data_7JKI # _entry.id 7JKI # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7JKI pdb_00007jki 10.2210/pdb7jki/pdb WWPDB D_1000250901 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7JKI _pdbx_database_status.recvd_initial_deposition_date 2020-07-28 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Simmons, C.R.' 1 0000-0002-2290-6132 'MacCulloch, T.' 2 0000-0001-5875-3361 'Stephanopoulos, N.' 3 0000-0001-7859-410X 'Yan, H.' 4 0000-0001-7397-9852 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nat Commun' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2041-1723 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 13 _citation.language ? _citation.page_first 3112 _citation.page_last 3112 _citation.title 'The influence of Holliday junction sequence and dynamics on DNA crystal self-assembly.' _citation.year 2022 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41467-022-30779-6 _citation.pdbx_database_id_PubMed 35662248 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Simmons, C.R.' 1 ? primary 'MacCulloch, T.' 2 ? primary 'Krepl, M.' 3 0000-0002-9833-4281 primary 'Matthies, M.' 4 ? primary 'Buchberger, A.' 5 ? primary 'Crawford, I.' 6 ? primary 'Sponer, J.' 7 0000-0001-6558-6186 primary 'Sulc, P.' 8 0000-0003-1565-6769 primary 'Stephanopoulos, N.' 9 0000-0001-7859-410X primary 'Yan, H.' 10 0000-0001-7397-9852 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 7JKI _cell.details ? _cell.formula_units_Z ? _cell.length_a 113.715 _cell.length_a_esd ? _cell.length_b 113.715 _cell.length_b_esd ? _cell.length_c 52.054 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 9 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7JKI _symmetry.cell_setting ? _symmetry.Int_Tables_number 146 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'H 3' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*GP*AP*AP*CP*GP*AP*CP*AP*CP*AP*GP*AP*CP*GP*GP*TP*GP*AP*CP*TP*C)-3') ; 6466.201 1 ? ? ? ? 2 polymer syn ;DNA (5'-D(*TP*CP*GP*AP*GP*TP*CP*A)-3') ; 2426.617 1 ? ? ? ? 3 polymer syn ;DNA (5'-D(P*GP*TP*GP*TP*CP*GP*T)-3') ; 2144.420 1 ? ? ? ? 4 polymer syn ;DNA (5'-D(P*CP*CP*GP*TP*CP*T)-3') ; 1760.179 1 ? ? ? ? 5 non-polymer syn 'MAGNESIUM ION' 24.305 2 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no no ;(DG)(DA)(DA)(DC)(DG)(DA)(DC)(DA)(DC)(DA)(DG)(DA)(DC)(DG)(DG)(DT)(DG)(DA)(DC)(DT) (DC) ; GAACGACACAGACGGTGACTC B ? 2 polydeoxyribonucleotide no no '(DT)(DC)(DG)(DA)(DG)(DT)(DC)(DA)' TCGAGTCA C ? 3 polydeoxyribonucleotide no no '(DG)(DT)(DG)(DT)(DC)(DG)(DT)' GTGTCGT D ? 4 polydeoxyribonucleotide no no '(DC)(DC)(DG)(DT)(DC)(DT)' CCGTCT A ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DA n 1 3 DA n 1 4 DC n 1 5 DG n 1 6 DA n 1 7 DC n 1 8 DA n 1 9 DC n 1 10 DA n 1 11 DG n 1 12 DA n 1 13 DC n 1 14 DG n 1 15 DG n 1 16 DT n 1 17 DG n 1 18 DA n 1 19 DC n 1 20 DT n 1 21 DC n 2 1 DT n 2 2 DC n 2 3 DG n 2 4 DA n 2 5 DG n 2 6 DT n 2 7 DC n 2 8 DA n 3 1 DG n 3 2 DT n 3 3 DG n 3 4 DT n 3 5 DC n 3 6 DG n 3 7 DT n 4 1 DC n 4 2 DC n 4 3 DG n 4 4 DT n 4 5 DC n 4 6 DT n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 21 'synthetic construct' ? 32630 ? 2 1 sample 1 8 'synthetic construct' ? 32630 ? 3 1 sample 1 7 'synthetic construct' ? 32630 ? 4 1 sample 1 6 'synthetic construct' ? 32630 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 7JKI 7JKI ? 1 ? 1 2 PDB 7JKI 7JKI ? 2 ? 1 3 PDB 7JKI 7JKI ? 3 ? 1 4 PDB 7JKI 7JKI ? 4 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 7JKI B 1 ? 21 ? 7JKI 7 ? 27 ? 7 27 2 2 7JKI C 1 ? 8 ? 7JKI 28 ? 35 ? 28 35 3 3 7JKI D 1 ? 7 ? 7JKI 36 ? 42 ? 36 42 4 4 7JKI A 1 ? 6 ? 7JKI 1 ? 6 ? 1 6 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7JKI _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 5.06 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 75.70 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 298 _exptl_crystal_grow.temp_details 'temperature gradient generated from 60 to 25 C at 0.3 degrees per hour' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.5 mL of 0.05 M Cacodylate pH 6.0 with 10 mM MgCl2, 2.5 mM spermine, 5 mM CaCl2, and 10% isopropanol was added to the reservoir with 2 uL added to the drop containing 4 uL of DNA stock ; _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS3 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2019-08-15 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 19-ID' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 19-ID _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate 103.660 _reflns.entry_id 7JKI _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.000 _reflns.d_resolution_low 50.000 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 4711 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 95.500 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 9.700 _reflns.pdbx_Rmerge_I_obs 0.142 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 9.800 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 5.774 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.150 _reflns.pdbx_Rpim_I_all 0.046 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.951 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_all _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split 3.000 3.050 ? ? ? ? ? ? 241 89.600 ? ? ? ? 0.765 ? ? ? ? ? ? ? ? 7.100 ? 0.501 ? ? 0.811 0.262 ? 1 1 0.894 ? ? 3.050 3.110 ? ? ? ? ? ? 222 96.100 ? ? ? ? 0.372 ? ? ? ? ? ? ? ? 7.700 ? 0.828 ? ? 0.392 0.122 ? 2 1 0.988 ? ? 3.110 3.170 ? ? ? ? ? ? 230 97.900 ? ? ? ? 0.246 ? ? ? ? ? ? ? ? 8.300 ? 1.755 ? ? 0.259 0.079 ? 3 1 0.989 ? ? 3.170 3.230 ? ? ? ? ? ? 252 99.600 ? ? ? ? 0.202 ? ? ? ? ? ? ? ? 8.800 ? 2.837 ? ? 0.212 0.066 ? 4 1 0.996 ? ? 3.230 3.300 ? ? ? ? ? ? 241 100.000 ? ? ? ? 0.201 ? ? ? ? ? ? ? ? 9.400 ? 1.892 ? ? 0.211 0.065 ? 5 1 0.990 ? ? 3.300 3.380 ? ? ? ? ? ? 263 99.600 ? ? ? ? 0.166 ? ? ? ? ? ? ? ? 9.600 ? 2.228 ? ? 0.175 0.056 ? 6 1 0.994 ? ? 3.380 3.460 ? ? ? ? ? ? 233 100.000 ? ? ? ? 0.181 ? ? ? ? ? ? ? ? 9.600 ? 2.322 ? ? 0.191 0.059 ? 7 1 0.991 ? ? 3.460 3.560 ? ? ? ? ? ? 258 100.000 ? ? ? ? 0.190 ? ? ? ? ? ? ? ? 9.900 ? 2.444 ? ? 0.200 0.061 ? 8 1 0.991 ? ? 3.560 3.660 ? ? ? ? ? ? 138 56.800 ? ? ? ? 0.289 ? ? ? ? ? ? ? ? 7.300 ? 1.894 ? ? 0.309 0.107 ? 9 1 0.977 ? ? 3.660 3.780 ? ? ? ? ? ? 180 73.200 ? ? ? ? 0.292 ? ? ? ? ? ? ? ? 9.400 ? 1.816 ? ? 0.310 0.102 ? 10 1 0.971 ? ? 3.780 3.910 ? ? ? ? ? ? 245 100.000 ? ? ? ? 0.240 ? ? ? ? ? ? ? ? 10.800 ? 2.032 ? ? 0.252 0.076 ? 11 1 0.977 ? ? 3.910 4.070 ? ? ? ? ? ? 233 100.000 ? ? ? ? 0.179 ? ? ? ? ? ? ? ? 10.800 ? 3.403 ? ? 0.187 0.057 ? 12 1 0.984 ? ? 4.070 4.260 ? ? ? ? ? ? 248 100.000 ? ? ? ? 0.161 ? ? ? ? ? ? ? ? 10.700 ? 3.577 ? ? 0.169 0.051 ? 13 1 0.991 ? ? 4.260 4.480 ? ? ? ? ? ? 253 100.000 ? ? ? ? 0.157 ? ? ? ? ? ? ? ? 10.700 ? 4.267 ? ? 0.165 0.050 ? 14 1 0.988 ? ? 4.480 4.760 ? ? ? ? ? ? 244 99.200 ? ? ? ? 0.162 ? ? ? ? ? ? ? ? 10.500 ? 6.155 ? ? 0.170 0.052 ? 15 1 0.989 ? ? 4.760 5.130 ? ? ? ? ? ? 254 100.000 ? ? ? ? 0.144 ? ? ? ? ? ? ? ? 10.200 ? 7.113 ? ? 0.151 0.047 ? 16 1 0.987 ? ? 5.130 5.640 ? ? ? ? ? ? 249 100.000 ? ? ? ? 0.134 ? ? ? ? ? ? ? ? 10.900 ? 9.258 ? ? 0.140 0.042 ? 17 1 0.990 ? ? 5.640 6.460 ? ? ? ? ? ? 234 100.000 ? ? ? ? 0.118 ? ? ? ? ? ? ? ? 10.600 ? 12.517 ? ? 0.124 0.038 ? 18 1 0.990 ? ? 6.460 8.130 ? ? ? ? ? ? 249 99.600 ? ? ? ? 0.088 ? ? ? ? ? ? ? ? 10.000 ? 13.277 ? ? 0.092 0.029 ? 19 1 0.995 ? ? 8.130 50.000 ? ? ? ? ? ? 244 98.400 ? ? ? ? 0.141 ? ? ? ? ? ? ? ? 10.400 ? 25.961 ? ? 0.148 0.046 ? 20 1 0.982 ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max 225.380 _refine.B_iso_mean 106.2416 _refine.B_iso_min 60.410 _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7JKI _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.0190 _refine.ls_d_res_low 32.8270 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 4597 _refine.ls_number_reflns_R_free 236 _refine.ls_number_reflns_R_work 4361 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 93.1500 _refine.ls_percent_reflns_R_free 5.1300 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2168 _refine.ls_R_factor_R_free 0.2579 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2144 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 2.000 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 5VY6 _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 29.9900 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.2400 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id final _refine_hist.details ? _refine_hist.d_res_high 3.0190 _refine_hist.d_res_low 32.8270 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 857 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total 42 _refine_hist.pdbx_B_iso_mean_ligand 89.76 _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 855 _refine_hist.pdbx_number_atoms_ligand 2 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.005 ? 956 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.709 ? 1467 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.037 ? 166 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.003 ? 42 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 34.623 ? 406 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 3.019 3.8023 . . 112 2038 87.0000 . . . 0.3448 0.0000 0.3191 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.8023 32.827 . . 124 2323 99.0000 . . . 0.2320 0.0000 0.1905 . . . . . . . . . . . # _struct.entry_id 7JKI _struct.title ;Self-assembly of a 3D DNA crystal lattice (4x6 scramble duplex version) containing the J7 immobile Holliday junction with R3 symmetry ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7JKI _struct_keywords.text 'Structural DNA nanotechnology, immobile Holliday junctions, 3D DNA self-assembly, designer DNA crystals, DNA' _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 5 ? F N N 5 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DA 2 N6 ? ? ? 1_555 C DT 7 O4 ? ? B DA 8 D DT 42 1_555 ? ? ? ? ? ? 'DA-DT PAIR' ? ? ? hydrog2 hydrog ? ? A DA 3 N1 ? ? ? 1_555 C DT 7 N3 ? ? B DA 9 D DT 42 1_555 ? ? ? ? ? ? 'DA-DT PAIR' ? ? ? hydrog3 hydrog ? ? A DC 4 N3 ? ? ? 1_555 C DG 6 N1 ? ? B DC 10 D DG 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DC 4 N4 ? ? ? 1_555 C DG 6 O6 ? ? B DC 10 D DG 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DC 4 O2 ? ? ? 1_555 C DG 6 N2 ? ? B DC 10 D DG 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DG 5 N1 ? ? ? 1_555 C DC 5 N3 ? ? B DG 11 D DC 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DG 5 N2 ? ? ? 1_555 C DC 5 O2 ? ? B DG 11 D DC 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DG 5 O6 ? ? ? 1_555 C DC 5 N4 ? ? B DG 11 D DC 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DA 6 N1 ? ? ? 1_555 C DT 4 N3 ? ? B DA 12 D DT 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DA 6 N6 ? ? ? 1_555 C DT 4 O4 ? ? B DA 12 D DT 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DC 7 N3 ? ? ? 1_555 C DG 3 N1 ? ? B DC 13 D DG 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DC 7 N4 ? ? ? 1_555 C DG 3 O6 ? ? B DC 13 D DG 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DC 7 O2 ? ? ? 1_555 C DG 3 N2 ? ? B DC 13 D DG 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DA 8 N1 ? ? ? 1_555 C DT 2 N3 ? ? B DA 14 D DT 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DA 8 N6 ? ? ? 1_555 C DT 2 O4 ? ? B DA 14 D DT 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 9 N3 ? ? ? 1_555 C DG 1 N1 ? ? B DC 15 D DG 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DC 9 N4 ? ? ? 1_555 C DG 1 O6 ? ? B DC 15 D DG 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DC 9 O2 ? ? ? 1_555 C DG 1 N2 ? ? B DC 15 D DG 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DA 10 N1 ? ? ? 1_555 D DT 6 N3 ? ? B DA 16 A DT 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DA 10 N6 ? ? ? 1_555 D DT 6 O4 ? ? B DA 16 A DT 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DG 11 N1 ? ? ? 1_555 D DC 5 N3 ? ? B DG 17 A DC 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DG 11 N2 ? ? ? 1_555 D DC 5 O2 ? ? B DG 17 A DC 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DG 11 O6 ? ? ? 1_555 D DC 5 N4 ? ? B DG 17 A DC 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DA 12 N1 ? ? ? 1_555 D DT 4 N3 ? ? B DA 18 A DT 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DA 12 N6 ? ? ? 1_555 D DT 4 O4 ? ? B DA 18 A DT 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DC 13 N3 ? ? ? 1_555 D DG 3 N1 ? ? B DC 19 A DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DC 13 N4 ? ? ? 1_555 D DG 3 O6 ? ? B DC 19 A DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DC 13 O2 ? ? ? 1_555 D DG 3 N2 ? ? B DC 19 A DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DG 14 N1 ? ? ? 1_555 D DC 2 N3 ? ? B DG 20 A DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A DG 14 N2 ? ? ? 1_555 D DC 2 O2 ? ? B DG 20 A DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A DG 14 O6 ? ? ? 1_555 D DC 2 N4 ? ? B DG 20 A DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A DG 15 N1 ? ? ? 1_555 D DC 1 N3 ? ? B DG 21 A DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DG 15 N2 ? ? ? 1_555 D DC 1 O2 ? ? B DG 21 A DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DG 15 O6 ? ? ? 1_555 D DC 1 N4 ? ? B DG 21 A DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DT 16 N3 ? ? ? 1_555 B DA 8 N1 ? ? B DT 22 C DA 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DT 16 O4 ? ? ? 1_555 B DA 8 N6 ? ? B DT 22 C DA 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DG 17 N1 ? ? ? 1_555 B DC 7 N3 ? ? B DG 23 C DC 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DG 17 N2 ? ? ? 1_555 B DC 7 O2 ? ? B DG 23 C DC 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DG 17 O6 ? ? ? 1_555 B DC 7 N4 ? ? B DG 23 C DC 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DA 18 N1 ? ? ? 1_555 B DT 6 N3 ? ? B DA 24 C DT 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DA 18 N6 ? ? ? 1_555 B DT 6 O4 ? ? B DA 24 C DT 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DC 19 N3 ? ? ? 1_555 B DG 5 N1 ? ? B DC 25 C DG 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DC 19 N4 ? ? ? 1_555 B DG 5 O6 ? ? B DC 25 C DG 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DC 19 O2 ? ? ? 1_555 B DG 5 N2 ? ? B DC 25 C DG 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A DT 20 N3 ? ? ? 1_555 B DA 4 N1 ? ? B DT 26 C DA 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A DT 20 O4 ? ? ? 1_555 B DA 4 N6 ? ? B DT 26 C DA 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A DC 21 N3 ? ? ? 1_555 B DG 3 N1 ? ? B DC 27 C DG 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A DC 21 N4 ? ? ? 1_555 B DG 3 O6 ? ? B DC 27 C DG 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A DC 21 O2 ? ? ? 1_555 B DG 3 N2 ? ? B DC 27 C DG 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 7JKI _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.008794 _atom_sites.fract_transf_matrix[1][2] 0.005077 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.010154 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.019211 _atom_sites.fract_transf_vector[1] 0.000000 _atom_sites.fract_transf_vector[2] 0.000000 _atom_sites.fract_transf_vector[3] 0.000000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 7 7 DG DG B . n A 1 2 DA 2 8 8 DA DA B . n A 1 3 DA 3 9 9 DA DA B . n A 1 4 DC 4 10 10 DC DC B . n A 1 5 DG 5 11 11 DG DG B . n A 1 6 DA 6 12 12 DA DA B . n A 1 7 DC 7 13 13 DC DC B . n A 1 8 DA 8 14 14 DA DA B . n A 1 9 DC 9 15 15 DC DC B . n A 1 10 DA 10 16 16 DA DA B . n A 1 11 DG 11 17 17 DG DG B . n A 1 12 DA 12 18 18 DA DA B . n A 1 13 DC 13 19 19 DC DC B . n A 1 14 DG 14 20 20 DG DG B . n A 1 15 DG 15 21 21 DG DG B . n A 1 16 DT 16 22 22 DT DT B . n A 1 17 DG 17 23 23 DG DG B . n A 1 18 DA 18 24 24 DA DA B . n A 1 19 DC 19 25 25 DC DC B . n A 1 20 DT 20 26 26 DT DT B . n A 1 21 DC 21 27 27 DC DC B . n B 2 1 DT 1 28 28 DT DT C . n B 2 2 DC 2 29 29 DC DC C . n B 2 3 DG 3 30 30 DG DG C . n B 2 4 DA 4 31 31 DA DA C . n B 2 5 DG 5 32 32 DG DG C . n B 2 6 DT 6 33 33 DT DT C . n B 2 7 DC 7 34 34 DC DC C . n B 2 8 DA 8 35 35 DA DA C . n C 3 1 DG 1 36 36 DG DG D . n C 3 2 DT 2 37 37 DT DT D . n C 3 3 DG 3 38 38 DG DG D . n C 3 4 DT 4 39 39 DT DT D . n C 3 5 DC 5 40 40 DC DC D . n C 3 6 DG 6 41 41 DG DG D . n C 3 7 DT 7 42 42 DT DT D . n D 4 1 DC 1 1 1 DC DC A . n D 4 2 DC 2 2 2 DC DC A . n D 4 3 DG 3 3 3 DG DG A . n D 4 4 DT 4 4 4 DT DT A . n D 4 5 DC 5 5 5 DC DC A . n D 4 6 DT 6 6 6 DT DT A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code E 5 MG 1 101 2 MG MG B . F 5 MG 1 101 1 MG MG A . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details tetrameric _pdbx_struct_assembly.oligomeric_count 4 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 2400 ? 1 MORE -17 ? 1 'SSA (A^2)' 7950 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2021-07-14 2 'Structure model' 1 1 2022-07-06 3 'Structure model' 1 2 2023-10-18 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 2 'Structure model' database_2 4 3 'Structure model' chem_comp_atom 5 3 'Structure model' chem_comp_bond 6 3 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_CSD' 4 2 'Structure model' '_citation.journal_id_ISSN' 5 2 'Structure model' '_citation.journal_volume' 6 2 'Structure model' '_citation.page_first' 7 2 'Structure model' '_citation.page_last' 8 2 'Structure model' '_citation.pdbx_database_id_DOI' 9 2 'Structure model' '_citation.pdbx_database_id_PubMed' 10 2 'Structure model' '_citation.title' 11 2 'Structure model' '_citation.year' 12 2 'Structure model' '_database_2.pdbx_DOI' 13 2 'Structure model' '_database_2.pdbx_database_accession' # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 2 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.11.1_2575 3 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? 3.25 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 5 # _pdbx_entry_details.entry_id 7JKI _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 "O4'" _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 DT _pdbx_validate_rmsd_angle.auth_seq_id_1 6 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 "C1'" _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 DT _pdbx_validate_rmsd_angle.auth_seq_id_2 6 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 N1 _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 DT _pdbx_validate_rmsd_angle.auth_seq_id_3 6 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 111.16 _pdbx_validate_rmsd_angle.angle_target_value 108.30 _pdbx_validate_rmsd_angle.angle_deviation 2.86 _pdbx_validate_rmsd_angle.angle_standard_deviation 0.30 _pdbx_validate_rmsd_angle.linker_flag N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal DA OP3 O N N 1 DA P P N N 2 DA OP1 O N N 3 DA OP2 O N N 4 DA "O5'" O N N 5 DA "C5'" C N N 6 DA "C4'" C N R 7 DA "O4'" O N N 8 DA "C3'" C N S 9 DA "O3'" O N N 10 DA "C2'" C N N 11 DA "C1'" C N R 12 DA N9 N Y N 13 DA C8 C Y N 14 DA N7 N Y N 15 DA C5 C Y N 16 DA C6 C Y N 17 DA N6 N N N 18 DA N1 N Y N 19 DA C2 C Y N 20 DA N3 N Y N 21 DA C4 C Y N 22 DA HOP3 H N N 23 DA HOP2 H N N 24 DA "H5'" H N N 25 DA "H5''" H N N 26 DA "H4'" H N N 27 DA "H3'" H N N 28 DA "HO3'" H N N 29 DA "H2'" H N N 30 DA "H2''" H N N 31 DA "H1'" H N N 32 DA H8 H N N 33 DA H61 H N N 34 DA H62 H N N 35 DA H2 H N N 36 DC OP3 O N N 37 DC P P N N 38 DC OP1 O N N 39 DC OP2 O N N 40 DC "O5'" O N N 41 DC "C5'" C N N 42 DC "C4'" C N R 43 DC "O4'" O N N 44 DC "C3'" C N S 45 DC "O3'" O N N 46 DC "C2'" C N N 47 DC "C1'" C N R 48 DC N1 N N N 49 DC C2 C N N 50 DC O2 O N N 51 DC N3 N N N 52 DC C4 C N N 53 DC N4 N N N 54 DC C5 C N N 55 DC C6 C N N 56 DC HOP3 H N N 57 DC HOP2 H N N 58 DC "H5'" H N N 59 DC "H5''" H N N 60 DC "H4'" H N N 61 DC "H3'" H N N 62 DC "HO3'" H N N 63 DC "H2'" H N N 64 DC "H2''" H N N 65 DC "H1'" H N N 66 DC H41 H N N 67 DC H42 H N N 68 DC H5 H N N 69 DC H6 H N N 70 DG OP3 O N N 71 DG P P N N 72 DG OP1 O N N 73 DG OP2 O N N 74 DG "O5'" O N N 75 DG "C5'" C N N 76 DG "C4'" C N R 77 DG "O4'" O N N 78 DG "C3'" C N S 79 DG "O3'" O N N 80 DG "C2'" C N N 81 DG "C1'" C N R 82 DG N9 N Y N 83 DG C8 C Y N 84 DG N7 N Y N 85 DG C5 C Y N 86 DG C6 C N N 87 DG O6 O N N 88 DG N1 N N N 89 DG C2 C N N 90 DG N2 N N N 91 DG N3 N N N 92 DG C4 C Y N 93 DG HOP3 H N N 94 DG HOP2 H N N 95 DG "H5'" H N N 96 DG "H5''" H N N 97 DG "H4'" H N N 98 DG "H3'" H N N 99 DG "HO3'" H N N 100 DG "H2'" H N N 101 DG "H2''" H N N 102 DG "H1'" H N N 103 DG H8 H N N 104 DG H1 H N N 105 DG H21 H N N 106 DG H22 H N N 107 DT OP3 O N N 108 DT P P N N 109 DT OP1 O N N 110 DT OP2 O N N 111 DT "O5'" O N N 112 DT "C5'" C N N 113 DT "C4'" C N R 114 DT "O4'" O N N 115 DT "C3'" C N S 116 DT "O3'" O N N 117 DT "C2'" C N N 118 DT "C1'" C N R 119 DT N1 N N N 120 DT C2 C N N 121 DT O2 O N N 122 DT N3 N N N 123 DT C4 C N N 124 DT O4 O N N 125 DT C5 C N N 126 DT C7 C N N 127 DT C6 C N N 128 DT HOP3 H N N 129 DT HOP2 H N N 130 DT "H5'" H N N 131 DT "H5''" H N N 132 DT "H4'" H N N 133 DT "H3'" H N N 134 DT "HO3'" H N N 135 DT "H2'" H N N 136 DT "H2''" H N N 137 DT "H1'" H N N 138 DT H3 H N N 139 DT H71 H N N 140 DT H72 H N N 141 DT H73 H N N 142 DT H6 H N N 143 MG MG MG N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal DA OP3 P sing N N 1 DA OP3 HOP3 sing N N 2 DA P OP1 doub N N 3 DA P OP2 sing N N 4 DA P "O5'" sing N N 5 DA OP2 HOP2 sing N N 6 DA "O5'" "C5'" sing N N 7 DA "C5'" "C4'" sing N N 8 DA "C5'" "H5'" sing N N 9 DA "C5'" "H5''" sing N N 10 DA "C4'" "O4'" sing N N 11 DA "C4'" "C3'" sing N N 12 DA "C4'" "H4'" sing N N 13 DA "O4'" "C1'" sing N N 14 DA "C3'" "O3'" sing N N 15 DA "C3'" "C2'" sing N N 16 DA "C3'" "H3'" sing N N 17 DA "O3'" "HO3'" sing N N 18 DA "C2'" "C1'" sing N N 19 DA "C2'" "H2'" sing N N 20 DA "C2'" "H2''" sing N N 21 DA "C1'" N9 sing N N 22 DA "C1'" "H1'" sing N N 23 DA N9 C8 sing Y N 24 DA N9 C4 sing Y N 25 DA C8 N7 doub Y N 26 DA C8 H8 sing N N 27 DA N7 C5 sing Y N 28 DA C5 C6 sing Y N 29 DA C5 C4 doub Y N 30 DA C6 N6 sing N N 31 DA C6 N1 doub Y N 32 DA N6 H61 sing N N 33 DA N6 H62 sing N N 34 DA N1 C2 sing Y N 35 DA C2 N3 doub Y N 36 DA C2 H2 sing N N 37 DA N3 C4 sing Y N 38 DC OP3 P sing N N 39 DC OP3 HOP3 sing N N 40 DC P OP1 doub N N 41 DC P OP2 sing N N 42 DC P "O5'" sing N N 43 DC OP2 HOP2 sing N N 44 DC "O5'" "C5'" sing N N 45 DC "C5'" "C4'" sing N N 46 DC "C5'" "H5'" sing N N 47 DC "C5'" "H5''" sing N N 48 DC "C4'" "O4'" sing N N 49 DC "C4'" "C3'" sing N N 50 DC "C4'" "H4'" sing N N 51 DC "O4'" "C1'" sing N N 52 DC "C3'" "O3'" sing N N 53 DC "C3'" "C2'" sing N N 54 DC "C3'" "H3'" sing N N 55 DC "O3'" "HO3'" sing N N 56 DC "C2'" "C1'" sing N N 57 DC "C2'" "H2'" sing N N 58 DC "C2'" "H2''" sing N N 59 DC "C1'" N1 sing N N 60 DC "C1'" "H1'" sing N N 61 DC N1 C2 sing N N 62 DC N1 C6 sing N N 63 DC C2 O2 doub N N 64 DC C2 N3 sing N N 65 DC N3 C4 doub N N 66 DC C4 N4 sing N N 67 DC C4 C5 sing N N 68 DC N4 H41 sing N N 69 DC N4 H42 sing N N 70 DC C5 C6 doub N N 71 DC C5 H5 sing N N 72 DC C6 H6 sing N N 73 DG OP3 P sing N N 74 DG OP3 HOP3 sing N N 75 DG P OP1 doub N N 76 DG P OP2 sing N N 77 DG P "O5'" sing N N 78 DG OP2 HOP2 sing N N 79 DG "O5'" "C5'" sing N N 80 DG "C5'" "C4'" sing N N 81 DG "C5'" "H5'" sing N N 82 DG "C5'" "H5''" sing N N 83 DG "C4'" "O4'" sing N N 84 DG "C4'" "C3'" sing N N 85 DG "C4'" "H4'" sing N N 86 DG "O4'" "C1'" sing N N 87 DG "C3'" "O3'" sing N N 88 DG "C3'" "C2'" sing N N 89 DG "C3'" "H3'" sing N N 90 DG "O3'" "HO3'" sing N N 91 DG "C2'" "C1'" sing N N 92 DG "C2'" "H2'" sing N N 93 DG "C2'" "H2''" sing N N 94 DG "C1'" N9 sing N N 95 DG "C1'" "H1'" sing N N 96 DG N9 C8 sing Y N 97 DG N9 C4 sing Y N 98 DG C8 N7 doub Y N 99 DG C8 H8 sing N N 100 DG N7 C5 sing Y N 101 DG C5 C6 sing N N 102 DG C5 C4 doub Y N 103 DG C6 O6 doub N N 104 DG C6 N1 sing N N 105 DG N1 C2 sing N N 106 DG N1 H1 sing N N 107 DG C2 N2 sing N N 108 DG C2 N3 doub N N 109 DG N2 H21 sing N N 110 DG N2 H22 sing N N 111 DG N3 C4 sing N N 112 DT OP3 P sing N N 113 DT OP3 HOP3 sing N N 114 DT P OP1 doub N N 115 DT P OP2 sing N N 116 DT P "O5'" sing N N 117 DT OP2 HOP2 sing N N 118 DT "O5'" "C5'" sing N N 119 DT "C5'" "C4'" sing N N 120 DT "C5'" "H5'" sing N N 121 DT "C5'" "H5''" sing N N 122 DT "C4'" "O4'" sing N N 123 DT "C4'" "C3'" sing N N 124 DT "C4'" "H4'" sing N N 125 DT "O4'" "C1'" sing N N 126 DT "C3'" "O3'" sing N N 127 DT "C3'" "C2'" sing N N 128 DT "C3'" "H3'" sing N N 129 DT "O3'" "HO3'" sing N N 130 DT "C2'" "C1'" sing N N 131 DT "C2'" "H2'" sing N N 132 DT "C2'" "H2''" sing N N 133 DT "C1'" N1 sing N N 134 DT "C1'" "H1'" sing N N 135 DT N1 C2 sing N N 136 DT N1 C6 sing N N 137 DT C2 O2 doub N N 138 DT C2 N3 sing N N 139 DT N3 C4 sing N N 140 DT N3 H3 sing N N 141 DT C4 O4 doub N N 142 DT C4 C5 sing N N 143 DT C5 C7 sing N N 144 DT C5 C6 doub N N 145 DT C7 H71 sing N N 146 DT C7 H72 sing N N 147 DT C7 H73 sing N N 148 DT C6 H6 sing N N 149 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7JKI 'double helix' 7JKI 'a-form double helix' 7JKI 'b-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DA 3 1_555 C DT 7 1_555 0.977 0.305 1.233 14.437 -15.047 8.448 1 B_DA9:DT42_D B 9 ? D 42 ? ? ? 1 A DC 4 1_555 C DG 6 1_555 -0.252 -0.238 0.219 9.258 -14.871 -3.618 2 B_DC10:DG41_D B 10 ? D 41 ? 19 1 1 A DG 5 1_555 C DC 5 1_555 0.604 0.003 0.389 4.259 -15.576 -5.812 3 B_DG11:DC40_D B 11 ? D 40 ? 19 1 1 A DA 6 1_555 C DT 4 1_555 0.117 0.026 0.086 1.443 -17.609 -8.528 4 B_DA12:DT39_D B 12 ? D 39 ? 20 1 1 A DC 7 1_555 C DG 3 1_555 -0.792 0.092 0.265 4.458 -11.314 -3.362 5 B_DC13:DG38_D B 13 ? D 38 ? 19 1 1 A DA 8 1_555 C DT 2 1_555 -0.447 0.126 0.306 -7.710 -18.520 -8.760 6 B_DA14:DT37_D B 14 ? D 37 ? 20 1 1 A DC 9 1_555 C DG 1 1_555 -0.132 -0.115 0.706 -7.703 -18.966 -3.618 7 B_DC15:DG36_D B 15 ? D 36 ? 19 1 1 A DA 10 1_555 D DT 6 1_555 -0.159 0.173 0.225 -1.647 3.011 0.406 8 B_DA16:DT6_A B 16 ? A 6 ? 20 1 1 A DG 11 1_555 D DC 5 1_555 -0.114 -0.150 0.468 9.532 -1.085 4.191 9 B_DG17:DC5_A B 17 ? A 5 ? 19 1 1 A DA 12 1_555 D DT 4 1_555 1.076 0.012 0.613 6.858 -9.853 -5.605 10 B_DA18:DT4_A B 18 ? A 4 ? 20 1 1 A DC 13 1_555 D DG 3 1_555 -0.055 -0.187 0.172 -1.824 -7.827 2.058 11 B_DC19:DG3_A B 19 ? A 3 ? 19 1 1 A DG 14 1_555 D DC 2 1_555 -0.292 -0.171 0.007 -2.886 -1.736 -4.067 12 B_DG20:DC2_A B 20 ? A 2 ? 19 1 1 A DG 15 1_555 D DC 1 1_555 -0.181 -0.005 0.845 1.881 -10.823 -3.269 13 B_DG21:DC1_A B 21 ? A 1 ? 19 1 1 A DT 16 1_555 B DA 8 1_555 -1.094 -0.040 0.726 3.305 -6.751 -3.595 14 B_DT22:DA35_C B 22 ? C 35 ? 20 1 1 A DG 17 1_555 B DC 7 1_555 0.330 0.108 0.675 5.618 -11.699 0.522 15 B_DG23:DC34_C B 23 ? C 34 ? 19 1 1 A DA 18 1_555 B DT 6 1_555 0.503 0.013 0.215 0.947 -7.180 -10.176 16 B_DA24:DT33_C B 24 ? C 33 ? 20 1 1 A DC 19 1_555 B DG 5 1_555 -0.104 -0.121 -0.327 5.512 -2.874 0.977 17 B_DC25:DG32_C B 25 ? C 32 ? 19 1 1 A DT 20 1_555 B DA 4 1_555 0.128 0.209 -0.571 11.646 -8.569 0.558 18 B_DT26:DA31_C B 26 ? C 31 ? 20 1 1 A DC 21 1_555 B DG 3 1_555 0.003 0.248 -0.089 7.435 -13.817 9.513 19 B_DC27:DG30_C B 27 ? C 30 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DA 3 1_555 C DT 7 1_555 A DC 4 1_555 C DG 6 1_555 -0.611 -0.769 3.524 3.272 1.370 27.686 -1.940 2.095 3.390 2.847 -6.802 27.908 1 BB_DA9DC10:DG41DT42_DD B 9 ? D 42 ? B 10 ? D 41 ? 1 A DC 4 1_555 C DG 6 1_555 A DG 5 1_555 C DC 5 1_555 -0.109 -0.061 3.790 0.301 1.304 35.150 -0.326 0.232 3.784 2.159 -0.498 35.175 2 BB_DC10DG11:DC40DG41_DD B 10 ? D 41 ? B 11 ? D 40 ? 1 A DG 5 1_555 C DC 5 1_555 A DA 6 1_555 C DT 4 1_555 -0.590 0.013 3.463 -0.752 2.594 33.862 -0.418 0.883 3.467 4.446 1.289 33.966 3 BB_DG11DA12:DT39DC40_DD B 11 ? D 40 ? B 12 ? D 39 ? 1 A DA 6 1_555 C DT 4 1_555 A DC 7 1_555 C DG 3 1_555 0.588 -0.921 3.145 -1.120 -1.036 25.877 -1.778 -1.609 3.151 -2.312 2.498 25.922 4 BB_DA12DC13:DG38DT39_DD B 12 ? D 39 ? B 13 ? D 38 ? 1 A DC 7 1_555 C DG 3 1_555 A DA 8 1_555 C DT 2 1_555 -0.072 -0.796 3.609 -0.627 -7.031 42.495 -0.305 0.029 3.690 -9.621 0.858 43.051 5 BB_DC13DA14:DT37DG38_DD B 13 ? D 38 ? B 14 ? D 37 ? 1 A DA 8 1_555 C DT 2 1_555 A DC 9 1_555 C DG 1 1_555 0.843 -0.965 3.312 -3.919 -2.364 37.617 -1.181 -1.805 3.263 -3.650 6.050 37.885 6 BB_DA14DC15:DG36DT37_DD B 14 ? D 37 ? B 15 ? D 36 ? 1 A DC 9 1_555 C DG 1 1_555 A DA 10 1_555 D DT 6 1_555 -1.178 -0.948 2.768 -2.236 5.683 31.023 -2.618 1.817 2.634 10.498 4.130 31.604 7 BB_DC15DA16:DT6DG36_AD B 15 ? D 36 ? B 16 ? A 6 ? 1 A DA 10 1_555 D DT 6 1_555 A DG 11 1_555 D DC 5 1_555 -0.522 -0.115 3.181 -2.878 5.456 30.666 -1.223 0.436 3.148 10.187 5.373 31.265 8 BB_DA16DG17:DC5DT6_AA B 16 ? A 6 ? B 17 ? A 5 ? 1 A DG 11 1_555 D DC 5 1_555 A DA 12 1_555 D DT 4 1_555 -0.835 -0.029 3.457 -2.139 2.299 40.703 -0.311 0.947 3.488 3.299 3.069 40.818 9 BB_DG17DA18:DT4DC5_AA B 17 ? A 5 ? B 18 ? A 4 ? 1 A DA 12 1_555 D DT 4 1_555 A DC 13 1_555 D DG 3 1_555 0.769 -1.228 3.463 3.150 1.165 26.523 -2.978 -0.793 3.473 2.527 -6.831 26.731 10 BB_DA18DC19:DG3DT4_AA B 18 ? A 4 ? B 19 ? A 3 ? 1 A DC 13 1_555 D DG 3 1_555 A DG 14 1_555 D DC 2 1_555 -0.012 0.068 3.619 0.455 0.003 33.024 0.120 0.106 3.619 0.006 -0.800 33.027 11 BB_DC19DG20:DC2DG3_AA B 19 ? A 3 ? B 20 ? A 2 ? 1 A DG 14 1_555 D DC 2 1_555 A DG 15 1_555 D DC 1 1_555 0.360 -1.175 2.958 -8.653 6.416 36.454 -2.514 -1.508 2.573 9.991 13.474 37.960 12 BB_DG20DG21:DC1DC2_AA B 20 ? A 2 ? B 21 ? A 1 ? 1 A DG 15 1_555 D DC 1 1_555 A DT 16 1_555 B DA 8 1_555 -1.118 -1.565 3.157 -2.114 -0.301 25.012 -3.513 1.961 3.257 -0.692 4.871 25.101 13 BB_DG21DT22:DA35DC1_CA B 21 ? A 1 ? B 22 ? C 35 ? 1 A DT 16 1_555 B DA 8 1_555 A DG 17 1_555 B DC 7 1_555 -0.067 0.795 3.454 -1.743 5.587 41.318 0.486 -0.102 3.527 7.871 2.455 41.713 14 BB_DT22DG23:DC34DA35_CC B 22 ? C 35 ? B 23 ? C 34 ? 1 A DG 17 1_555 B DC 7 1_555 A DA 18 1_555 B DT 6 1_555 -0.830 -0.582 3.243 -1.645 2.997 34.152 -1.452 1.151 3.217 5.088 2.793 34.318 15 BB_DG23DA24:DT33DC34_CC B 23 ? C 34 ? B 24 ? C 33 ? 1 A DA 18 1_555 B DT 6 1_555 A DC 19 1_555 B DG 5 1_555 0.940 -0.866 3.195 4.411 3.056 32.509 -2.039 -0.919 3.199 5.414 -7.812 32.937 16 BB_DA24DC25:DG32DT33_CC B 24 ? C 33 ? B 25 ? C 32 ? 1 A DC 19 1_555 B DG 5 1_555 A DT 20 1_555 B DA 4 1_555 -0.087 -0.381 3.167 4.811 3.766 36.811 -1.074 0.749 3.079 5.914 -7.554 37.297 17 BB_DC25DT26:DA31DG32_CC B 25 ? C 32 ? B 26 ? C 31 ? 1 A DT 20 1_555 B DA 4 1_555 A DC 21 1_555 B DG 3 1_555 0.566 0.276 3.574 3.312 3.017 32.379 -0.086 -0.372 3.623 5.377 -5.903 32.679 18 BB_DT26DC27:DG30DA31_CC B 26 ? C 31 ? B 27 ? C 30 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Science Foundation (NSF, United States)' 'United States' 1360635 1 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R01GM104960 2 'National Science Foundation (NSF, United States)' 'United States' NSF2004250 3 # _pdbx_entity_nonpoly.entity_id 5 _pdbx_entity_nonpoly.name 'MAGNESIUM ION' _pdbx_entity_nonpoly.comp_id MG # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 5VY6 _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? #