data_7K4L # _entry.id 7K4L # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7K4L pdb_00007k4l 10.2210/pdb7k4l/pdb WWPDB D_1000251721 ? ? BMRB 30797 ? 10.13018/BMR30797 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2021-09-29 2 'Structure model' 1 1 2022-04-13 3 'Structure model' 1 2 2023-06-14 4 'Structure model' 1 3 2024-05-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Structure summary' 2 3 'Structure model' Other 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' struct 2 3 'Structure model' pdbx_database_status 3 4 'Structure model' chem_comp_atom 4 4 'Structure model' chem_comp_bond 5 4 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_struct.title' 2 3 'Structure model' '_pdbx_database_status.status_code_nmr_data' 3 4 'Structure model' '_database_2.pdbx_DOI' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.entry_id 7K4L _pdbx_database_status.recvd_initial_deposition_date 2020-09-15 _pdbx_database_status.SG_entry Y _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs REL _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name BMRB _pdbx_database_related.details ;Dengue 5'UTR SLA ; _pdbx_database_related.db_id 30797 _pdbx_database_related.content_type unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Sun, Y.T.' 1 0000-0001-6196-1727 'Varani, G.' 2 0000-0001-6642-7144 'Seattle Structural Genomics Center for Infectious Disease (SSGCID)' 3 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title ;Solution NMR Structure of Denv1 5'UTR SLA region ; _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Sun, Y.T.' 1 0000-0001-6196-1727 primary 'Varani, G.' 2 0000-0001-6642-7144 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'DenvSLA RNA' _entity.formula_weight 11521.802 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGAGUGGUUAGUCUACGUUUCGACGUAGUUCUAACC _entity_poly.pdbx_seq_one_letter_code_can GGAGUGGUUAGUCUACGUUUCGACGUAGUUCUAACC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 G n 1 5 U n 1 6 G n 1 7 G n 1 8 U n 1 9 U n 1 10 A n 1 11 G n 1 12 U n 1 13 C n 1 14 U n 1 15 A n 1 16 C n 1 17 G n 1 18 U n 1 19 U n 1 20 U n 1 21 C n 1 22 G n 1 23 A n 1 24 C n 1 25 G n 1 26 U n 1 27 A n 1 28 G n 1 29 U n 1 30 U n 1 31 C n 1 32 U n 1 33 A n 1 34 A n 1 35 C n 1 36 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 36 _pdbx_entity_src_syn.organism_scientific 'Escherichia phage T7' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 10760 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G GUA A . n A 1 2 G 2 2 2 G GUA A . n A 1 3 A 3 3 3 A ADE A . n A 1 4 G 4 4 4 G GUA A . n A 1 5 U 5 5 5 U URI A . n A 1 6 G 6 6 6 G GUA A . n A 1 7 G 7 7 7 G GUA A . n A 1 8 U 8 8 8 U URI A . n A 1 9 U 9 9 9 U URI A . n A 1 10 A 10 10 10 A ADE A . n A 1 11 G 11 11 11 G GUA A . n A 1 12 U 12 12 12 U URI A . n A 1 13 C 13 13 13 C CYT A . n A 1 14 U 14 14 14 U URI A . n A 1 15 A 15 15 15 A ADE A . n A 1 16 C 16 16 16 C CYT A . n A 1 17 G 17 17 17 G GUA A . n A 1 18 U 18 18 18 U URI A . n A 1 19 U 19 19 19 U URI A . n A 1 20 U 20 20 20 U URI A . n A 1 21 C 21 21 21 C CYT A . n A 1 22 G 22 22 22 G GUA A . n A 1 23 A 23 23 23 A ADE A . n A 1 24 C 24 24 24 C CYT A . n A 1 25 G 25 25 25 G GUA A . n A 1 26 U 26 26 26 U URI A . n A 1 27 A 27 27 27 A ADE A . n A 1 28 G 28 28 28 G GUA A . n A 1 29 U 29 29 29 U URI A . n A 1 30 U 30 30 30 U URI A . n A 1 31 C 31 31 31 C CYT A . n A 1 32 U 32 32 32 U URI A . n A 1 33 A 33 33 33 A ADE A . n A 1 34 A 34 34 34 A ADE A . n A 1 35 C 35 35 35 C CYT A . n A 1 36 C 36 36 36 C CYT A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7K4L _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 7K4L _struct.title 'DENV1 SLA bottom stem RNA (DenvBS)' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7K4L _struct_keywords.text ;Denv1, 5'-UTR, RNA, Structural Genomics, Seattle Structural Genomics Center for Infectious Disease, SSGCID ; _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7K4L _struct_ref.pdbx_db_accession 7K4L _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7K4L _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 36 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7K4L _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 36 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 36 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 36 N3 ? ? A G 6 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 36 O2 ? ? A G 6 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 36 N4 ? ? A G 6 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 7 N1 ? ? ? 1_555 A C 35 N3 ? ? A G 7 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 7 N2 ? ? ? 1_555 A C 35 O2 ? ? A G 7 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 7 O6 ? ? ? 1_555 A C 35 N4 ? ? A G 7 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 34 N1 ? ? A U 8 A A 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 34 N6 ? ? A U 8 A A 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 33 N1 ? ? A U 9 A A 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 9 O4 ? ? ? 1_555 A A 33 N6 ? ? A U 9 A A 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 10 N1 ? ? ? 1_555 A U 32 N3 ? ? A A 10 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 10 N6 ? ? ? 1_555 A U 32 O4 ? ? A A 10 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 11 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 11 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 11 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 28 O6 ? ? A C 13 A G 28 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog17 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 27 N1 ? ? A U 14 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 27 N6 ? ? A U 14 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A A 15 N1 ? ? ? 1_555 A U 26 N3 ? ? A A 15 A U 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A A 15 N6 ? ? ? 1_555 A U 26 O4 ? ? A A 15 A U 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 16 N3 ? ? ? 1_555 A G 25 N1 ? ? A C 16 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 16 N4 ? ? ? 1_555 A G 25 O6 ? ? A C 16 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 16 O2 ? ? ? 1_555 A G 25 N2 ? ? A C 16 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 17 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 17 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 17 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 17 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 17 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 17 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A U 18 N3 ? ? ? 1_555 A A 23 N1 ? ? A U 18 A A 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 18 O4 ? ? ? 1_555 A A 23 N6 ? ? A U 18 A A 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 19 O2 ? ? ? 1_555 A G 22 N1 ? ? A U 19 A G 22 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_SG_project.full_name_of_center 'Seattle Structural Genomics Center for Infectious Disease' _pdbx_SG_project.id 1 _pdbx_SG_project.initial_of_center SSGCID _pdbx_SG_project.project_name 'NIAID, National Institute of Allergy and Infectious Diseases' # _pdbx_nmr_ensemble.entry_id 7K4L _pdbx_nmr_ensemble.conformers_calculated_total_number 400 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 7K4L _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 '200 uM DenvSLA, 10 mM potassium phosphate, 10 mM potassium chloride, 90% H2O/10% D2O' '90% H2O/10% D2O' 1H solution ? 2 '200 uM [U-100% 2H] DenvSLA, 10 mM potassium phosphate, 10 mM potassium chloride, 90% H2O/10% D2O' '90% H2O/10% D2O' Deuterated solution ? # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 DenvSLA 200 ? uM 'natural abundance' 1 'potassium phosphate' 10 ? mM 'natural abundance' 1 'potassium chloride' 10 ? mM 'natural abundance' 2 DenvSLA 200 ? uM '[U-100% 2H]' 2 'potassium phosphate' 10 ? mM 'natural abundance' 2 'potassium chloride' 10 ? mM 'natural abundance' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 6.5 _pdbx_nmr_exptl_sample_conditions.ionic_strength 40 _pdbx_nmr_exptl_sample_conditions.details ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_err ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_units mM _pdbx_nmr_exptl_sample_conditions.label Kphos _pdbx_nmr_exptl_sample_conditions.pH_err ? _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.pressure_err ? _pdbx_nmr_exptl_sample_conditions.temperature_err ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 2 '2D 1H-1H TOCSY' 1 isotropic 2 1 2 '2D 1H-1H NOESY' 1 isotropic 3 1 1 '2D 1H-1H NOESY' 2 isotropic 4 1 1 '2D 1H-1H TOCSY' 2 isotropic # _pdbx_nmr_refine.entry_id 7K4L _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 2 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 processing TopSpin ? 'Bruker Biospin' 2 refinement 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' 3 'chemical shift assignment' NMRFAM-SPARKY ? 'Lee W, Tonelli M, Markley JL' 4 'structure calculation' 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7K4L 'double helix' 7K4L 'a-form double helix' 7K4L tetraloop 7K4L 'mismatched base pair' 7K4L 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 6 1_555 A C 36 1_555 -0.102 -0.014 0.049 4.356 -12.100 2.410 1 A_G6:C36_A A 6 ? A 36 ? 19 1 1 A G 7 1_555 A C 35 1_555 -0.209 -0.055 0.033 -1.647 -13.190 5.338 2 A_G7:C35_A A 7 ? A 35 ? 19 1 1 A U 8 1_555 A A 34 1_555 0.057 -0.167 0.058 -0.415 -12.401 3.623 3 A_U8:A34_A A 8 ? A 34 ? 20 1 1 A U 9 1_555 A A 33 1_555 0.065 -0.172 -0.023 0.658 -7.732 3.070 4 A_U9:A33_A A 9 ? A 33 ? 20 1 1 A A 10 1_555 A U 32 1_555 0.005 -0.142 -0.033 -0.487 -7.035 3.122 5 A_A10:U32_A A 10 ? A 32 ? 20 1 1 A G 11 1_555 A C 31 1_555 -0.140 -0.075 0.061 -2.524 -10.234 4.304 6 A_G11:C31_A A 11 ? A 31 ? 19 1 1 A C 13 1_555 A G 28 1_555 0.392 0.684 -0.653 12.028 -4.391 -15.860 7 A_C13:G28_A A 13 ? A 28 ? ? ? 1 A U 14 1_555 A A 27 1_555 0.043 0.090 -0.296 10.368 -10.877 -9.145 8 A_U14:A27_A A 14 ? A 27 ? 20 1 1 A A 15 1_555 A U 26 1_555 -0.116 -0.246 0.010 1.962 -13.519 -5.923 9 A_A15:U26_A A 15 ? A 26 ? 20 1 1 A C 16 1_555 A G 25 1_555 0.202 -0.102 0.027 1.756 -15.827 2.129 10 A_C16:G25_A A 16 ? A 25 ? 19 1 1 A G 17 1_555 A C 24 1_555 -0.300 -0.042 -0.084 -3.169 -10.261 2.955 11 A_G17:C24_A A 17 ? A 24 ? 19 1 1 A U 18 1_555 A A 23 1_555 0.541 -0.262 0.061 0.559 -3.027 1.869 12 A_U18:A23_A A 18 ? A 23 ? 20 1 1 A U 19 1_555 A G 22 1_555 -0.034 -2.780 -1.172 -21.322 -3.168 -112.534 13 A_U19:G22_A A 19 ? A 22 ? ? 6 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 6 1_555 A C 36 1_555 A G 7 1_555 A C 35 1_555 0.122 -1.668 3.274 -1.969 13.239 29.852 -5.027 -0.524 2.332 24.225 3.603 32.653 1 AA_G6G7:C35C36_AA A 6 ? A 36 ? A 7 ? A 35 ? 1 A G 7 1_555 A C 35 1_555 A U 8 1_555 A A 34 1_555 -0.141 -1.499 3.279 -0.988 6.599 31.734 -3.799 0.085 2.919 11.903 1.783 32.410 2 AA_G7U8:A34C35_AA A 7 ? A 35 ? A 8 ? A 34 ? 1 A U 8 1_555 A A 34 1_555 A U 9 1_555 A A 33 1_555 -0.033 -1.517 3.255 -0.295 8.714 30.861 -4.214 0.009 2.736 15.980 0.542 32.040 3 AA_U8U9:A33A34_AA A 8 ? A 34 ? A 9 ? A 33 ? 1 A U 9 1_555 A A 33 1_555 A A 10 1_555 A U 32 1_555 -0.011 -1.469 3.280 0.266 9.183 30.511 -4.255 0.065 2.733 16.973 -0.492 31.833 4 AA_U9A10:U32A33_AA A 9 ? A 33 ? A 10 ? A 32 ? 1 A A 10 1_555 A U 32 1_555 A G 11 1_555 A C 31 1_555 -0.021 -1.601 3.331 -0.985 10.600 29.541 -4.832 -0.135 2.614 19.987 1.858 31.361 5 AA_A10G11:C31U32_AA A 10 ? A 32 ? A 11 ? A 31 ? 1 A C 13 1_555 A G 28 1_555 A U 14 1_555 A A 27 1_555 0.070 -1.753 3.367 -2.443 7.594 30.255 -4.640 -0.576 2.840 14.240 4.581 31.265 6 AA_C13U14:A27G28_AA A 13 ? A 28 ? A 14 ? A 27 ? 1 A U 14 1_555 A A 27 1_555 A A 15 1_555 A U 26 1_555 -0.036 -1.566 3.499 -3.256 5.668 33.200 -3.636 -0.480 3.185 9.802 5.630 33.819 7 AA_U14A15:U26A27_AA A 14 ? A 27 ? A 15 ? A 26 ? 1 A A 15 1_555 A U 26 1_555 A C 16 1_555 A G 25 1_555 0.217 -1.477 3.308 -0.299 3.254 34.502 -2.976 -0.410 3.157 5.470 0.502 34.652 8 AA_A15C16:G25U26_AA A 15 ? A 26 ? A 16 ? A 25 ? 1 A C 16 1_555 A G 25 1_555 A G 17 1_555 A C 24 1_555 0.032 -1.722 3.258 -0.703 12.599 28.755 -5.301 -0.177 2.317 23.965 1.337 31.348 9 AA_C16G17:C24G25_AA A 16 ? A 25 ? A 17 ? A 24 ? 1 A G 17 1_555 A C 24 1_555 A U 18 1_555 A A 23 1_555 -0.070 -1.527 3.260 -2.862 10.000 31.311 -4.273 -0.329 2.656 17.919 5.128 32.953 10 AA_G17U18:A23C24_AA A 17 ? A 24 ? A 18 ? A 23 ? 1 A U 18 1_555 A A 23 1_555 A U 19 1_555 A G 22 1_555 -0.639 -1.449 3.609 27.749 15.654 85.360 -1.363 1.053 3.097 11.219 -19.886 90.030 11 AA_U18U19:G22A23_AA A 18 ? A 23 ? A 19 ? A 22 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 'AVANCE II' ? Bruker 600 ? 2 'AVANCE II' ? Bruker 500 ? # _atom_sites.entry_id 7K4L _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_