19 1 1 A G 50 1_555 B C 20 1_555 -0.095 -0.021 -0.215 -10.509 -15.489 7.817 27 A_G50:C20_B A 50 ? B 20 ? 19 1 1 A U23 51 1_555 B A 19 1_555 0.276 -0.027 -0.013 -6.720 -10.068 -1.780 28 A_U2351:A19_B A 51 ? B 19 ? 20 1 1 B G 2 1_555 B C 42 1_555 -0.392 0.058 0.309 -1.375 -6.452 1.059 29 B_G2:C42_B B 2 ? B 42 ? 19 1 1 B A 3 1_555 B U 41 1_555 -0.095 -0.080 0.078 4.135 -12.706 0.718 30 B_A3:U41_B B 3 ? B 41 ? 20 1 1 B A 4 1_555 B U 40 1_555 -0.047 -0.081 0.428 4.989 -17.415 2.479 31 B_A4:U40_B B 4 ? B 40 ? 20 1 1 B C 5 1_555 B G 39 1_555 0.591 -0.448 0.192 1.378 -24.080 -3.970 32 B_C5:G39_B B 5 ? B 39 ? 19 1 1 B U 6 1_555 B A 38 1_555 0.014 -0.011 0.278 -6.742 -12.282 -7.557 33 B_U6:A38_B B 6 ? B 38 ? 20 1 1 B C 9 1_555 B G 36 1_555 -0.327 -0.035 0.217 -0.804 -21.570 -2.996 34 B_C9:G36_B B 9 ? B 36 ? 19 1 1 B U 10 1_555 B G 35 1_555 2.470 -0.529 0.541 -1.011 -10.864 3.653 35 B_U10:G35_B B 10 ? B 35 ? 28 1 1 B C 11 1_555 B G 34 1_555 0.711 -0.329 -0.012 7.684 -13.806 2.852 36 B_C11:G34_B B 11 ? B 34 ? 19 1 1 B A 12 1_555 B U 33 1_555 0.170 -0.161 -0.199 -5.911 -10.265 4.214 37 B_A12:U33_B B 12 ? B 33 ? 20 1 1 B G 13 1_555 B C 31 1_555 -0.146 0.000 0.220 2.029 -4.788 2.657 38 B_G13:C31_B B 13 ? B 31 ? 19 1 1 B C 14 1_555 B G 30 1_555 0.459 -0.011 -0.076 22.191 -5.458 1.938 39 B_C14:G30_B B 14 ? B 30 ? 19 1 1 B G 8 1_555 B C 27 1_555 0.244 0.291 -0.092 -26.370 -21.231 1.534 40 B_G8:C27_B B 8 ? B 27 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 A C 42 1_555 A A 3 1_555 A U 41 1_555 0.055 -1.709 3.404 -1.680 -1.525 29.790 -2.982 -0.474 3.476 -2.961 3.262 29.874 1 AA_G2A3:U41C42_AA A 2 ? A 42 ? A 3 ? A 41 ? 1 A A 3 1_555 A U 41 1_555 A A 4 1_555 A U 40 1_555 -0.513 -1.430 3.160 -1.624 2.321 31.990 -2.983 0.650 3.073 4.201 2.940 32.112 2 AA_A3A4:U40U41_AA A 3 ? A 41 ? A 4 ? A 40 ? 1 A A 4 1_555 A U 40 1_555 A C 5 1_555 A G 39 1_555 -0.706 -1.165 3.124 0.986 3.844 36.660 -2.329 1.241 2.971 6.089 -1.561 36.867 3 AA_A4C5:G39U40_AA A 4 ? A 40 ? A 5 ? A 39 ? 1 A C 5 1_555 A G 39 1_555 A U 6 1_555 A A 38 1_555 0.512 -1.375 3.401 4.555 5.943 35.247 -3.084 -0.170 3.174 9.680 -7.419 36.009 4 AA_C5U6:A38G39_AA A 5 ? A 39 ? A 6 ? A 38 ? 1 A U 6 1_555 A A 38 1_555 A C 9 1_555 A G 36 1_555 -2.441 -1.474 3.692 10.778 -6.977 82.977 -0.919 2.112 3.506 -5.238 -8.092 83.787 5 AA_U6C9:G36A38_AA A 6 ? A 38 ? A 9 ? A 36 ? 1 A C 9 1_555 A G 36 1_555 A U 10 1_555 A G 35 1_555 0.393 -1.190 3.276 1.019 2.182 45.546 -1.725 -0.418 3.226 2.816 -1.315 45.607 6 AA_C9U10:G35G36_AA A 9 ? A 36 ? A 10 ? A 35 ? 1 A U 10 1_555 A G 35 1_555 A C 11 1_555 A G 34 1_555 -0.330 -1.929 2.955 3.114 4.925 24.208 -5.715 1.551 2.458 11.532 -7.292 24.890 7 AA_U10C11:G34G35_AA A 10 ? A 35 ? A 11 ? A 34 ? 1 A C 11 1_555 A G 34 1_555 A A 12 1_555 A U 33 1_555 0.308 -1.638 3.533 2.444 6.205 30.909 -4.198 -0.096 3.166 11.475 -4.520 31.603 8 AA_C11A12:U33G34_AA A 11 ? A 34 ? A 12 ? A 33 ? 1 A A 12 1_555 A U 33 1_555 A G 13 1_555 A C 31 1_555 0.031 -1.634 3.019 -1.172 0.191 29.138 -3.284 -0.297 3.005 0.380 2.329 29.162 9 AA_A12G13:C31U33_AA A 12 ? A 33 ? A 13 ? A 31 ? 1 A G 13 1_555 A C 31 1_555 A C 14 1_555 A G 30 1_555 0.087 -1.026 2.968 -0.599 23.315 33.699 -3.587 -0.179 1.898 35.441 0.911 40.789 10 AA_G13C14:G30C31_AA A 13 ? A 31 ? A 14 ? A 30 ? 1 A A 7 1_555 A G 26 1_555 A A 29 1_555 A U 25 1_555 -1.497 -2.948 -2.526 164.439 -42.758 43.355 -1.831 -0.604 -1.593 -22.179 -85.295 170.623 11 AA_A7A29:U25G26_AA A 7 ? A 26 ? A 29 ? A 25 ? 1 A A 29 1_555 A U 25 1_555 A A 32 1_555 A U 24 1_555 2.966 2.912 -1.818 165.244 -1.511 -27.696 -1.486 -0.518 -3.291 0.807 88.222 -165.682 12 AA_A29A32:U24U25_AA A 29 ? A 25 ? A 32 ? A 24 ? 1 A A 32 1_555 A U 24 1_555 B C 47 1_555 A G 23 1_555 -1.749 -2.887 -0.943 104.351 -138.056 73.538 -1.547 0.799 0.435 -70.139 -53.015 174.440 13 AB_A32C47:G23U24_AA A 32 ? A 24 ? B 47 ? A 23 ? 1 B C 47 1_555 A G 23 1_555 B U 48 1_555 A A 22 1_555 -0.131 -2.212 3.605 -6.179 10.174 29.760 -5.850 -0.878 2.696 18.887 11.469 32.002 14 BB_C47U48:A22G23_AA B 47 ? A 23 ? B 48 ? A 22 ? 1 B U 48 1_555 A A 22 1_555 B C 49 1_555 A G 21 1_555 -0.282 -1.705 3.084 0.795 8.858 31.533 -4.361 0.620 2.518 15.908 -1.429 32.732 15 BB_U48C49:G21A22_AA B 48 ? A 22 ? B 49 ? A 21 ? 1 B C 49 1_555 A G 21 1_555 B G 50 1_555 A C 20 1_555 -0.019 -1.700 3.413 2.453 13.230 27.611 -5.643 0.486 2.360 25.864 -4.795 30.657 16 BB_C49G50:C20G21_AA B 49 ? A 21 ? B 50 ? A 20 ? 1 B G 50 1_555 A C 20 1_555 B U23 51 1_555 A A 19 1_555 0.151 -1.747 3.114 0.868 10.021 28.516 -5.114 -0.137 2.381 19.589 -1.697 30.203 17 BB_G50U2351:A19C20_AA B 50 ? A 20 ? B 51 ? A 19 ? 1 B A 7 1_555 B G 26 1_555 B A 29 1_555 B U 25 1_555 -1.564 -2.926 -2.257 164.602 -41.591 34.422 -1.802 -0.537 -1.434 -21.676 -85.787 170.234 18 BB_A7A29:U25G26_BB B 7 ? B 26 ? B 29 ? B 25 ? 1 B A 29 1_555 B U 25 1_555 B A 32 1_555 B U 24 1_555 2.736 2.981 -1.546 167.142 2.379 -26.580 -1.473 -0.454 -3.060 -1.260 88.509 -167.505 19 BB_A29A32:U24U25_BB B 29 ? B 25 ? B 32 ? B 24 ? 1 B A 32 1_555 B U 24 1_555 A C 47 1_555 B G 23 1_555 -1.797 -2.718 -1.154 105.267 -137.647 56.103 -1.541 0.762 0.398 -70.235 -53.713 174.075 20 BA_A32C47:G23U24_BB B 32 ? B 24 ? A 47 ? B 23 ? 1 A C 47 1_555 B G 23 1_555 A U 48 1_555 B A 22 1_555 -0.153 -2.298 3.472 -4.444 8.769 28.261 -6.207 -0.592 2.649 17.309 8.773 29.889 21 AA_C47U48:A22G23_BB A 47 ? B 23 ? A 48 ? B 22 ? 1 A U 48 1_555 B A 22 1_555 A C 49 1_555 B G 21 1_555 -0.170 -1.769 3.159 1.047 10.836 32.371 -4.532 0.436 2.451 18.785 -1.816 34.106 22 AA_U48C49:G21A22_BB A 48 ? B 22 ? A 49 ? B 21 ? 1 A C 49 1_555 B G 21 1_555 A G 50 1_555 B C 20 1_555 0.089 -1.640 3.451 2.718 14.059 27.389 -5.662 0.332 2.347 27.442 -5.306 30.843 23 AA_C49G50:C20G21_BB A 49 ? B 21 ? A 50 ? B 20 ? 1 A G 50 1_555 B C 20 1_555 A U23 51 1_555 B A 19 1_555 -0.020 -1.713 3.253 -0.119 9.302 28.573 -5.056 0.017 2.580 18.246 0.233 30.020 24 AA_G50U2351:A19C20_BB A 50 ? B 20 ? A 51 ? B 19 ? 1 B G 2 1_555 B C 42 1_555 B A 3 1_555 B U 41 1_555 -0.265 -1.621 3.180 1.728 -0.646 32.535 -2.779 0.765 3.193 -1.151 -3.082 32.586 25 BB_G2A3:U41C42_BB B 2 ? B 42 ? B 3 ? B 41 ? 1 B A 3 1_555 B U 41 1_555 B A 4 1_555 B U 40 1_555 0.006 -1.309 3.152 -1.542 5.015 32.746 -3.082 -0.254 2.921 8.825 2.712 33.152 26 BB_A3A4:U40U41_BB B 3 ? B 41 ? B 4 ? B 40 ? 1 B A 4 1_555 B U 40 1_555 B C 5 1_555 B G 39 1_555 -0.351 -1.223 3.294 2.386 4.218 36.749 -2.481 0.867 3.112 6.655 -3.765 37.056 27 BB_A4C5:G39U40_BB B 4 ? B 40 ? B 5 ? B 39 ? 1 B C 5 1_555 B G 39 1_555 B U 6 1_555 B A 38 1_555 0.251 -1.444 3.330 2.609 4.937 35.276 -3.063 -0.035 3.116 8.083 -4.272 35.702 28 BB_C5U6:A38G39_BB B 5 ? B 39 ? B 6 ? B 38 ? 1 B U 6 1_555 B A 38 1_555 B C 9 1_555 B G 36 1_555 -2.657 -1.511 3.547 11.247 -8.005 84.307 -0.921 2.237 3.346 -5.929 -8.330 85.220 29 BB_U6C9:G36A38_BB B 6 ? B 38 ? B 9 ? B 36 ? 1 B C 9 1_555 B G 36 1_555 B U 10 1_555 B G 35 1_555 0.245 -1.304 3.268 -2.466 3.485 45.704 -1.968 -0.524 3.149 4.476 3.166 45.892 30 BB_C9U10:G35G36_BB B 9 ? B 36 ? B 10 ? B 35 ? 1 B U 10 1_555 B G 35 1_555 B C 11 1_555 B G 34 1_555 -0.268 -1.953 2.866 4.572 2.344 23.828 -5.243 1.838 2.569 5.593 -10.911 24.368 31 BB_U10C11:G34G35_BB B 10 ? B 35 ? B 11 ? B 34 ? 1 B C 11 1_555 B G 34 1_555 B A 12 1_555 B U 33 1_555 0.611 -1.495 3.602 3.298 6.119 32.298 -3.740 -0.476 3.315 10.843 -5.845 33.018 32 BB_C11A12:U33G34_BB B 11 ? B 34 ? B 12 ? B 33 ? 1 B A 12 1_555 B U 33 1_555 B G 13 1_555 B C 31 1_555 -0.062 -1.550 3.008 -0.767 1.820 29.544 -3.381 -0.026 2.910 3.563 1.503 29.609 33 BB_A12G13:C31U33_BB B 12 ? B 33 ? B 13 ? B 31 ? 1 B G 13 1_555 B C 31 1_555 B C 14 1_555 B G 30 1_555 0.226 -0.921 2.957 1.765 22.162 31.813 -3.655 -0.161 1.945 35.525 -2.830 38.646 34 BB_G13C14:G30C31_BB B 13 ? B 31 ? B 14 ? B 30 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R35GM118070 1 'National Institutes of Health/National Institute Of Allergy and Infectious Diseases (NIH/NIAID)' 'United States' R01AI133348 2 'German Research Foundation (DFG)' Germany STE2509/201 3 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' P30GM124169-01 4 'Department of Energy (DOE, United States)' 'United States' DE-AC02-05CH11231 5 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' P30CA046934 6 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' ? 7 # _space_group.name_H-M_alt 'P 43 21 2' _space_group.name_Hall 'P 4nw 2abw' _space_group.IT_number 96 _space_group.crystal_system tetragonal _space_group.id 1 # _atom_sites.entry_id 7JJU _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.013852 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.013852 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.007292 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source AS ? ? 25.88022 7.02060 ? ? 1.67971 31.58991 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? C ? ? 3.54356 2.42580 ? ? 25.62398 1.50364 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? IR ? ? 76.48196 ? ? ? 4.24549 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 4.01032 2.96436 ? ? 19.97189 1.75589 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 4.49882 3.47563 ? ? 15.80542 1.70748 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 9.51135 5.44231 ? ? 1.42069 35.72801 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_