data_7JRR # _entry.id 7JRR # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7JRR pdb_00007jrr 10.2210/pdb7jrr/pdb WWPDB D_1000250945 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7JRR _pdbx_database_status.recvd_initial_deposition_date 2020-08-12 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Liu, D.' 1 0000-0002-0708-7466 'Shao, Y.' 2 0000-0003-3663-1325 'Piccirilli, J.A.' 3 0000-0002-0541-6270 'Weizmann, Y.' 4 0000-0002-3467-990X # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Sci Adv' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2375-2548 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 7 _citation.language ? _citation.page_first eabf4459 _citation.page_last eabf4459 _citation.title 'Structures of artificially designed discrete RNA nanoarchitectures at near-atomic resolution.' _citation.year 2021 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1126/sciadv.abf4459 _citation.pdbx_database_id_PubMed 34550747 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Liu, D.' 1 0000-0002-0708-7466 primary 'Shao, Y.' 2 ? primary 'Piccirilli, J.A.' 3 0000-0002-0541-6270 primary 'Weizmann, Y.' 4 0000-0002-3467-990X # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 7JRR _cell.details ? _cell.formula_units_Z ? _cell.length_a 40.219 _cell.length_a_esd ? _cell.length_b 40.219 _cell.length_b_esd ? _cell.length_c 202.430 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7JRR _symmetry.cell_setting ? _symmetry.Int_Tables_number 96 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 43 21 2' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (50-MER)' 16694.879 1 ? ? ? ? 2 non-polymer syn 'MAGNESIUM ION' 24.305 2 ? ? ? ? 3 non-polymer syn 'MANGANESE (II) ION' 54.938 6 ? ? ? ? 4 water nat water 18.015 46 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GTP)GACGGGAGCUGAACCAUCCAGCGAAGAACGUCCCGACGGAUGGUUCGUCG' _entity_poly.pdbx_seq_one_letter_code_can GGACGGGAGCUGAACCAUCCAGCGAAGAACGUCCCGACGGAUGGUUCGUCG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 A n 1 4 C n 1 5 G n 1 6 G n 1 7 G n 1 8 A n 1 9 G n 1 10 C n 1 11 U n 1 12 G n 1 13 A n 1 14 A n 1 15 C n 1 16 C n 1 17 A n 1 18 U n 1 19 C n 1 20 C n 1 21 A n 1 22 G n 1 23 C n 1 24 G n 1 25 A n 1 26 A n 1 27 G n 1 28 A n 1 29 A n 1 30 C n 1 31 G n 1 32 U n 1 33 C n 1 34 C n 1 35 C n 1 36 G n 1 37 A n 1 38 C n 1 39 G n 1 40 G n 1 41 A n 1 42 U n 1 43 G n 1 44 G n 1 45 U n 1 46 U n 1 47 C n 1 48 G n 1 49 U n 1 50 C n 1 51 G n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 51 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7JRR _struct_ref.pdbx_db_accession 7JRR _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7JRR _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 51 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7JRR _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 51 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 51 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 MN non-polymer . 'MANGANESE (II) ION' ? 'Mn 2' 54.938 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7JRR _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.45 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 49.83 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 7.0 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 295 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '50 mM HEPES pH 7.0, 20 of mM KCl, 5 mM of MnCl2, 35 % (v/v) MPD' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'PSI PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2016-04-11 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97918 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 24-ID-E' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97918 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 24-ID-E _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate 47.85 _reflns.entry_id 7JRR _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.0879 _reflns.d_resolution_low 40.22 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 10347 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 96.8 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 7.1 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 23.3 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.999 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.09 _reflns_shell.d_res_low 2.15 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 0.9 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 614 _reflns_shell.percent_possible_all 77.7 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 1.052 _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 2.4 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.3 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max 109.310 _refine.B_iso_mean 57.7634 _refine.B_iso_min 27.630 _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7JRR _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.1600 _refine.ls_d_res_low 28.1630 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 9320 _refine.ls_number_reflns_R_free 932 _refine.ls_number_reflns_R_work 8388 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 95.9700 _refine.ls_percent_reflns_R_free 10.0000 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2295 _refine.ls_R_factor_R_free 0.2598 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2261 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 0.000 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 'PDB ID: 2NOK' _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 29.0800 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.2900 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id final _refine_hist.details ? _refine_hist.d_res_high 2.1600 _refine_hist.d_res_low 28.1630 _refine_hist.number_atoms_solvent 46 _refine_hist.number_atoms_total 1193 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total 50 _refine_hist.pdbx_B_iso_mean_ligand 67.51 _refine_hist.pdbx_B_iso_mean_solvent 51.14 _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1107 _refine_hist.pdbx_number_atoms_ligand 40 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.005 ? 1238 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.237 ? 1929 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.048 ? 254 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.007 ? 51 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 14.628 ? 611 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 2.1600 2.2739 . . 108 1003 82.0000 . . . 0.3575 0.0000 0.3585 . . . . . . . . . . . 'X-RAY DIFFRACTION' 2.2739 2.4163 . . 129 1146 96.0000 . . . 0.3402 0.0000 0.3095 . . . . . . . . . . . 'X-RAY DIFFRACTION' 2.4163 2.6027 . . 134 1193 98.0000 . . . 0.3468 0.0000 0.3045 . . . . . . . . . . . 'X-RAY DIFFRACTION' 2.6027 2.8644 . . 137 1223 99.0000 . . . 0.3407 0.0000 0.3110 . . . . . . . . . . . 'X-RAY DIFFRACTION' 2.8644 3.2784 . . 137 1231 100.0000 . . . 0.2926 0.0000 0.2395 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.2784 4.1283 . . 140 1267 100.0000 . . . 0.2172 0.0000 0.1942 . . . . . . . . . . . 'X-RAY DIFFRACTION' 4.1283 28.1630 . . 147 1325 96.0000 . . . 0.2289 0.0000 0.1919 . . . . . . . . . . . # _struct.entry_id 7JRR _struct.title 'Crystal structures of artificially designed homomeric RNA nanoarchitectures' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7JRR _struct_keywords.text 'nano structure, dimeric parallelogram, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 3 ? E N N 3 ? F N N 3 ? G N N 3 ? H N N 3 ? I N N 2 ? J N N 4 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? A GTP 1 A G 2 1_555 ? ? ? ? ? ? ? 1.562 ? ? metalc1 metalc ? ? A GTP 1 N7 ? ? ? 1_555 D MN . MN ? ? A GTP 1 A MN 103 1_555 ? ? ? ? ? ? ? 2.518 ? ? metalc2 metalc ? ? A GTP 1 O3G ? ? ? 1_555 G MN . MN ? ? A GTP 1 A MN 106 1_555 ? ? ? ? ? ? ? 2.782 ? ? metalc3 metalc ? ? A G 7 OP2 ? ? ? 1_555 E MN . MN ? ? A G 7 A MN 104 1_555 ? ? ? ? ? ? ? 2.034 ? ? metalc4 metalc ? ? A A 13 OP1 ? ? ? 1_555 C MN . MN ? ? A A 13 A MN 102 7_555 ? ? ? ? ? ? ? 2.238 ? ? metalc5 metalc ? ? A G 39 OP2 ? ? ? 1_555 B MG . MG ? ? A G 39 A MG 101 1_555 ? ? ? ? ? ? ? 2.677 ? ? metalc6 metalc ? ? A G 40 OP1 ? ? ? 1_555 C MN . MN ? ? A G 40 A MN 102 1_555 ? ? ? ? ? ? ? 2.078 ? ? metalc7 metalc ? ? A A 41 OP1 ? ? ? 1_555 B MG . MG ? ? A A 41 A MG 101 1_555 ? ? ? ? ? ? ? 1.956 ? ? metalc8 metalc ? ? C MN . MN ? ? ? 1_555 J HOH . O ? ? A MN 102 A HOH 208 7_555 ? ? ? ? ? ? ? 2.010 ? ? metalc9 metalc ? ? D MN . MN ? ? ? 1_555 J HOH . O ? ? A MN 103 A HOH 209 1_555 ? ? ? ? ? ? ? 2.338 ? ? metalc10 metalc ? ? E MN . MN ? ? ? 1_555 J HOH . O ? ? A MN 104 A HOH 220 1_555 ? ? ? ? ? ? ? 2.014 ? ? metalc11 metalc ? ? E MN . MN ? ? ? 1_555 J HOH . O ? ? A MN 104 A HOH 223 5_444 ? ? ? ? ? ? ? 2.020 ? ? metalc12 metalc ? ? H MN . MN ? ? ? 1_555 J HOH . O ? ? A MN 107 A HOH 218 1_555 ? ? ? ? ? ? ? 2.327 ? ? metalc13 metalc ? ? I MG . MG ? ? ? 1_555 J HOH . O ? ? A MG 108 A HOH 216 5_454 ? ? ? ? ? ? ? 2.116 ? ? metalc14 metalc ? ? I MG . MG ? ? ? 1_555 J HOH . O ? ? A MG 108 A HOH 237 1_555 ? ? ? ? ? ? ? 1.882 ? ? metalc15 metalc ? ? I MG . MG ? ? ? 1_555 J HOH . O ? ? A MG 108 A HOH 246 1_555 ? ? ? ? ? ? ? 2.121 ? ? hydrog1 hydrog ? ? A GTP 1 N1 ? ? ? 1_555 A C 34 N3 ? ? A GTP 1 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A GTP 1 N2 ? ? ? 1_555 A C 34 O2 ? ? A GTP 1 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A GTP 1 O6 ? ? ? 1_555 A C 34 N4 ? ? A GTP 1 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 33 N3 ? ? A G 2 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 33 O2 ? ? A G 2 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 33 N4 ? ? A G 2 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 32 N3 ? ? A A 3 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 32 O4 ? ? A A 3 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 31 N1 ? ? A C 4 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 31 O6 ? ? A C 4 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 31 N2 ? ? A C 4 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 30 N3 ? ? A G 5 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 30 O2 ? ? A G 5 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 30 N4 ? ? A G 5 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 6 N2 ? ? ? 1_555 A A 29 N7 ? ? A G 6 A A 29 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog16 hydrog ? ? A G 6 N3 ? ? ? 1_555 A A 29 N6 ? ? A G 6 A A 29 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog17 hydrog ? ? A G 7 N2 ? ? ? 1_555 A A 28 N7 ? ? A G 7 A A 28 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog18 hydrog ? ? A G 7 N3 ? ? ? 1_555 A A 28 N6 ? ? A G 7 A A 28 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog19 hydrog ? ? A A 8 N3 ? ? ? 1_555 A G 24 N2 ? ? A A 8 A G 24 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog20 hydrog ? ? A A 8 N6 ? ? ? 1_555 A G 27 N3 ? ? A A 8 A G 27 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog21 hydrog ? ? A A 8 N7 ? ? ? 1_555 A G 27 N2 ? ? A A 8 A G 27 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog22 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 9 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 9 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 9 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 22 N1 ? ? A C 10 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 22 O6 ? ? A C 10 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 22 N2 ? ? A C 10 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 11 N3 ? ? ? 1_555 A A 21 N1 ? ? A U 11 A A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 11 O4 ? ? ? 1_555 A A 21 N6 ? ? A U 11 A A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 12 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 12 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 12 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 35 N3 ? ? ? 1_555 A G 51 N1 ? ? A C 35 A G 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 35 N4 ? ? ? 1_555 A G 51 O6 ? ? A C 35 A G 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 35 O2 ? ? ? 1_555 A G 51 N2 ? ? A C 35 A G 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 36 N1 ? ? ? 1_555 A C 50 N3 ? ? A G 36 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 36 N2 ? ? ? 1_555 A C 50 O2 ? ? A G 36 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 36 O6 ? ? ? 1_555 A C 50 N4 ? ? A G 36 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A A 37 N1 ? ? ? 1_555 A U 49 N3 ? ? A A 37 A U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A A 37 N6 ? ? ? 1_555 A U 49 O4 ? ? A A 37 A U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 38 N3 ? ? ? 1_555 A G 48 N1 ? ? A C 38 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 38 N4 ? ? ? 1_555 A G 48 O6 ? ? A C 38 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 38 O2 ? ? ? 1_555 A G 48 N2 ? ? A C 38 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 39 N1 ? ? ? 1_555 A C 47 N3 ? ? A G 39 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 39 N2 ? ? ? 1_555 A C 47 O2 ? ? A G 39 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 39 O6 ? ? ? 1_555 A C 47 N4 ? ? A G 39 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # _atom_sites.entry_id 7JRR _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.024864 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.024864 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.004940 _atom_sites.fract_transf_vector[1] 0.000000 _atom_sites.fract_transf_vector[2] 0.000000 _atom_sites.fract_transf_vector[3] 0.000000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG MN N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 C 4 4 4 C C A . n A 1 5 G 5 5 5 G G A . n A 1 6 G 6 6 6 G G A . n A 1 7 G 7 7 7 G G A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 C 10 10 10 C C A . n A 1 11 U 11 11 11 U U A . n A 1 12 G 12 12 12 G G A . n A 1 13 A 13 13 13 A A A . n A 1 14 A 14 14 14 A A A . n A 1 15 C 15 15 15 C C A . n A 1 16 C 16 16 16 C C A . n A 1 17 A 17 17 17 A A A . n A 1 18 U 18 18 18 U U A . n A 1 19 C 19 19 19 C C A . n A 1 20 C 20 20 20 C C A . n A 1 21 A 21 21 21 A A A . n A 1 22 G 22 22 22 G G A . n A 1 23 C 23 23 23 C C A . n A 1 24 G 24 24 24 G G A . n A 1 25 A 25 25 25 A A A . n A 1 26 A 26 26 26 A A A . n A 1 27 G 27 27 27 G G A . n A 1 28 A 28 28 28 A A A . n A 1 29 A 29 29 29 A A A . n A 1 30 C 30 30 30 C C A . n A 1 31 G 31 31 31 G G A . n A 1 32 U 32 32 32 U U A . n A 1 33 C 33 33 33 C C A . n A 1 34 C 34 34 34 C C A . n A 1 35 C 35 35 35 C C A . n A 1 36 G 36 36 36 G G A . n A 1 37 A 37 37 37 A A A . n A 1 38 C 38 38 38 C C A . n A 1 39 G 39 39 39 G G A . n A 1 40 G 40 40 40 G G A . n A 1 41 A 41 41 41 A A A . n A 1 42 U 42 42 42 U U A . n A 1 43 G 43 43 43 G G A . n A 1 44 G 44 44 44 G G A . n A 1 45 U 45 45 45 U U A . n A 1 46 U 46 46 46 U U A . n A 1 47 C 47 47 47 C C A . n A 1 48 G 48 48 48 G G A . n A 1 49 U 49 49 49 U U A . n A 1 50 C 50 50 50 C C A . n A 1 51 G 51 51 51 G G A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 MG 1 101 60 MG MG A . C 3 MN 1 102 61 MN MN A . D 3 MN 1 103 62 MN MN A . E 3 MN 1 104 63 MN MN A . F 3 MN 1 105 64 MN MN A . G 3 MN 1 106 65 MN MN A . H 3 MN 1 107 66 MN MN A . I 2 MG 1 108 67 MG MG A . J 4 HOH 1 201 43 HOH HOH A . J 4 HOH 2 202 8 HOH HOH A . J 4 HOH 3 203 30 HOH HOH A . J 4 HOH 4 204 16 HOH HOH A . J 4 HOH 5 205 23 HOH HOH A . J 4 HOH 6 206 44 HOH HOH A . J 4 HOH 7 207 29 HOH HOH A . J 4 HOH 8 208 36 HOH HOH A . J 4 HOH 9 209 35 HOH HOH A . J 4 HOH 10 210 10 HOH HOH A . J 4 HOH 11 211 4 HOH HOH A . J 4 HOH 12 212 42 HOH HOH A . J 4 HOH 13 213 26 HOH HOH A . J 4 HOH 14 214 31 HOH HOH A . J 4 HOH 15 215 11 HOH HOH A . J 4 HOH 16 216 40 HOH HOH A . J 4 HOH 17 217 15 HOH HOH A . J 4 HOH 18 218 34 HOH HOH A . J 4 HOH 19 219 6 HOH HOH A . J 4 HOH 20 220 3 HOH HOH A . J 4 HOH 21 221 1 HOH HOH A . J 4 HOH 22 222 28 HOH HOH A . J 4 HOH 23 223 2 HOH HOH A . J 4 HOH 24 224 27 HOH HOH A . J 4 HOH 25 225 19 HOH HOH A . J 4 HOH 26 226 21 HOH HOH A . J 4 HOH 27 227 46 HOH HOH A . J 4 HOH 28 228 41 HOH HOH A . J 4 HOH 29 229 39 HOH HOH A . J 4 HOH 30 230 12 HOH HOH A . J 4 HOH 31 231 18 HOH HOH A . J 4 HOH 32 232 20 HOH HOH A . J 4 HOH 33 233 7 HOH HOH A . J 4 HOH 34 234 22 HOH HOH A . J 4 HOH 35 235 13 HOH HOH A . J 4 HOH 36 236 24 HOH HOH A . J 4 HOH 37 237 33 HOH HOH A . J 4 HOH 38 238 32 HOH HOH A . J 4 HOH 39 239 9 HOH HOH A . J 4 HOH 40 240 38 HOH HOH A . J 4 HOH 41 241 5 HOH HOH A . J 4 HOH 42 242 17 HOH HOH A . J 4 HOH 43 243 45 HOH HOH A . J 4 HOH 44 244 25 HOH HOH A . J 4 HOH 45 245 14 HOH HOH A . J 4 HOH 46 246 37 HOH HOH A . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1,2 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 5270 ? 1 MORE -100 ? 1 'SSA (A^2)' 16690 ? # loop_ _pdbx_struct_oper_list.id _pdbx_struct_oper_list.type _pdbx_struct_oper_list.name _pdbx_struct_oper_list.symmetry_operation _pdbx_struct_oper_list.matrix[1][1] _pdbx_struct_oper_list.matrix[1][2] _pdbx_struct_oper_list.matrix[1][3] _pdbx_struct_oper_list.vector[1] _pdbx_struct_oper_list.matrix[2][1] _pdbx_struct_oper_list.matrix[2][2] _pdbx_struct_oper_list.matrix[2][3] _pdbx_struct_oper_list.vector[2] _pdbx_struct_oper_list.matrix[3][1] _pdbx_struct_oper_list.matrix[3][2] _pdbx_struct_oper_list.matrix[3][3] _pdbx_struct_oper_list.vector[3] 1 'identity operation' 1_555 x,y,z 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 2 'crystal symmetry operation' 7_555 y,x,-z 0.0000000000 1.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 -1.0000000000 0.0000000000 # loop_ _pdbx_struct_special_symmetry.id _pdbx_struct_special_symmetry.PDB_model_num _pdbx_struct_special_symmetry.auth_asym_id _pdbx_struct_special_symmetry.auth_comp_id _pdbx_struct_special_symmetry.auth_seq_id _pdbx_struct_special_symmetry.PDB_ins_code _pdbx_struct_special_symmetry.label_asym_id _pdbx_struct_special_symmetry.label_comp_id _pdbx_struct_special_symmetry.label_seq_id 1 1 A HOH 215 ? J HOH . 2 1 A HOH 238 ? J HOH . # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 N7 ? A GTP 1 ? A GTP 1 ? 1_555 MN ? D MN . ? A MN 103 ? 1_555 O ? J HOH . ? A HOH 209 ? 1_555 78.1 ? 2 OP2 ? A G 7 ? A G 7 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 O ? J HOH . ? A HOH 220 ? 1_555 87.2 ? 3 OP2 ? A G 7 ? A G 7 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 O ? J HOH . ? A HOH 223 ? 5_444 94.8 ? 4 O ? J HOH . ? A HOH 220 ? 1_555 MN ? E MN . ? A MN 104 ? 1_555 O ? J HOH . ? A HOH 223 ? 5_444 176.0 ? 5 OP1 ? A A 13 ? A A 13 ? 1_555 MN ? C MN . ? A MN 102 ? 7_555 OP1 ? A G 40 ? A G 40 ? 1_555 40.1 ? 6 OP1 ? A A 13 ? A A 13 ? 1_555 MN ? C MN . ? A MN 102 ? 7_555 O ? J HOH . ? A HOH 208 ? 7_555 36.4 ? 7 OP1 ? A G 40 ? A G 40 ? 1_555 MN ? C MN . ? A MN 102 ? 7_555 O ? J HOH . ? A HOH 208 ? 7_555 8.6 ? 8 OP2 ? A G 39 ? A G 39 ? 1_555 MG ? B MG . ? A MG 101 ? 1_555 OP1 ? A A 41 ? A A 41 ? 1_555 90.3 ? 9 O ? J HOH . ? A HOH 216 ? 5_454 MG ? I MG . ? A MG 108 ? 1_555 O ? J HOH . ? A HOH 237 ? 1_555 168.4 ? 10 O ? J HOH . ? A HOH 216 ? 5_454 MG ? I MG . ? A MG 108 ? 1_555 O ? J HOH . ? A HOH 246 ? 1_555 91.0 ? 11 O ? J HOH . ? A HOH 237 ? 1_555 MG ? I MG . ? A MG 108 ? 1_555 O ? J HOH . ? A HOH 246 ? 1_555 78.5 ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2021-09-08 2 'Structure model' 1 1 2021-10-06 3 'Structure model' 1 2 2023-10-18 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' chem_comp_atom 4 3 'Structure model' chem_comp_bond 5 3 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_CSD' 4 2 'Structure model' '_citation.journal_id_ISSN' 5 2 'Structure model' '_citation.journal_volume' 6 2 'Structure model' '_citation.page_first' 7 2 'Structure model' '_citation.page_last' 8 2 'Structure model' '_citation.pdbx_database_id_DOI' 9 2 'Structure model' '_citation.pdbx_database_id_PubMed' 10 2 'Structure model' '_citation.title' 11 2 'Structure model' '_citation.year' 12 2 'Structure model' '_citation_author.identifier_ORCID' # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.11.1_2575 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? 718 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? 718 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.11.1_2575 4 # _pdbx_entry_details.entry_id 7JRR _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest N # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 O A HOH 217 ? ? O A HOH 242 ? ? 1.83 2 1 OP1 A C 16 ? ? O A HOH 201 ? ? 1.90 3 1 O A HOH 228 ? ? O A HOH 242 ? ? 1.95 4 1 O A HOH 241 ? ? O A HOH 242 ? ? 1.95 5 1 "O2'" A C 10 ? ? O A HOH 202 ? ? 2.01 6 1 OP1 A C 33 ? ? O A HOH 203 ? ? 2.15 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C3'" A GTP 1 ? ? "O3'" A GTP 1 ? ? P A G 2 ? ? 143.20 119.70 23.50 1.20 Y 2 1 "O3'" A GTP 1 ? ? P A G 2 ? ? "O5'" A G 2 ? ? 79.69 104.00 -24.31 1.90 Y 3 1 "O3'" A GTP 1 ? ? P A G 2 ? ? OP2 A G 2 ? ? 72.74 105.20 -32.46 2.20 Y 4 1 "O3'" A GTP 1 ? ? P A G 2 ? ? OP1 A G 2 ? ? 74.52 105.20 -30.68 2.20 Y 5 1 N1 A A 25 ? ? C6 A A 25 ? ? N6 A A 25 ? ? 122.22 118.60 3.62 0.60 N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GTP PG P N N 111 GTP O1G O N N 112 GTP O2G O N N 113 GTP O3G O N N 114 GTP O3B O N N 115 GTP PB P N N 116 GTP O1B O N N 117 GTP O2B O N N 118 GTP O3A O N N 119 GTP PA P N N 120 GTP O1A O N N 121 GTP O2A O N N 122 GTP "O5'" O N N 123 GTP "C5'" C N N 124 GTP "C4'" C N R 125 GTP "O4'" O N N 126 GTP "C3'" C N S 127 GTP "O3'" O N N 128 GTP "C2'" C N R 129 GTP "O2'" O N N 130 GTP "C1'" C N R 131 GTP N9 N Y N 132 GTP C8 C Y N 133 GTP N7 N Y N 134 GTP C5 C Y N 135 GTP C6 C N N 136 GTP O6 O N N 137 GTP N1 N N N 138 GTP C2 C N N 139 GTP N2 N N N 140 GTP N3 N N N 141 GTP C4 C Y N 142 GTP HOG2 H N N 143 GTP HOG3 H N N 144 GTP HOB2 H N N 145 GTP HOA2 H N N 146 GTP "H5'" H N N 147 GTP "H5''" H N N 148 GTP "H4'" H N N 149 GTP "H3'" H N N 150 GTP "HO3'" H N N 151 GTP "H2'" H N N 152 GTP "HO2'" H N N 153 GTP "H1'" H N N 154 GTP H8 H N N 155 GTP HN1 H N N 156 GTP HN21 H N N 157 GTP HN22 H N N 158 HOH O O N N 159 HOH H1 H N N 160 HOH H2 H N N 161 MG MG MG N N 162 MN MN MN N N 163 U OP3 O N N 164 U P P N N 165 U OP1 O N N 166 U OP2 O N N 167 U "O5'" O N N 168 U "C5'" C N N 169 U "C4'" C N R 170 U "O4'" O N N 171 U "C3'" C N S 172 U "O3'" O N N 173 U "C2'" C N R 174 U "O2'" O N N 175 U "C1'" C N R 176 U N1 N N N 177 U C2 C N N 178 U O2 O N N 179 U N3 N N N 180 U C4 C N N 181 U O4 O N N 182 U C5 C N N 183 U C6 C N N 184 U HOP3 H N N 185 U HOP2 H N N 186 U "H5'" H N N 187 U "H5''" H N N 188 U "H4'" H N N 189 U "H3'" H N N 190 U "HO3'" H N N 191 U "H2'" H N N 192 U "HO2'" H N N 193 U "H1'" H N N 194 U H3 H N N 195 U H5 H N N 196 U H6 H N N 197 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GTP PG O1G doub N N 116 GTP PG O2G sing N N 117 GTP PG O3G sing N N 118 GTP PG O3B sing N N 119 GTP O2G HOG2 sing N N 120 GTP O3G HOG3 sing N N 121 GTP O3B PB sing N N 122 GTP PB O1B doub N N 123 GTP PB O2B sing N N 124 GTP PB O3A sing N N 125 GTP O2B HOB2 sing N N 126 GTP O3A PA sing N N 127 GTP PA O1A doub N N 128 GTP PA O2A sing N N 129 GTP PA "O5'" sing N N 130 GTP O2A HOA2 sing N N 131 GTP "O5'" "C5'" sing N N 132 GTP "C5'" "C4'" sing N N 133 GTP "C5'" "H5'" sing N N 134 GTP "C5'" "H5''" sing N N 135 GTP "C4'" "O4'" sing N N 136 GTP "C4'" "C3'" sing N N 137 GTP "C4'" "H4'" sing N N 138 GTP "O4'" "C1'" sing N N 139 GTP "C3'" "O3'" sing N N 140 GTP "C3'" "C2'" sing N N 141 GTP "C3'" "H3'" sing N N 142 GTP "O3'" "HO3'" sing N N 143 GTP "C2'" "O2'" sing N N 144 GTP "C2'" "C1'" sing N N 145 GTP "C2'" "H2'" sing N N 146 GTP "O2'" "HO2'" sing N N 147 GTP "C1'" N9 sing N N 148 GTP "C1'" "H1'" sing N N 149 GTP N9 C8 sing Y N 150 GTP N9 C4 sing Y N 151 GTP C8 N7 doub Y N 152 GTP C8 H8 sing N N 153 GTP N7 C5 sing Y N 154 GTP C5 C6 sing N N 155 GTP C5 C4 doub Y N 156 GTP C6 O6 doub N N 157 GTP C6 N1 sing N N 158 GTP N1 C2 sing N N 159 GTP N1 HN1 sing N N 160 GTP C2 N2 sing N N 161 GTP C2 N3 doub N N 162 GTP N2 HN21 sing N N 163 GTP N2 HN22 sing N N 164 GTP N3 C4 sing N N 165 HOH O H1 sing N N 166 HOH O H2 sing N N 167 U OP3 P sing N N 168 U OP3 HOP3 sing N N 169 U P OP1 doub N N 170 U P OP2 sing N N 171 U P "O5'" sing N N 172 U OP2 HOP2 sing N N 173 U "O5'" "C5'" sing N N 174 U "C5'" "C4'" sing N N 175 U "C5'" "H5'" sing N N 176 U "C5'" "H5''" sing N N 177 U "C4'" "O4'" sing N N 178 U "C4'" "C3'" sing N N 179 U "C4'" "H4'" sing N N 180 U "O4'" "C1'" sing N N 181 U "C3'" "O3'" sing N N 182 U "C3'" "C2'" sing N N 183 U "C3'" "H3'" sing N N 184 U "O3'" "HO3'" sing N N 185 U "C2'" "O2'" sing N N 186 U "C2'" "C1'" sing N N 187 U "C2'" "H2'" sing N N 188 U "O2'" "HO2'" sing N N 189 U "C1'" N1 sing N N 190 U "C1'" "H1'" sing N N 191 U N1 C2 sing N N 192 U N1 C6 sing N N 193 U C2 O2 doub N N 194 U C2 N3 sing N N 195 U N3 C4 sing N N 196 U N3 H3 sing N N 197 U C4 O4 doub N N 198 U C4 C5 sing N N 199 U C5 C6 doub N N 200 U C5 H5 sing N N 201 U C6 H6 sing N N 202 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7JRR 'double helix' 7JRR 'a-form double helix' 7JRR 'hairpin loop' 7JRR 'mismatched base pair' 7JRR 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 27 1_555 A A 8 1_555 6.531 -4.531 0.349 17.514 23.153 4.495 1 A_G27:A8_A A 27 ? A 8 ? 11 10 1 A A 28 1_555 A G 7 1_555 -6.454 -4.751 0.653 -22.838 -3.073 1.910 2 A_A28:G7_A A 28 ? A 7 ? 11 10 1 A A 29 1_555 A G 6 1_555 -6.639 -3.999 0.097 6.628 -10.521 -2.588 3 A_A29:G6_A A 29 ? A 6 ? 11 10 1 A C 30 1_555 A G 5 1_555 -0.231 -0.209 -0.285 5.992 -13.329 -0.370 4 A_C30:G5_A A 30 ? A 5 ? 19 1 1 A G 31 1_555 A C 4 1_555 -0.251 -0.242 0.101 5.463 -6.744 1.016 5 A_G31:C4_A A 31 ? A 4 ? 19 1 1 A U 32 1_555 A A 3 1_555 -0.058 -0.162 0.172 4.009 -9.700 6.708 6 A_U32:A3_A A 32 ? A 3 ? 20 1 1 A C 33 1_555 A G 2 1_555 0.239 -0.166 -0.281 6.352 -12.482 6.420 7 A_C33:G2_A A 33 ? A 2 ? 19 1 1 A C 34 1_555 A GTP 1 1_555 0.683 -0.211 -0.041 -2.935 -8.076 -5.839 8 A_C34:GTP1_A A 34 ? A 1 ? 19 1 1 A C 35 1_555 A G 51 1_555 0.593 0.055 0.137 -5.272 -6.491 8.616 9 A_C35:G51_A A 35 ? A 51 ? 19 1 1 A G 36 1_555 A C 50 1_555 -0.011 -0.100 0.056 -1.783 -15.599 -0.410 10 A_G36:C50_A A 36 ? A 50 ? 19 1 1 A A 37 1_555 A U 49 1_555 0.227 0.222 0.505 -1.251 -10.303 8.918 11 A_A37:U49_A A 37 ? A 49 ? 20 1 1 A C 38 1_555 A G 48 1_555 0.076 -0.374 0.089 -2.098 -8.944 2.734 12 A_C38:G48_A A 38 ? A 48 ? 19 1 1 A G 39 1_555 A C 47 1_555 -0.061 -0.412 0.319 -2.380 -6.685 -2.583 13 A_G39:C47_A A 39 ? A 47 ? 19 1 1 A G 9 1_555 A C 23 1_555 -0.147 -0.287 -0.351 -1.535 -1.433 -0.660 14 A_G9:C23_A A 9 ? A 23 ? 19 1 1 A C 10 1_555 A G 22 1_555 0.372 -0.259 -0.436 3.357 -8.456 -0.431 15 A_C10:G22_A A 10 ? A 22 ? 19 1 1 A U 11 1_555 A A 21 1_555 0.185 -0.078 0.090 -6.619 -11.422 9.512 16 A_U11:A21_A A 11 ? A 21 ? 20 1 1 A G 12 1_555 A C 20 1_555 -0.128 -0.109 0.022 -0.544 -15.760 -0.408 17 A_G12:C20_A A 12 ? A 20 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 27 1_555 A A 8 1_555 A A 28 1_555 A G 7 1_555 -0.903 -1.440 4.467 -4.773 -9.011 -10.608 14.668 -8.316 2.055 38.868 -20.589 -14.704 1 AA_G27A28:G7A8_AA A 27 ? A 8 ? A 28 ? A 7 ? 1 A A 28 1_555 A G 7 1_555 A A 29 1_555 A G 6 1_555 0.048 -1.002 2.883 -10.534 4.577 29.585 -2.560 -1.755 2.539 8.568 19.718 31.690 2 AA_A28A29:G6G7_AA A 28 ? A 7 ? A 29 ? A 6 ? 1 A A 29 1_555 A G 6 1_555 A C 30 1_555 A G 5 1_555 0.503 -0.725 3.447 0.125 6.627 62.663 -1.003 -0.475 3.364 6.353 -0.120 62.977 3 AA_A29C30:G5G6_AA A 29 ? A 6 ? A 30 ? A 5 ? 1 A C 30 1_555 A G 5 1_555 A G 31 1_555 A C 4 1_555 -0.623 -1.874 3.317 -4.032 11.726 25.083 -6.410 0.422 2.298 25.133 8.642 27.937 4 AA_C30G31:C4G5_AA A 30 ? A 5 ? A 31 ? A 4 ? 1 A G 31 1_555 A C 4 1_555 A U 32 1_555 A A 3 1_555 -0.083 -1.453 3.379 -3.110 10.130 31.364 -4.213 -0.363 2.784 18.104 5.557 33.063 5 AA_G31U32:A3C4_AA A 31 ? A 4 ? A 32 ? A 3 ? 1 A U 32 1_555 A A 3 1_555 A C 33 1_555 A G 2 1_555 0.369 -1.469 3.077 3.788 8.465 33.413 -3.632 -0.099 2.662 14.382 -6.436 34.641 6 AA_U32C33:G2A3_AA A 32 ? A 3 ? A 33 ? A 2 ? 1 A C 33 1_555 A G 2 1_555 A C 34 1_555 A GTP 1 1_555 0.185 -1.802 3.381 2.950 8.997 36.899 -3.875 0.081 2.884 13.934 -4.569 38.054 7 AA_C33C34:GTP1G2_AA A 33 ? A 2 ? A 34 ? A 1 ? 1 A C 34 1_555 A GTP 1 1_555 A C 35 1_555 A G 51 1_555 -1.139 -2.551 3.246 0.962 9.494 10.761 -16.097 5.150 0.677 41.462 -4.202 14.373 8 AA_C34C35:G51GTP1_AA A 34 ? A 1 ? A 35 ? A 51 ? 1 A C 35 1_555 A G 51 1_555 A G 36 1_555 A C 50 1_555 -0.226 -1.750 3.095 -0.429 10.148 29.996 -4.829 0.346 2.393 18.935 0.800 31.632 9 AA_C35G36:C50G51_AA A 35 ? A 51 ? A 36 ? A 50 ? 1 A G 36 1_555 A C 50 1_555 A A 37 1_555 A U 49 1_555 0.189 -1.360 3.113 -1.674 0.459 34.127 -2.384 -0.573 3.082 0.782 2.850 34.169 10 AA_G36A37:U49C50_AA A 36 ? A 50 ? A 37 ? A 49 ? 1 A A 37 1_555 A U 49 1_555 A C 38 1_555 A G 48 1_555 -0.191 -1.549 3.235 4.537 4.079 30.834 -3.592 1.165 2.953 7.580 -8.430 31.417 11 AA_A37C38:G48U49_AA A 37 ? A 49 ? A 38 ? A 48 ? 1 A C 38 1_555 A G 48 1_555 A G 39 1_555 A C 47 1_555 0.215 -1.719 3.076 3.449 15.364 30.563 -4.910 0.084 2.019 27.013 -6.064 34.294 12 AA_C38G39:C47G48_AA A 38 ? A 48 ? A 39 ? A 47 ? 1 A G 9 1_555 A C 23 1_555 A C 10 1_555 A G 22 1_555 -0.373 -2.258 3.244 0.825 2.295 29.844 -4.829 0.886 3.055 4.447 -1.598 29.941 13 AA_G9C10:G22C23_AA A 9 ? A 23 ? A 10 ? A 22 ? 1 A C 10 1_555 A G 22 1_555 A U 11 1_555 A A 21 1_555 -0.080 -1.787 3.579 -3.124 8.647 28.692 -5.243 -0.497 2.921 16.909 6.109 30.100 14 AA_C10U11:A21G22_AA A 10 ? A 22 ? A 11 ? A 21 ? 1 A U 11 1_555 A A 21 1_555 A G 12 1_555 A C 20 1_555 -0.688 -1.454 3.210 3.345 8.114 28.459 -4.378 1.977 2.609 16.029 -6.609 29.755 15 AA_U11G12:C20A21_AA A 11 ? A 21 ? A 12 ? A 20 ? # _pdbx_audit_support.funding_organization 'National Science Foundation (NSF, United States)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number 1555361 _pdbx_audit_support.ordinal 1 # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'MAGNESIUM ION' MG 3 'MANGANESE (II) ION' MN 4 water HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 2NOK _pdbx_initial_refinement_model.details 'PDB ID: 2NOK' # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details ? #