data_7JOL # _entry.id 7JOL # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7JOL pdb_00007jol 10.2210/pdb7jol/pdb WWPDB D_1000250932 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7JOL _pdbx_database_status.recvd_initial_deposition_date 2020-08-06 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Simmons, C.R.' 1 0000-0002-2290-6132 'MacCulloch, T.' 2 0000-0001-5875-3361 'Stephanopoulos, N.' 3 0000-0001-7859-410X 'Yan, H.' 4 0000-0001-7397-9852 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nat Commun' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2041-1723 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 13 _citation.language ? _citation.page_first 3112 _citation.page_last 3112 _citation.title 'The influence of Holliday junction sequence and dynamics on DNA crystal self-assembly.' _citation.year 2022 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41467-022-30779-6 _citation.pdbx_database_id_PubMed 35662248 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Simmons, C.R.' 1 ? primary 'MacCulloch, T.' 2 ? primary 'Krepl, M.' 3 0000-0002-9833-4281 primary 'Matthies, M.' 4 ? primary 'Buchberger, A.' 5 ? primary 'Crawford, I.' 6 ? primary 'Sponer, J.' 7 0000-0001-6558-6186 primary 'Sulc, P.' 8 0000-0003-1565-6769 primary 'Stephanopoulos, N.' 9 0000-0001-7859-410X primary 'Yan, H.' 10 0000-0001-7397-9852 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 7JOL _cell.details ? _cell.formula_units_Z ? _cell.length_a 68.104 _cell.length_a_esd ? _cell.length_b 68.104 _cell.length_b_esd ? _cell.length_c 57.304 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 3 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7JOL _symmetry.cell_setting ? _symmetry.Int_Tables_number 145 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 32' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*GP*AP*GP*CP*AP*GP*AP*CP*CP*AP*GP*AP*CP*GP*TP*CP*AP*CP*TP*CP*A)-3') ; 6426.177 1 ? ? ? ? 2 polymer syn ;DNA (5'-D(P*AP*CP*GP*TP*CP*T)-3') ; 1784.204 1 ? ? ? ? 3 polymer syn ;DNA (5'-D(*TP*CP*TP*GP*AP*GP*TP*G)-3') ; 2457.627 1 ? ? ? ? 4 polymer syn ;DNA (5'-D(P*GP*GP*TP*CP*TP*GP*C)-3') ; 2129.409 1 ? ? ? ? 5 non-polymer syn 'CACODYLATE ION' 136.989 3 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no no ;(DG)(DA)(DG)(DC)(DA)(DG)(DA)(DC)(DC)(DA)(DG)(DA)(DC)(DG)(DT)(DC)(DA)(DC)(DT)(DC) (DA) ; GAGCAGACCAGACGTCACTCA A ? 2 polydeoxyribonucleotide no no '(DA)(DC)(DG)(DT)(DC)(DT)' ACGTCT B ? 3 polydeoxyribonucleotide no no '(DT)(DC)(DT)(DG)(DA)(DG)(DT)(DG)' TCTGAGTG C ? 4 polydeoxyribonucleotide no no '(DG)(DG)(DT)(DC)(DT)(DG)(DC)' GGTCTGC D ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DA n 1 3 DG n 1 4 DC n 1 5 DA n 1 6 DG n 1 7 DA n 1 8 DC n 1 9 DC n 1 10 DA n 1 11 DG n 1 12 DA n 1 13 DC n 1 14 DG n 1 15 DT n 1 16 DC n 1 17 DA n 1 18 DC n 1 19 DT n 1 20 DC n 1 21 DA n 2 1 DA n 2 2 DC n 2 3 DG n 2 4 DT n 2 5 DC n 2 6 DT n 3 1 DT n 3 2 DC n 3 3 DT n 3 4 DG n 3 5 DA n 3 6 DG n 3 7 DT n 3 8 DG n 4 1 DG n 4 2 DG n 4 3 DT n 4 4 DC n 4 5 DT n 4 6 DG n 4 7 DC n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 21 'synthetic construct' ? 32630 ? 2 1 sample 1 6 'synthetic construct' ? 32630 ? 3 1 sample 1 8 'synthetic construct' ? 32630 ? 4 1 sample 1 7 'synthetic construct' ? 32630 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 7JOL 7JOL ? 1 ? 1 2 PDB 7JOL 7JOL ? 2 ? 1 3 PDB 7JOL 7JOL ? 3 ? 1 4 PDB 7JOL 7JOL ? 4 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 7JOL A 1 ? 21 ? 7JOL 1 ? 21 ? 1 21 2 2 7JOL B 1 ? 6 ? 7JOL 0 ? 5 ? 0 5 3 3 7JOL C 1 ? 8 ? 7JOL 1 ? 8 ? 1 8 4 4 7JOL D 1 ? 7 ? 7JOL 10 ? 16 ? 10 16 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight CAC non-polymer . 'CACODYLATE ION' dimethylarsinate 'C2 H6 As O2 -1' 136.989 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7JOL _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 6.00 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 79.48 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 298 _exptl_crystal_grow.temp_details 'temperature gradient generated from 60 to 25 C at 0.3 degrees per hour' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.5 mL of 0.05 M Cacodylate pH 6.0 with 15 mM MgCl2, 5.0 mM spermidine, and 2.0 M Li2SO4 was added to the reservoir with 2 uL added to the drop containing 4 uL of DNA stock ; _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector CCD _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'ADSC QUANTUM 210r' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2017-08-15 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.1 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 19-BM' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.1 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 19-BM _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate 67.100 _reflns.entry_id 7JOL _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.100 _reflns.d_resolution_low 50.000 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 4353 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 81.800 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 6.100 _reflns.pdbx_Rmerge_I_obs 0.115 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 7.300 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 2.072 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.125 _reflns.pdbx_Rpim_I_all 0.047 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.997 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_all _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split 3.100 3.150 ? ? ? ? ? ? 131 50.000 ? ? ? ? 0.617 ? ? ? ? ? ? ? ? 4.000 ? 1.305 ? ? 0.676 0.268 ? 1 1 0.861 ? ? 3.150 3.210 ? ? ? ? ? ? 149 56.200 ? ? ? ? 0.239 ? ? ? ? ? ? ? ? 4.400 ? 2.072 ? ? 0.262 0.104 ? 2 1 0.978 ? ? 3.210 3.270 ? ? ? ? ? ? 154 57.700 ? ? ? ? 0.263 ? ? ? ? ? ? ? ? 3.800 ? 1.724 ? ? 0.289 0.117 ? 3 1 0.984 ? ? 3.270 3.340 ? ? ? ? ? ? 173 64.600 ? ? ? ? 0.258 ? ? ? ? ? ? ? ? 4.600 ? 1.764 ? ? 0.282 0.112 ? 4 1 0.958 ? ? 3.340 3.410 ? ? ? ? ? ? 174 63.000 ? ? ? ? 0.270 ? ? ? ? ? ? ? ? 4.500 ? 1.797 ? ? 0.295 0.117 ? 5 1 0.983 ? ? 3.410 3.490 ? ? ? ? ? ? 167 67.600 ? ? ? ? 0.657 ? ? ? ? ? ? ? ? 5.100 ? 1.395 ? ? 0.716 0.280 ? 6 1 0.840 ? ? 3.490 3.580 ? ? ? ? ? ? 187 69.500 ? ? ? ? 0.672 ? ? ? ? ? ? ? ? 5.100 ? 1.359 ? ? 0.732 0.285 ? 7 1 0.840 ? ? 3.580 3.680 ? ? ? ? ? ? 201 73.600 ? ? ? ? 0.773 ? ? ? ? ? ? ? ? 5.100 ? 1.666 ? ? 0.845 0.333 ? 8 1 0.762 ? ? 3.680 3.780 ? ? ? ? ? ? 210 79.800 ? ? ? ? 0.831 ? ? ? ? ? ? ? ? 5.400 ? 1.485 ? ? 0.904 0.349 ? 9 1 0.808 ? ? 3.780 3.910 ? ? ? ? ? ? 203 77.200 ? ? ? ? 0.890 ? ? ? ? ? ? ? ? 5.700 ? 1.378 ? ? 0.966 0.370 ? 10 1 0.808 ? ? 3.910 4.040 ? ? ? ? ? ? 230 88.100 ? ? ? ? 0.818 ? ? ? ? ? ? ? ? 5.700 ? 1.378 ? ? 0.887 0.339 ? 11 1 0.857 ? ? 4.040 4.210 ? ? ? ? ? ? 267 92.700 ? ? ? ? 0.668 ? ? ? ? ? ? ? ? 6.000 ? 1.572 ? ? 0.725 0.277 ? 12 1 0.810 ? ? 4.210 4.400 ? ? ? ? ? ? 251 98.800 ? ? ? ? 0.570 ? ? ? ? ? ? ? ? 6.200 ? 1.634 ? ? 0.618 0.235 ? 13 1 0.846 ? ? 4.400 4.630 ? ? ? ? ? ? 260 99.600 ? ? ? ? 0.661 ? ? ? ? ? ? ? ? 6.700 ? 1.438 ? ? 0.715 0.268 ? 14 1 0.867 ? ? 4.630 4.920 ? ? ? ? ? ? 281 100.000 ? ? ? ? 0.383 ? ? ? ? ? ? ? ? 7.200 ? 1.525 ? ? 0.413 0.153 ? 15 1 0.964 ? ? 4.920 5.300 ? ? ? ? ? ? 253 100.000 ? ? ? ? 0.262 ? ? ? ? ? ? ? ? 7.500 ? 1.940 ? ? 0.281 0.102 ? 16 1 0.981 ? ? 5.300 5.830 ? ? ? ? ? ? 257 100.000 ? ? ? ? 0.153 ? ? ? ? ? ? ? ? 7.700 ? 1.971 ? ? 0.164 0.059 ? 17 1 0.993 ? ? 5.830 6.670 ? ? ? ? ? ? 269 100.000 ? ? ? ? 0.125 ? ? ? ? ? ? ? ? 7.800 ? 2.043 ? ? 0.134 0.048 ? 18 1 0.995 ? ? 6.670 8.400 ? ? ? ? ? ? 273 100.000 ? ? ? ? 0.071 ? ? ? ? ? ? ? ? 7.800 ? 3.099 ? ? 0.076 0.027 ? 19 1 0.998 ? ? 8.400 50.000 ? ? ? ? ? ? 263 97.400 ? ? ? ? 0.057 ? ? ? ? ? ? ? ? 7.400 ? 5.503 ? ? 0.061 0.023 ? 20 1 0.995 ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max 360.370 _refine.B_iso_mean 116.3739 _refine.B_iso_min 52.330 _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7JOL _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.1140 _refine.ls_d_res_low 34.0520 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 4327 _refine.ls_number_reflns_R_free 217 _refine.ls_number_reflns_R_work 4110 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 81.4700 _refine.ls_percent_reflns_R_free 5.0200 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2482 _refine.ls_R_factor_R_free 0.2572 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2476 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.960 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 5VY6 _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 37.3900 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.5500 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id final _refine_hist.details ? _refine_hist.d_res_high 3.1140 _refine_hist.d_res_low 34.0520 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 856 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total 42 _refine_hist.pdbx_B_iso_mean_ligand 277.21 _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 853 _refine_hist.pdbx_number_atoms_ligand 3 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.007 ? 954 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.868 ? 1464 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.045 ? 165 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.004 ? 42 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 35.093 ? 403 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 3.1144 3.9229 . . 84 1652 65.0000 . . . 0.4621 0.0000 0.3587 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.9229 34.052 . . 133 2458 98.0000 . . . 0.2183 0.0000 0.2150 . . . . . . . . . . . # _struct.entry_id 7JOL _struct.title 'Self-assembly of a 3D DNA crystal lattice (4x6 duplex version) containing the J24 immobile Holliday junction' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7JOL _struct_keywords.text 'Structural DNA nanotechnology, immobile Holliday junctions, 3D DNA self-assembly, designer DNA crystals, DNA' _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 5 ? F N N 5 ? G N N 5 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 3 N1 ? ? ? 1_555 D DC 7 N3 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DG 3 N2 ? ? ? 1_555 D DC 7 O2 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DG 3 O6 ? ? ? 1_555 D DC 7 N4 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DC 4 N3 ? ? ? 1_555 D DG 6 N1 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DC 4 N4 ? ? ? 1_555 D DG 6 O6 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DC 4 O2 ? ? ? 1_555 D DG 6 N2 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DA 5 N1 ? ? ? 1_555 D DT 5 N3 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DA 5 N6 ? ? ? 1_555 D DT 5 O4 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DG 6 N1 ? ? ? 1_555 D DC 4 N3 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DG 6 N2 ? ? ? 1_555 D DC 4 O2 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DG 6 O6 ? ? ? 1_555 D DC 4 N4 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DA 7 N1 ? ? ? 1_555 D DT 3 N3 ? ? A DA 7 D DT 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DA 7 N6 ? ? ? 1_555 D DT 3 O4 ? ? A DA 7 D DT 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DC 8 N3 ? ? ? 1_555 D DG 2 N1 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DC 8 N4 ? ? ? 1_555 D DG 2 O6 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 8 O2 ? ? ? 1_555 D DG 2 N2 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DC 9 N3 ? ? ? 1_555 D DG 1 N1 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DC 9 N4 ? ? ? 1_555 D DG 1 O6 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DC 9 O2 ? ? ? 1_555 D DG 1 N2 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DA 10 N1 ? ? ? 1_555 B DT 6 N3 ? ? A DA 10 B DT 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DA 10 N6 ? ? ? 1_555 B DT 6 O4 ? ? A DA 10 B DT 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DG 11 N1 ? ? ? 1_555 B DC 5 N3 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DG 11 N2 ? ? ? 1_555 B DC 5 O2 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DG 11 O6 ? ? ? 1_555 B DC 5 N4 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DA 12 N1 ? ? ? 1_555 B DG 3 N1 ? ? A DA 12 B DG 2 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog26 hydrog ? ? A DA 12 N6 ? ? ? 1_555 B DG 3 O6 ? ? A DA 12 B DG 2 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog27 hydrog ? ? A DA 12 N1 ? ? ? 1_555 B DT 4 N3 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DA 12 N6 ? ? ? 1_555 B DT 4 O4 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DC 13 N3 ? ? ? 1_555 B DG 3 N1 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A DC 13 N4 ? ? ? 1_555 B DG 3 O6 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A DC 13 O2 ? ? ? 1_555 B DG 3 N2 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A DG 14 N1 ? ? ? 1_555 B DC 2 N3 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DG 14 N2 ? ? ? 1_555 B DC 2 O2 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DG 14 O6 ? ? ? 1_555 B DC 2 N4 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DT 15 N3 ? ? ? 1_555 B DA 1 N1 ? ? A DT 15 B DA 0 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DT 15 O4 ? ? ? 1_555 B DA 1 N6 ? ? A DT 15 B DA 0 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DC 16 N3 ? ? ? 1_555 C DG 8 N1 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DC 16 N4 ? ? ? 1_555 C DG 8 O6 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DC 16 O2 ? ? ? 1_555 C DG 8 N2 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DA 17 N1 ? ? ? 1_555 C DT 7 N3 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DA 17 N6 ? ? ? 1_555 C DT 7 O4 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DC 18 N3 ? ? ? 1_555 C DG 6 N1 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DC 18 N4 ? ? ? 1_555 C DG 6 O6 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DC 18 O2 ? ? ? 1_555 C DG 6 N2 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A DT 19 N3 ? ? ? 1_555 C DA 5 N1 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A DT 19 O4 ? ? ? 1_555 C DA 5 N6 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A DC 20 N3 ? ? ? 1_555 C DG 4 N1 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A DC 20 N4 ? ? ? 1_555 C DG 4 O6 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A DC 20 O2 ? ? ? 1_555 C DG 4 N2 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A DA 21 N1 ? ? ? 1_555 C DT 3 N3 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A DA 21 N6 ? ? ? 1_555 C DT 3 O4 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 7JOL _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.014683 _atom_sites.fract_transf_matrix[1][2] 0.008477 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.016955 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.017451 _atom_sites.fract_transf_vector[1] 0.000000 _atom_sites.fract_transf_vector[2] 0.000000 _atom_sites.fract_transf_vector[3] 0.000000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol AS C H N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DA 2 2 2 DA DA A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DC 4 4 4 DC DC A . n A 1 5 DA 5 5 5 DA DA A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DA 7 7 7 DA DA A . n A 1 8 DC 8 8 8 DC DC A . n A 1 9 DC 9 9 9 DC DC A . n A 1 10 DA 10 10 10 DA DA A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DA 12 12 12 DA DA A . n A 1 13 DC 13 13 13 DC DC A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DT 15 15 15 DT DT A . n A 1 16 DC 16 16 16 DC DC A . n A 1 17 DA 17 17 17 DA DA A . n A 1 18 DC 18 18 18 DC DC A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DC 20 20 20 DC DC A . n A 1 21 DA 21 21 21 DA DA A . n B 2 1 DA 1 0 0 DA DA B . n B 2 2 DC 2 1 1 DC DC B . n B 2 3 DG 3 2 2 DG DG B . n B 2 4 DT 4 3 3 DT DT B . n B 2 5 DC 5 4 4 DC DC B . n B 2 6 DT 6 5 5 DT DT B . n C 3 1 DT 1 1 1 DT DT C . n C 3 2 DC 2 2 2 DC DC C . n C 3 3 DT 3 3 3 DT DT C . n C 3 4 DG 4 4 4 DG DG C . n C 3 5 DA 5 5 5 DA DA C . n C 3 6 DG 6 6 6 DG DG C . n C 3 7 DT 7 7 7 DT DT C . n C 3 8 DG 8 8 8 DG DG C . n D 4 1 DG 1 10 10 DG DG D . n D 4 2 DG 2 11 11 DG DG D . n D 4 3 DT 3 12 12 DT DT D . n D 4 4 DC 4 13 13 DC DC D . n D 4 5 DT 5 14 14 DT DT D . n D 4 6 DG 6 15 15 DG DG D . n D 4 7 DC 7 16 16 DC DC D . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code E 5 CAC 1 101 1 CAC AS A . F 5 CAC 1 102 2 CAC AS A . G 5 CAC 1 103 3 CAC AS A . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details tetrameric _pdbx_struct_assembly.oligomeric_count 4 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2021-07-14 2 'Structure model' 1 1 2022-07-06 3 'Structure model' 1 2 2023-10-18 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 2 'Structure model' database_2 4 3 'Structure model' chem_comp_atom 5 3 'Structure model' chem_comp_bond 6 3 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_CSD' 4 2 'Structure model' '_citation.journal_id_ISSN' 5 2 'Structure model' '_citation.journal_volume' 6 2 'Structure model' '_citation.page_first' 7 2 'Structure model' '_citation.page_last' 8 2 'Structure model' '_citation.pdbx_database_id_DOI' 9 2 'Structure model' '_citation.pdbx_database_id_PubMed' 10 2 'Structure model' '_citation.title' 11 2 'Structure model' '_citation.year' 12 2 'Structure model' '_database_2.pdbx_DOI' 13 2 'Structure model' '_database_2.pdbx_database_accession' # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.11.1_2575 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 3 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? 3.25 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 5 # _pdbx_entry_details.entry_id 7JOL _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest N # _pdbx_validate_symm_contact.id 1 _pdbx_validate_symm_contact.PDB_model_num 1 _pdbx_validate_symm_contact.auth_atom_id_1 OP1 _pdbx_validate_symm_contact.auth_asym_id_1 B _pdbx_validate_symm_contact.auth_comp_id_1 DA _pdbx_validate_symm_contact.auth_seq_id_1 0 _pdbx_validate_symm_contact.PDB_ins_code_1 ? _pdbx_validate_symm_contact.label_alt_id_1 ? _pdbx_validate_symm_contact.site_symmetry_1 1_555 _pdbx_validate_symm_contact.auth_atom_id_2 "O3'" _pdbx_validate_symm_contact.auth_asym_id_2 B _pdbx_validate_symm_contact.auth_comp_id_2 DT _pdbx_validate_symm_contact.auth_seq_id_2 5 _pdbx_validate_symm_contact.PDB_ins_code_2 ? _pdbx_validate_symm_contact.label_alt_id_2 ? _pdbx_validate_symm_contact.site_symmetry_2 3_555 _pdbx_validate_symm_contact.dist 2.19 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A DC 13 ? ? "C1'" A DC 13 ? ? N1 A DC 13 ? ? 110.20 108.30 1.90 0.30 N 2 1 "O4'" D DT 12 ? ? "C1'" D DT 12 ? ? N1 D DT 12 ? ? 110.85 108.30 2.55 0.30 N # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A DG 1 ? "O5'" ? A DG 1 "O5'" 2 1 Y 1 A DG 1 ? "C5'" ? A DG 1 "C5'" 3 1 N 1 A CAC 101 ? O1 ? E CAC 1 O1 4 1 N 1 A CAC 101 ? O2 ? E CAC 1 O2 5 1 N 1 A CAC 101 ? C1 ? E CAC 1 C1 6 1 N 1 A CAC 101 ? C2 ? E CAC 1 C2 7 1 N 1 A CAC 102 ? O1 ? F CAC 1 O1 8 1 N 1 A CAC 102 ? O2 ? F CAC 1 O2 9 1 N 1 A CAC 102 ? C1 ? F CAC 1 C1 10 1 N 1 A CAC 102 ? C2 ? F CAC 1 C2 11 1 N 1 A CAC 103 ? O1 ? G CAC 1 O1 12 1 N 1 A CAC 103 ? O2 ? G CAC 1 O2 13 1 N 1 A CAC 103 ? C1 ? G CAC 1 C1 14 1 N 1 A CAC 103 ? C2 ? G CAC 1 C2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal CAC AS AS N N 1 CAC O1 O N N 2 CAC O2 O N N 3 CAC C1 C N N 4 CAC C2 C N N 5 CAC H11 H N N 6 CAC H12 H N N 7 CAC H13 H N N 8 CAC H21 H N N 9 CAC H22 H N N 10 CAC H23 H N N 11 DA OP3 O N N 12 DA P P N N 13 DA OP1 O N N 14 DA OP2 O N N 15 DA "O5'" O N N 16 DA "C5'" C N N 17 DA "C4'" C N R 18 DA "O4'" O N N 19 DA "C3'" C N S 20 DA "O3'" O N N 21 DA "C2'" C N N 22 DA "C1'" C N R 23 DA N9 N Y N 24 DA C8 C Y N 25 DA N7 N Y N 26 DA C5 C Y N 27 DA C6 C Y N 28 DA N6 N N N 29 DA N1 N Y N 30 DA C2 C Y N 31 DA N3 N Y N 32 DA C4 C Y N 33 DA HOP3 H N N 34 DA HOP2 H N N 35 DA "H5'" H N N 36 DA "H5''" H N N 37 DA "H4'" H N N 38 DA "H3'" H N N 39 DA "HO3'" H N N 40 DA "H2'" H N N 41 DA "H2''" H N N 42 DA "H1'" H N N 43 DA H8 H N N 44 DA H61 H N N 45 DA H62 H N N 46 DA H2 H N N 47 DC OP3 O N N 48 DC P P N N 49 DC OP1 O N N 50 DC OP2 O N N 51 DC "O5'" O N N 52 DC "C5'" C N N 53 DC "C4'" C N R 54 DC "O4'" O N N 55 DC "C3'" C N S 56 DC "O3'" O N N 57 DC "C2'" C N N 58 DC "C1'" C N R 59 DC N1 N N N 60 DC C2 C N N 61 DC O2 O N N 62 DC N3 N N N 63 DC C4 C N N 64 DC N4 N N N 65 DC C5 C N N 66 DC C6 C N N 67 DC HOP3 H N N 68 DC HOP2 H N N 69 DC "H5'" H N N 70 DC "H5''" H N N 71 DC "H4'" H N N 72 DC "H3'" H N N 73 DC "HO3'" H N N 74 DC "H2'" H N N 75 DC "H2''" H N N 76 DC "H1'" H N N 77 DC H41 H N N 78 DC H42 H N N 79 DC H5 H N N 80 DC H6 H N N 81 DG OP3 O N N 82 DG P P N N 83 DG OP1 O N N 84 DG OP2 O N N 85 DG "O5'" O N N 86 DG "C5'" C N N 87 DG "C4'" C N R 88 DG "O4'" O N N 89 DG "C3'" C N S 90 DG "O3'" O N N 91 DG "C2'" C N N 92 DG "C1'" C N R 93 DG N9 N Y N 94 DG C8 C Y N 95 DG N7 N Y N 96 DG C5 C Y N 97 DG C6 C N N 98 DG O6 O N N 99 DG N1 N N N 100 DG C2 C N N 101 DG N2 N N N 102 DG N3 N N N 103 DG C4 C Y N 104 DG HOP3 H N N 105 DG HOP2 H N N 106 DG "H5'" H N N 107 DG "H5''" H N N 108 DG "H4'" H N N 109 DG "H3'" H N N 110 DG "HO3'" H N N 111 DG "H2'" H N N 112 DG "H2''" H N N 113 DG "H1'" H N N 114 DG H8 H N N 115 DG H1 H N N 116 DG H21 H N N 117 DG H22 H N N 118 DT OP3 O N N 119 DT P P N N 120 DT OP1 O N N 121 DT OP2 O N N 122 DT "O5'" O N N 123 DT "C5'" C N N 124 DT "C4'" C N R 125 DT "O4'" O N N 126 DT "C3'" C N S 127 DT "O3'" O N N 128 DT "C2'" C N N 129 DT "C1'" C N R 130 DT N1 N N N 131 DT C2 C N N 132 DT O2 O N N 133 DT N3 N N N 134 DT C4 C N N 135 DT O4 O N N 136 DT C5 C N N 137 DT C7 C N N 138 DT C6 C N N 139 DT HOP3 H N N 140 DT HOP2 H N N 141 DT "H5'" H N N 142 DT "H5''" H N N 143 DT "H4'" H N N 144 DT "H3'" H N N 145 DT "HO3'" H N N 146 DT "H2'" H N N 147 DT "H2''" H N N 148 DT "H1'" H N N 149 DT H3 H N N 150 DT H71 H N N 151 DT H72 H N N 152 DT H73 H N N 153 DT H6 H N N 154 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal CAC AS O1 doub N N 1 CAC AS O2 sing N N 2 CAC AS C1 sing N N 3 CAC AS C2 sing N N 4 CAC C1 H11 sing N N 5 CAC C1 H12 sing N N 6 CAC C1 H13 sing N N 7 CAC C2 H21 sing N N 8 CAC C2 H22 sing N N 9 CAC C2 H23 sing N N 10 DA OP3 P sing N N 11 DA OP3 HOP3 sing N N 12 DA P OP1 doub N N 13 DA P OP2 sing N N 14 DA P "O5'" sing N N 15 DA OP2 HOP2 sing N N 16 DA "O5'" "C5'" sing N N 17 DA "C5'" "C4'" sing N N 18 DA "C5'" "H5'" sing N N 19 DA "C5'" "H5''" sing N N 20 DA "C4'" "O4'" sing N N 21 DA "C4'" "C3'" sing N N 22 DA "C4'" "H4'" sing N N 23 DA "O4'" "C1'" sing N N 24 DA "C3'" "O3'" sing N N 25 DA "C3'" "C2'" sing N N 26 DA "C3'" "H3'" sing N N 27 DA "O3'" "HO3'" sing N N 28 DA "C2'" "C1'" sing N N 29 DA "C2'" "H2'" sing N N 30 DA "C2'" "H2''" sing N N 31 DA "C1'" N9 sing N N 32 DA "C1'" "H1'" sing N N 33 DA N9 C8 sing Y N 34 DA N9 C4 sing Y N 35 DA C8 N7 doub Y N 36 DA C8 H8 sing N N 37 DA N7 C5 sing Y N 38 DA C5 C6 sing Y N 39 DA C5 C4 doub Y N 40 DA C6 N6 sing N N 41 DA C6 N1 doub Y N 42 DA N6 H61 sing N N 43 DA N6 H62 sing N N 44 DA N1 C2 sing Y N 45 DA C2 N3 doub Y N 46 DA C2 H2 sing N N 47 DA N3 C4 sing Y N 48 DC OP3 P sing N N 49 DC OP3 HOP3 sing N N 50 DC P OP1 doub N N 51 DC P OP2 sing N N 52 DC P "O5'" sing N N 53 DC OP2 HOP2 sing N N 54 DC "O5'" "C5'" sing N N 55 DC "C5'" "C4'" sing N N 56 DC "C5'" "H5'" sing N N 57 DC "C5'" "H5''" sing N N 58 DC "C4'" "O4'" sing N N 59 DC "C4'" "C3'" sing N N 60 DC "C4'" "H4'" sing N N 61 DC "O4'" "C1'" sing N N 62 DC "C3'" "O3'" sing N N 63 DC "C3'" "C2'" sing N N 64 DC "C3'" "H3'" sing N N 65 DC "O3'" "HO3'" sing N N 66 DC "C2'" "C1'" sing N N 67 DC "C2'" "H2'" sing N N 68 DC "C2'" "H2''" sing N N 69 DC "C1'" N1 sing N N 70 DC "C1'" "H1'" sing N N 71 DC N1 C2 sing N N 72 DC N1 C6 sing N N 73 DC C2 O2 doub N N 74 DC C2 N3 sing N N 75 DC N3 C4 doub N N 76 DC C4 N4 sing N N 77 DC C4 C5 sing N N 78 DC N4 H41 sing N N 79 DC N4 H42 sing N N 80 DC C5 C6 doub N N 81 DC C5 H5 sing N N 82 DC C6 H6 sing N N 83 DG OP3 P sing N N 84 DG OP3 HOP3 sing N N 85 DG P OP1 doub N N 86 DG P OP2 sing N N 87 DG P "O5'" sing N N 88 DG OP2 HOP2 sing N N 89 DG "O5'" "C5'" sing N N 90 DG "C5'" "C4'" sing N N 91 DG "C5'" "H5'" sing N N 92 DG "C5'" "H5''" sing N N 93 DG "C4'" "O4'" sing N N 94 DG "C4'" "C3'" sing N N 95 DG "C4'" "H4'" sing N N 96 DG "O4'" "C1'" sing N N 97 DG "C3'" "O3'" sing N N 98 DG "C3'" "C2'" sing N N 99 DG "C3'" "H3'" sing N N 100 DG "O3'" "HO3'" sing N N 101 DG "C2'" "C1'" sing N N 102 DG "C2'" "H2'" sing N N 103 DG "C2'" "H2''" sing N N 104 DG "C1'" N9 sing N N 105 DG "C1'" "H1'" sing N N 106 DG N9 C8 sing Y N 107 DG N9 C4 sing Y N 108 DG C8 N7 doub Y N 109 DG C8 H8 sing N N 110 DG N7 C5 sing Y N 111 DG C5 C6 sing N N 112 DG C5 C4 doub Y N 113 DG C6 O6 doub N N 114 DG C6 N1 sing N N 115 DG N1 C2 sing N N 116 DG N1 H1 sing N N 117 DG C2 N2 sing N N 118 DG C2 N3 doub N N 119 DG N2 H21 sing N N 120 DG N2 H22 sing N N 121 DG N3 C4 sing N N 122 DT OP3 P sing N N 123 DT OP3 HOP3 sing N N 124 DT P OP1 doub N N 125 DT P OP2 sing N N 126 DT P "O5'" sing N N 127 DT OP2 HOP2 sing N N 128 DT "O5'" "C5'" sing N N 129 DT "C5'" "C4'" sing N N 130 DT "C5'" "H5'" sing N N 131 DT "C5'" "H5''" sing N N 132 DT "C4'" "O4'" sing N N 133 DT "C4'" "C3'" sing N N 134 DT "C4'" "H4'" sing N N 135 DT "O4'" "C1'" sing N N 136 DT "C3'" "O3'" sing N N 137 DT "C3'" "C2'" sing N N 138 DT "C3'" "H3'" sing N N 139 DT "O3'" "HO3'" sing N N 140 DT "C2'" "C1'" sing N N 141 DT "C2'" "H2'" sing N N 142 DT "C2'" "H2''" sing N N 143 DT "C1'" N1 sing N N 144 DT "C1'" "H1'" sing N N 145 DT N1 C2 sing N N 146 DT N1 C6 sing N N 147 DT C2 O2 doub N N 148 DT C2 N3 sing N N 149 DT N3 C4 sing N N 150 DT N3 H3 sing N N 151 DT C4 O4 doub N N 152 DT C4 C5 sing N N 153 DT C5 C7 sing N N 154 DT C5 C6 doub N N 155 DT C7 H71 sing N N 156 DT C7 H72 sing N N 157 DT C7 H73 sing N N 158 DT C6 H6 sing N N 159 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7JOL 'double helix' 7JOL 'a-form double helix' 7JOL 'b-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 3 1_555 D DC 7 1_555 1.567 0.007 1.294 11.658 -18.695 -4.813 1 A_DG3:DC16_D A 3 ? D 16 ? 19 1 1 A DC 4 1_555 D DG 6 1_555 0.187 -0.095 0.011 -4.378 -9.575 0.683 2 A_DC4:DG15_D A 4 ? D 15 ? 19 1 1 A DA 5 1_555 D DT 5 1_555 1.961 0.013 0.528 -5.080 -8.886 -21.499 3 A_DA5:DT14_D A 5 ? D 14 ? 20 1 1 A DG 6 1_555 D DC 4 1_555 -0.138 -0.188 0.340 -1.013 -3.728 -3.970 4 A_DG6:DC13_D A 6 ? D 13 ? 19 1 1 A DA 7 1_555 D DT 3 1_555 1.361 0.495 0.161 1.013 2.993 -19.969 5 A_DA7:DT12_D A 7 ? D 12 ? 20 1 1 A DC 8 1_555 D DG 2 1_555 0.180 -0.194 0.155 6.332 -0.845 -0.503 6 A_DC8:DG11_D A 8 ? D 11 ? 19 1 1 A DC 9 1_555 D DG 1 1_555 0.156 -0.157 -0.154 -2.876 -1.282 -2.735 7 A_DC9:DG10_D A 9 ? D 10 ? 19 1 1 A DA 10 1_555 B DT 6 1_555 0.115 0.252 1.286 10.945 -4.245 -9.520 8 A_DA10:DT5_B A 10 ? B 5 ? 20 1 1 A DG 11 1_555 B DC 5 1_555 -0.150 -0.157 0.583 4.769 0.609 3.530 9 A_DG11:DC4_B A 11 ? B 4 ? 19 1 1 A DA 12 1_555 B DT 4 1_555 0.313 -0.133 0.592 1.656 0.290 -4.207 10 A_DA12:DT3_B A 12 ? B 3 ? 20 1 1 A DC 13 1_555 B DG 3 1_555 0.163 -0.389 1.066 0.746 -6.879 -3.534 11 A_DC13:DG2_B A 13 ? B 2 ? 19 1 1 A DG 14 1_555 B DC 2 1_555 -0.201 -0.250 0.051 7.465 -2.731 -0.454 12 A_DG14:DC1_B A 14 ? B 1 ? 19 1 1 A DT 15 1_555 B DA 1 1_555 -0.077 -0.564 0.638 2.397 -10.797 0.464 13 A_DT15:DA0_B A 15 ? B 0 ? 20 1 1 A DC 16 1_555 C DG 8 1_555 0.156 -0.128 0.208 -0.821 -8.159 -0.877 14 A_DC16:DG8_C A 16 ? C 8 ? 19 1 1 A DA 17 1_555 C DT 7 1_555 0.269 -0.209 0.656 3.536 -12.728 -4.151 15 A_DA17:DT7_C A 17 ? C 7 ? 20 1 1 A DC 18 1_555 C DG 6 1_555 0.129 -0.120 0.530 -4.155 -7.402 0.982 16 A_DC18:DG6_C A 18 ? C 6 ? 19 1 1 A DT 19 1_555 C DA 5 1_555 -0.081 -0.124 0.296 -1.015 -6.909 0.381 17 A_DT19:DA5_C A 19 ? C 5 ? 20 1 1 A DC 20 1_555 C DG 4 1_555 0.162 -0.147 0.147 -2.328 -5.579 1.051 18 A_DC20:DG4_C A 20 ? C 4 ? 19 1 1 A DA 21 1_555 C DT 3 1_555 0.137 -0.141 -0.029 -2.910 -8.540 1.914 19 A_DA21:DT3_C A 21 ? C 3 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 3 1_555 D DC 7 1_555 A DC 4 1_555 D DG 6 1_555 0.878 -0.459 3.824 12.863 -6.994 35.612 0.376 0.642 3.920 -10.885 -20.021 38.414 1 AA_DG3DC4:DG15DC16_DD A 3 ? D 16 ? A 4 ? D 15 ? 1 A DC 4 1_555 D DG 6 1_555 A DA 5 1_555 D DT 5 1_555 -1.260 0.055 3.616 -2.135 3.566 35.934 -0.473 1.694 3.671 5.756 3.446 36.165 2 AA_DC4DA5:DT14DG15_DD A 4 ? D 15 ? A 5 ? D 14 ? 1 A DA 5 1_555 D DT 5 1_555 A DG 6 1_555 D DC 4 1_555 0.873 -0.651 3.072 1.127 4.123 20.865 -3.333 -1.933 2.932 11.234 -3.070 21.294 3 AA_DA5DG6:DC13DT14_DD A 5 ? D 14 ? A 6 ? D 13 ? 1 A DG 6 1_555 D DC 4 1_555 A DA 7 1_555 D DT 3 1_555 -0.917 -1.066 3.136 1.619 1.838 47.085 -1.475 1.272 3.063 2.298 -2.025 47.145 4 AA_DG6DA7:DT12DC13_DD A 6 ? D 13 ? A 7 ? D 12 ? 1 A DA 7 1_555 D DT 3 1_555 A DC 8 1_555 D DG 2 1_555 1.493 -1.283 3.289 -4.613 5.070 30.346 -3.308 -3.617 2.791 9.532 8.674 31.093 5 AA_DA7DC8:DG11DT12_DD A 7 ? D 12 ? A 8 ? D 11 ? 1 A DC 8 1_555 D DG 2 1_555 A DC 9 1_555 D DG 1 1_555 -0.911 -1.405 3.442 -1.264 2.978 34.167 -2.867 1.339 3.342 5.055 2.145 34.315 6 AA_DC8DC9:DG10DG11_DD A 8 ? D 11 ? A 9 ? D 10 ? 1 A DC 9 1_555 D DG 1 1_555 A DA 10 1_555 B DT 6 1_555 -1.397 -1.816 2.891 -7.487 -1.263 19.170 -4.533 0.677 3.304 -3.615 21.426 20.606 7 AA_DC9DA10:DT5DG10_BD A 9 ? D 10 ? A 10 ? B 5 ? 1 A DA 10 1_555 B DT 6 1_555 A DG 11 1_555 B DC 5 1_555 0.109 -0.571 3.544 3.813 1.253 29.469 -1.397 0.653 3.504 2.448 -7.451 29.735 8 AA_DA10DG11:DC4DT5_BB A 10 ? B 5 ? A 11 ? B 4 ? 1 A DG 11 1_555 B DC 5 1_555 A DA 12 1_555 B DT 4 1_555 -0.495 -0.043 3.217 -0.776 3.975 41.456 -0.474 0.616 3.208 5.599 1.093 41.645 9 AA_DG11DA12:DT3DC4_BB A 11 ? B 4 ? A 12 ? B 3 ? 1 A DA 12 1_555 B DT 4 1_555 A DC 13 1_555 B DG 3 1_555 0.548 -1.594 3.200 -4.507 3.411 36.076 -2.991 -1.464 2.954 5.467 7.223 36.502 10 AA_DA12DC13:DG2DT3_BB A 12 ? B 3 ? A 13 ? B 2 ? 1 A DC 13 1_555 B DG 3 1_555 A DG 14 1_555 B DC 2 1_555 -0.368 -1.143 3.051 3.693 -2.937 29.908 -1.630 1.409 3.080 -5.646 -7.101 30.270 11 AA_DC13DG14:DC1DG2_BB A 13 ? B 2 ? A 14 ? B 1 ? 1 A DG 14 1_555 B DC 2 1_555 A DT 15 1_555 B DA 1 1_555 -0.103 -1.129 3.373 -4.248 0.319 36.363 -1.844 -0.438 3.354 0.510 6.778 36.604 12 AA_DG14DT15:DA0DC1_BB A 14 ? B 1 ? A 15 ? B 0 ? 1 A DT 15 1_555 B DA 1 1_555 A DC 16 1_555 C DG 8 1_555 -1.074 -1.333 3.092 2.327 6.283 24.128 -4.716 3.086 2.555 14.672 -5.434 25.027 13 AA_DT15DC16:DG8DA0_CB A 15 ? B 0 ? A 16 ? C 8 ? 1 A DC 16 1_555 C DG 8 1_555 A DA 17 1_555 C DT 7 1_555 -1.234 0.154 3.267 -6.170 1.412 36.141 0.046 1.091 3.427 2.255 9.852 36.673 14 AA_DC16DA17:DT7DG8_CC A 16 ? C 8 ? A 17 ? C 7 ? 1 A DA 17 1_555 C DT 7 1_555 A DC 18 1_555 C DG 6 1_555 0.314 -0.744 3.376 -1.937 -4.974 33.532 -0.441 -0.863 3.425 -8.555 3.331 33.942 15 AA_DA17DC18:DG6DT7_CC A 17 ? C 7 ? A 18 ? C 6 ? 1 A DC 18 1_555 C DG 6 1_555 A DT 19 1_555 C DA 5 1_555 -0.258 -1.022 3.163 1.645 -3.415 37.305 -1.153 0.613 3.227 -5.321 -2.564 37.491 16 AA_DC18DT19:DA5DG6_CC A 18 ? C 6 ? A 19 ? C 5 ? 1 A DT 19 1_555 C DA 5 1_555 A DC 20 1_555 C DG 4 1_555 0.282 0.958 3.358 2.755 -0.807 39.151 1.524 -0.082 3.349 -1.202 -4.105 39.252 17 AA_DT19DC20:DG4DA5_CC A 19 ? C 5 ? A 20 ? C 4 ? 1 A DC 20 1_555 C DG 4 1_555 A DA 21 1_555 C DT 3 1_555 -0.622 1.637 3.545 -1.818 -0.468 34.328 2.849 0.744 3.550 -0.793 3.077 34.377 18 AA_DC20DA21:DT3DG4_CC A 20 ? C 4 ? A 21 ? C 3 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Science Foundation (NSF, United States)' 'United States' 1360635 1 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R01GM104960 2 'National Science Foundation (NSF, United States)' 'United States' NSF2004250 3 # _pdbx_entity_nonpoly.entity_id 5 _pdbx_entity_nonpoly.name 'CACODYLATE ION' _pdbx_entity_nonpoly.comp_id CAC # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 5VY6 _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? #