data_7KJU # _entry.id 7KJU # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7KJU pdb_00007kju 10.2210/pdb7kju/pdb WWPDB D_1000252534 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7KJU _pdbx_database_status.recvd_initial_deposition_date 2020-10-26 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Ceccarelli, D.F.' 1 0000-0002-2674-9234 'Beenstock, J.' 2 0000-0002-0417-9656 'Wan, L.C.K.' 3 ? 'Sicheri, F.' 4 0000-0002-9824-2117 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nat Commun' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2041-1723 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 11 _citation.language ? _citation.page_first 6233 _citation.page_last 6233 _citation.title 'A substrate binding model for the KEOPS tRNA modifying complex.' _citation.year 2020 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41467-020-19990-5 _citation.pdbx_database_id_PubMed 33277478 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Beenstock, J.' 1 ? primary 'Ona, S.M.' 2 ? primary 'Porat, J.' 3 ? primary 'Orlicky, S.' 4 ? primary 'Wan, L.C.K.' 5 ? primary 'Ceccarelli, D.F.' 6 0000-0002-2674-9234 primary 'Maisonneuve, P.' 7 0000-0001-8292-5741 primary 'Szilard, R.K.' 8 ? primary 'Yin, Z.' 9 ? primary 'Setiaputra, D.' 10 ? primary 'Mao, D.Y.L.' 11 ? primary 'Khan, M.' 12 ? primary 'Raval, S.' 13 ? primary 'Schriemer, D.C.' 14 0000-0002-5202-1618 primary 'Bayfield, M.A.' 15 ? primary 'Durocher, D.' 16 0000-0003-3863-8635 primary 'Sicheri, F.' 17 0000-0002-9824-2117 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 7KJU _cell.details ? _cell.formula_units_Z ? _cell.length_a 100.493 _cell.length_a_esd ? _cell.length_b 168.527 _cell.length_b_esd ? _cell.length_c 68.968 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7KJU _symmetry.cell_setting ? _symmetry.Int_Tables_number 21 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'C 2 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (75-MER)' 24413.467 1 ? ? ? ? 2 non-polymer syn 'MAGNESIUM ION' 24.305 4 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCCCGUAGCUCAGUCUGGCAGAGCGCCUGGCUUUUAACCAGGUGGUCGAGGGUUCAAAUCCCUUCGGGCCCGCCA _entity_poly.pdbx_seq_one_letter_code_can GGCCCGUAGCUCAGUCUGGCAGAGCGCCUGGCUUUUAACCAGGUGGUCGAGGGUUCAAAUCCCUUCGGGCCCGCCA _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 C n 1 5 C n 1 6 G n 1 7 U n 1 8 A n 1 9 G n 1 10 C n 1 11 U n 1 12 C n 1 13 A n 1 14 G n 1 15 U n 1 16 C n 1 17 U n 1 18 G n 1 19 G n 1 20 C n 1 21 A n 1 22 G n 1 23 A n 1 24 G n 1 25 C n 1 26 G n 1 27 C n 1 28 C n 1 29 U n 1 30 G n 1 31 G n 1 32 C n 1 33 U n 1 34 U n 1 35 U n 1 36 U n 1 37 A n 1 38 A n 1 39 C n 1 40 C n 1 41 A n 1 42 G n 1 43 G n 1 44 U n 1 45 G n 1 46 G n 1 47 U n 1 48 C n 1 49 G n 1 50 A n 1 51 G n 1 52 G n 1 53 G n 1 54 U n 1 55 U n 1 56 C n 1 57 A n 1 58 A n 1 59 A n 1 60 U n 1 61 C n 1 62 C n 1 63 C n 1 64 U n 1 65 U n 1 66 C n 1 67 G n 1 68 G n 1 69 G n 1 70 C n 1 71 C n 1 72 C n 1 73 G n 1 74 C n 1 75 C n 1 76 A n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 76 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Methanocaldococcus jannaschii' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 2190 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-Fluc(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905932 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type plasmid _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details 'hepatitis delta virus ribozyme ' _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name pUC19 _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # _struct_ref.id 1 _struct_ref.db_name GB _struct_ref.db_code L77117.1 _struct_ref.pdbx_db_accession 6626255 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code GGCCCGUAGCUCAGUCUGGCAGAGCGCCUGGCUUUUAACCAGGUGGUCGAGGGUUCAAAUCCCUUCGGGCCCGC _struct_ref.pdbx_align_begin 863817 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7KJU _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 74 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 6626255 _struct_ref_seq.db_align_beg 863817 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 863890 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 74 # loop_ _struct_ref_seq_dif.align_id _struct_ref_seq_dif.pdbx_pdb_id_code _struct_ref_seq_dif.mon_id _struct_ref_seq_dif.pdbx_pdb_strand_id _struct_ref_seq_dif.seq_num _struct_ref_seq_dif.pdbx_pdb_ins_code _struct_ref_seq_dif.pdbx_seq_db_name _struct_ref_seq_dif.pdbx_seq_db_accession_code _struct_ref_seq_dif.db_mon_id _struct_ref_seq_dif.pdbx_seq_db_seq_num _struct_ref_seq_dif.details _struct_ref_seq_dif.pdbx_auth_seq_num _struct_ref_seq_dif.pdbx_ordinal 1 7KJU C A 75 ? GB 6626255 ? ? insertion 75 1 1 7KJU A A 76 ? GB 6626255 ? ? insertion 76 2 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7KJU _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 5.98 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 79.43 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 6.0 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '100 mM MES, pH 6.0, 0.2 M zinc acetate, 10% PEG8000' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS3 S 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2013-11-21 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator 'double crystal Si(111)' _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97964 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'CLSI BEAMLINE 08ID-1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97964 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 08ID-1 _diffrn_source.pdbx_synchrotron_site CLSI # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 7KJU _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.1 _reflns.d_resolution_low 49.140 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 10895 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.900 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 11.800 _reflns.pdbx_Rmerge_I_obs 0.081 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 13.300 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.085 _reflns.pdbx_Rpim_I_all 0.025 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.999 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_all _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split 3.110 3.190 ? ? 7016 ? ? ? 792 100.000 ? ? ? ? 0.931 ? ? ? ? ? ? ? ? 8.900 ? ? ? 2.100 0.989 0.330 ? 1 1 0.956 ? ? 13.910 49.140 ? ? 1211 ? ? ? 127 87.200 ? ? ? ? 0.036 ? ? ? ? ? ? ? ? 9.500 ? ? ? 36.800 0.038 0.012 ? 2 1 0.999 ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max 432.370 _refine.B_iso_mean 181.6269 _refine.B_iso_min 37.960 _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7KJU _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.1020 _refine.ls_d_res_low 49.0340 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 10765 _refine.ls_number_reflns_R_free 603 _refine.ls_number_reflns_R_work 10162 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 97.9700 _refine.ls_percent_reflns_R_free 5.6000 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2492 _refine.ls_R_factor_R_free 0.2665 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2481 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.340 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 'PDB entry 3L0U' _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 42.1900 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.3000 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id final _refine_hist.details ? _refine_hist.d_res_high 3.1020 _refine_hist.d_res_low 49.0340 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 1598 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total 75 _refine_hist.pdbx_B_iso_mean_ligand 108.37 _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1594 _refine_hist.pdbx_number_atoms_ligand 4 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 3.1022 3.4144 . . 146 2400 94.0000 . . . 0.3007 0.0000 0.3211 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.4144 3.9082 . . 151 2513 99.0000 . . . 0.3343 0.0000 0.2801 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.9082 4.9232 . . 131 2595 100.0000 . . . 0.2688 0.0000 0.2697 . . . . . . . . . . . 'X-RAY DIFFRACTION' 4.9232 49.03 . . 175 2654 99.0000 . . . 0.2499 0.0000 0.2235 . . . . . . . . . . . # _struct.entry_id 7KJU _struct.title 'Cgi121-tRNA complex' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7KJU _struct_keywords.text 'KEOPS, tRNA, Cgi121, RNA modifying enzyme, N6-threonylcarbamoyl adenosine, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 2 ? E N N 2 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A A 21 OP2 ? ? ? 1_555 D MG . MG ? ? A A 21 A MG 103 1_555 ? ? ? ? ? ? ? 2.631 ? ? metalc2 metalc ? ? A A 59 OP1 ? ? ? 1_555 D MG . MG ? ? A A 59 A MG 103 1_555 ? ? ? ? ? ? ? 2.979 ? ? hydrog1 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 72 N4 ? ? A G 1 A C 72 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog2 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 71 N3 ? ? A G 2 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 71 O2 ? ? A G 2 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 71 N4 ? ? A G 2 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 3 N4 ? ? ? 1_555 A C 70 N3 ? ? A C 3 A C 70 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ? ? ? hydrog6 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 69 N1 ? ? A C 4 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 69 O6 ? ? A C 4 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 69 N2 ? ? A C 4 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 68 N1 ? ? A C 5 A G 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 68 O6 ? ? A C 5 A G 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 68 N2 ? ? A C 5 A G 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 6 N1 ? ? ? 1_555 A G 67 O6 ? ? A G 6 A G 67 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog13 hydrog ? ? A U 7 O4 ? ? ? 1_555 A C 66 N4 ? ? A U 7 A C 66 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog14 hydrog ? ? A G 9 N7 ? ? ? 1_555 A A 23 N6 ? ? A G 9 A A 23 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog15 hydrog ? ? A C 10 N4 ? ? ? 1_555 A C 25 N3 ? ? A C 10 A C 25 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ? ? ? hydrog16 hydrog ? ? A U 11 O4 ? ? ? 1_555 A G 24 N1 ? ? A U 11 A G 24 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog17 hydrog ? ? A U 11 N3 ? ? ? 1_555 A C 25 O2 ? ? A U 11 A C 25 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog18 hydrog ? ? A A 13 N1 ? ? ? 1_555 A G 22 N1 ? ? A A 13 A G 22 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog19 hydrog ? ? A A 13 N6 ? ? ? 1_555 A G 22 O6 ? ? A A 13 A G 22 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog20 hydrog ? ? A G 18 N1 ? ? ? 1_555 A U 55 O2 ? ? A G 18 A U 55 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog21 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 56 N3 ? ? A G 19 A C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 56 O2 ? ? A G 19 A C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 56 N4 ? ? A G 19 A C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 22 N7 ? ? ? 1_555 A G 46 N1 ? ? A G 22 A G 46 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog25 hydrog ? ? A G 22 O6 ? ? ? 1_555 A G 46 N2 ? ? A G 22 A G 46 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog26 hydrog ? ? A G 26 N1 ? ? ? 1_555 A U 44 O2 ? ? A G 26 A U 44 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog27 hydrog ? ? A G 26 O6 ? ? ? 1_555 A U 44 N3 ? ? A G 26 A U 44 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog28 hydrog ? ? A C 27 N3 ? ? ? 1_555 A G 43 N1 ? ? A C 27 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 27 N4 ? ? ? 1_555 A G 43 O6 ? ? A C 27 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 27 O2 ? ? ? 1_555 A G 43 N2 ? ? A C 27 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 28 N3 ? ? ? 1_555 A G 42 N1 ? ? A C 28 A G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 28 N4 ? ? ? 1_555 A G 42 O6 ? ? A C 28 A G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 28 O2 ? ? ? 1_555 A G 42 N2 ? ? A C 28 A G 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A U 29 N3 ? ? ? 1_555 A A 41 N1 ? ? A U 29 A A 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A U 29 O4 ? ? ? 1_555 A A 41 N6 ? ? A U 29 A A 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 30 N1 ? ? ? 1_555 A C 40 N3 ? ? A G 30 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 30 N2 ? ? ? 1_555 A C 40 O2 ? ? A G 30 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 30 O6 ? ? ? 1_555 A C 40 N4 ? ? A G 30 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 39 N3 ? ? A G 31 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 39 O2 ? ? A G 31 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 39 N4 ? ? A G 31 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 32 O2 ? ? ? 1_555 A A 38 N6 ? ? A C 32 A A 38 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog43 hydrog ? ? A G 49 N1 ? ? ? 1_555 A U 65 O2 ? ? A G 49 A U 65 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog44 hydrog ? ? A G 49 O6 ? ? ? 1_555 A U 65 N3 ? ? A G 49 A U 65 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog45 hydrog ? ? A A 50 N1 ? ? ? 1_555 A U 64 N3 ? ? A A 50 A U 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A A 50 N6 ? ? ? 1_555 A U 64 O4 ? ? A A 50 A U 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 51 N1 ? ? ? 1_555 A C 63 N3 ? ? A G 51 A C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 51 N2 ? ? ? 1_555 A C 63 O2 ? ? A G 51 A C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 51 O6 ? ? ? 1_555 A C 63 N4 ? ? A G 51 A C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 52 N1 ? ? ? 1_555 A C 62 N3 ? ? A G 52 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 52 N2 ? ? ? 1_555 A C 62 O2 ? ? A G 52 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 52 O6 ? ? ? 1_555 A C 62 N4 ? ? A G 52 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 53 N1 ? ? ? 1_555 A C 61 N3 ? ? A G 53 A C 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 53 N2 ? ? ? 1_555 A C 61 O2 ? ? A G 53 A C 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 53 O6 ? ? ? 1_555 A C 61 N4 ? ? A G 53 A C 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A U 54 N3 ? ? ? 1_555 A A 58 N7 ? ? A U 54 A A 58 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog57 hydrog ? ? A U 54 O2 ? ? ? 1_555 A A 58 N6 ? ? A U 54 A A 58 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # _atom_sites.entry_id 7KJU _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.009951 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.005934 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.014500 _atom_sites.fract_transf_vector[1] 0.000000 _atom_sites.fract_transf_vector[2] 0.000000 _atom_sites.fract_transf_vector[3] 0.000000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H MG N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 C 4 4 4 C C A . n A 1 5 C 5 5 5 C C A . n A 1 6 G 6 6 6 G G A . n A 1 7 U 7 7 7 U U A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 C 10 10 10 C C A . n A 1 11 U 11 11 11 U U A . n A 1 12 C 12 12 12 C C A . n A 1 13 A 13 13 13 A A A . n A 1 14 G 14 14 14 G G A . n A 1 15 U 15 15 15 U U A . n A 1 16 C 16 16 16 C C A . n A 1 17 U 17 17 17 U U A . n A 1 18 G 18 18 18 G G A . n A 1 19 G 19 19 19 G G A . n A 1 20 C 20 20 20 C C A . n A 1 21 A 21 21 21 A A A . n A 1 22 G 22 22 22 G G A . n A 1 23 A 23 23 23 A A A . n A 1 24 G 24 24 24 G G A . n A 1 25 C 25 25 25 C C A . n A 1 26 G 26 26 26 G G A . n A 1 27 C 27 27 27 C C A . n A 1 28 C 28 28 28 C C A . n A 1 29 U 29 29 29 U U A . n A 1 30 G 30 30 30 G G A . n A 1 31 G 31 31 31 G G A . n A 1 32 C 32 32 32 C C A . n A 1 33 U 33 33 33 U U A . n A 1 34 U 34 34 34 U U A . n A 1 35 U 35 35 35 U U A . n A 1 36 U 36 36 36 U U A . n A 1 37 A 37 37 37 A A A . n A 1 38 A 38 38 38 A A A . n A 1 39 C 39 39 39 C C A . n A 1 40 C 40 40 40 C C A . n A 1 41 A 41 41 41 A A A . n A 1 42 G 42 42 42 G G A . n A 1 43 G 43 43 43 G G A . n A 1 44 U 44 44 44 U U A . n A 1 45 G 45 45 45 G G A . n A 1 46 G 46 46 46 G G A . n A 1 47 U 47 47 47 U U A . n A 1 48 C 48 48 48 C C A . n A 1 49 G 49 49 49 G G A . n A 1 50 A 50 50 50 A A A . n A 1 51 G 51 51 51 G G A . n A 1 52 G 52 52 52 G G A . n A 1 53 G 53 53 53 G G A . n A 1 54 U 54 54 54 U U A . n A 1 55 U 55 55 55 U U A . n A 1 56 C 56 56 56 C C A . n A 1 57 A 57 57 57 A A A . n A 1 58 A 58 58 58 A A A . n A 1 59 A 59 59 59 A A A . n A 1 60 U 60 60 60 U U A . n A 1 61 C 61 61 61 C C A . n A 1 62 C 62 62 62 C C A . n A 1 63 C 63 63 63 C C A . n A 1 64 U 64 64 64 U U A . n A 1 65 U 65 65 65 U U A . n A 1 66 C 66 66 66 C C A . n A 1 67 G 67 67 67 G G A . n A 1 68 G 68 68 68 G G A . n A 1 69 G 69 69 69 G G A . n A 1 70 C 70 70 70 C C A . n A 1 71 C 71 71 71 C C A . n A 1 72 C 72 72 72 C C A . n A 1 73 G 73 73 73 G G A . n A 1 74 C 74 74 74 C C A . n A 1 75 C 75 75 75 C C A . n A 1 76 A 76 76 ? ? ? A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 MG 1 101 1 MG MG A . C 2 MG 1 102 2 MG MG A . D 2 MG 1 103 3 MG MG A . E 2 MG 1 104 4 MG MG A . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 440 ? 1 MORE -32 ? 1 'SSA (A^2)' 12470 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _pdbx_struct_conn_angle.id 1 _pdbx_struct_conn_angle.ptnr1_label_atom_id OP2 _pdbx_struct_conn_angle.ptnr1_label_alt_id ? _pdbx_struct_conn_angle.ptnr1_label_asym_id A _pdbx_struct_conn_angle.ptnr1_label_comp_id A _pdbx_struct_conn_angle.ptnr1_label_seq_id 21 _pdbx_struct_conn_angle.ptnr1_auth_atom_id ? _pdbx_struct_conn_angle.ptnr1_auth_asym_id A _pdbx_struct_conn_angle.ptnr1_auth_comp_id A _pdbx_struct_conn_angle.ptnr1_auth_seq_id 21 _pdbx_struct_conn_angle.ptnr1_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr1_symmetry 1_555 _pdbx_struct_conn_angle.ptnr2_label_atom_id MG _pdbx_struct_conn_angle.ptnr2_label_alt_id ? _pdbx_struct_conn_angle.ptnr2_label_asym_id D _pdbx_struct_conn_angle.ptnr2_label_comp_id MG _pdbx_struct_conn_angle.ptnr2_label_seq_id . _pdbx_struct_conn_angle.ptnr2_auth_atom_id ? _pdbx_struct_conn_angle.ptnr2_auth_asym_id A _pdbx_struct_conn_angle.ptnr2_auth_comp_id MG _pdbx_struct_conn_angle.ptnr2_auth_seq_id 103 _pdbx_struct_conn_angle.ptnr2_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr2_symmetry 1_555 _pdbx_struct_conn_angle.ptnr3_label_atom_id OP1 _pdbx_struct_conn_angle.ptnr3_label_alt_id ? _pdbx_struct_conn_angle.ptnr3_label_asym_id A _pdbx_struct_conn_angle.ptnr3_label_comp_id A _pdbx_struct_conn_angle.ptnr3_label_seq_id 59 _pdbx_struct_conn_angle.ptnr3_auth_atom_id ? _pdbx_struct_conn_angle.ptnr3_auth_asym_id A _pdbx_struct_conn_angle.ptnr3_auth_comp_id A _pdbx_struct_conn_angle.ptnr3_auth_seq_id 59 _pdbx_struct_conn_angle.ptnr3_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr3_symmetry 1_555 _pdbx_struct_conn_angle.value 159.5 _pdbx_struct_conn_angle.value_esd ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2020-12-02 2 'Structure model' 1 1 2020-12-16 3 'Structure model' 1 2 2023-10-18 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Database references' 4 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' chem_comp_atom 4 3 'Structure model' chem_comp_bond 5 3 'Structure model' database_2 6 3 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_CSD' 4 2 'Structure model' '_citation.journal_id_ISSN' 5 2 'Structure model' '_citation.journal_volume' 6 2 'Structure model' '_citation.page_first' 7 2 'Structure model' '_citation.page_last' 8 2 'Structure model' '_citation.pdbx_database_id_DOI' 9 2 'Structure model' '_citation.pdbx_database_id_PubMed' 10 2 'Structure model' '_citation.title' 11 2 'Structure model' '_citation.year' 12 2 'Structure model' '_citation_author.identifier_ORCID' 13 2 'Structure model' '_citation_author.name' 14 3 'Structure model' '_database_2.pdbx_DOI' 15 3 'Structure model' '_database_2.pdbx_database_accession' # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x -32.6180 _pdbx_refine_tls.origin_y -10.6402 _pdbx_refine_tls.origin_z 10.4170 _pdbx_refine_tls.T[1][1] 0.5461 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] 0.2847 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.0825 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.6380 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] 0.0735 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.6952 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 1.3117 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] -0.3082 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] -0.6091 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 0.9064 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] -0.5988 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 0.9442 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] 0.1168 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] -0.9014 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] -0.0359 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] 0.5265 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] -0.0912 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] -0.5753 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] -0.0741 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] 0.6813 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] -0.0862 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id ? _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id A _pdbx_refine_tls_group.beg_auth_seq_id 1 _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id ? _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id A _pdbx_refine_tls_group.end_auth_seq_id 75 _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details ;(chain 'A' and resid 1 through 75) ; # _pdbx_phasing_MR.entry_id 7KJU _pdbx_phasing_MR.method_rotation ? _pdbx_phasing_MR.method_translation ? _pdbx_phasing_MR.model_details ? _pdbx_phasing_MR.R_factor ? _pdbx_phasing_MR.R_rigid_body ? _pdbx_phasing_MR.correlation_coeff_Fo_to_Fc ? _pdbx_phasing_MR.correlation_coeff_Io_to_Ic ? _pdbx_phasing_MR.d_res_high_rotation 3.110 _pdbx_phasing_MR.d_res_low_rotation 49.030 _pdbx_phasing_MR.d_res_high_translation 3.110 _pdbx_phasing_MR.d_res_low_translation 49.030 _pdbx_phasing_MR.packing ? _pdbx_phasing_MR.reflns_percent_rotation ? _pdbx_phasing_MR.reflns_percent_translation ? _pdbx_phasing_MR.sigma_F_rotation ? _pdbx_phasing_MR.sigma_F_translation ? _pdbx_phasing_MR.sigma_I_rotation ? _pdbx_phasing_MR.sigma_I_translation ? # _phasing.method MR # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? DIALS ? ? ? 1.14.5 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? Aimless ? ? ? 0.7.4 2 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? 2.8.3 3 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.16 4 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? 3.25 5 # _pdbx_entry_details.entry_id 7KJU _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 1 _pdbx_validate_close_contact.auth_atom_id_1 "O2'" _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 A _pdbx_validate_close_contact.auth_seq_id_1 58 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 OP2 _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 U _pdbx_validate_close_contact.auth_seq_id_2 60 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 1.98 # _pdbx_unobs_or_zero_occ_residues.id 1 _pdbx_unobs_or_zero_occ_residues.PDB_model_num 1 _pdbx_unobs_or_zero_occ_residues.polymer_flag Y _pdbx_unobs_or_zero_occ_residues.occupancy_flag 1 _pdbx_unobs_or_zero_occ_residues.auth_asym_id A _pdbx_unobs_or_zero_occ_residues.auth_comp_id A _pdbx_unobs_or_zero_occ_residues.auth_seq_id 76 _pdbx_unobs_or_zero_occ_residues.PDB_ins_code ? _pdbx_unobs_or_zero_occ_residues.label_asym_id A _pdbx_unobs_or_zero_occ_residues.label_comp_id A _pdbx_unobs_or_zero_occ_residues.label_seq_id 76 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 MG MG MG N N 111 U OP3 O N N 112 U P P N N 113 U OP1 O N N 114 U OP2 O N N 115 U "O5'" O N N 116 U "C5'" C N N 117 U "C4'" C N R 118 U "O4'" O N N 119 U "C3'" C N S 120 U "O3'" O N N 121 U "C2'" C N R 122 U "O2'" O N N 123 U "C1'" C N R 124 U N1 N N N 125 U C2 C N N 126 U O2 O N N 127 U N3 N N N 128 U C4 C N N 129 U O4 O N N 130 U C5 C N N 131 U C6 C N N 132 U HOP3 H N N 133 U HOP2 H N N 134 U "H5'" H N N 135 U "H5''" H N N 136 U "H4'" H N N 137 U "H3'" H N N 138 U "HO3'" H N N 139 U "H2'" H N N 140 U "HO2'" H N N 141 U "H1'" H N N 142 U H3 H N N 143 U H5 H N N 144 U H6 H N N 145 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7KJU 'double helix' 7KJU 'a-form double helix' 7KJU 'parallel strands' 7KJU 'hairpin loop' 7KJU 'mismatched base pair' 7KJU 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 72 1_555 0.395 0.517 -0.295 -3.465 -9.661 -26.126 1 A_G1:C72_A A 1 ? A 72 ? ? 1 1 A G 2 1_555 A C 71 1_555 0.768 0.241 -0.047 -9.351 -9.892 0.193 2 A_G2:C71_A A 2 ? A 71 ? 19 1 1 A C 3 1_555 A C 70 1_555 -1.701 -1.404 0.283 1.541 -13.452 -11.065 3 A_C3:C70_A A 3 ? A 70 ? ? ? 1 A C 4 1_555 A G 69 1_555 -0.112 -0.226 0.203 2.725 -3.875 -5.572 4 A_C4:G69_A A 4 ? A 69 ? 19 1 1 A C 5 1_555 A G 68 1_555 -0.148 -0.186 -0.352 8.127 -8.556 0.919 5 A_C5:G68_A A 5 ? A 68 ? 19 1 1 A G 6 1_555 A G 67 1_555 1.303 1.234 -0.679 -7.928 -14.556 -10.856 6 A_G6:G67_A A 6 ? A 67 ? ? ? 1 A U 7 1_555 A C 66 1_555 -0.677 -0.781 -0.081 5.219 -15.319 -12.895 7 A_U7:C66_A A 7 ? A 66 ? ? ? 1 A G 49 1_555 A U 65 1_555 -2.120 -0.535 -0.151 5.543 0.179 -9.851 8 A_G49:U65_A A 49 ? A 65 ? 28 1 1 A A 50 1_555 A U 64 1_555 0.028 0.219 -0.717 -12.887 2.565 1.810 9 A_A50:U64_A A 50 ? A 64 ? 20 1 1 A G 51 1_555 A C 63 1_555 0.703 -0.151 -0.572 -11.606 5.629 -8.129 10 A_G51:C63_A A 51 ? A 63 ? 19 1 1 A G 52 1_555 A C 62 1_555 -0.017 -0.245 -0.537 -14.682 -10.305 -4.220 11 A_G52:C62_A A 52 ? A 62 ? 19 1 1 A G 53 1_555 A C 61 1_555 -0.006 0.136 0.081 -14.096 -9.535 -1.810 12 A_G53:C61_A A 53 ? A 61 ? 19 1 1 A U 54 1_555 A A 58 1_555 4.936 -2.737 0.613 -3.096 7.614 -98.995 13 A_U54:A58_A A 54 ? A 58 ? 24 4 1 A U 55 1_555 A G 18 1_555 0.781 -5.367 1.038 8.767 12.859 -100.870 14 A_U55:G18_A A 55 ? A 18 ? ? 6 1 A G 22 1_555 A A 13 1_555 -0.796 1.516 0.817 1.747 10.715 11.189 15 A_G22:A13_A A 22 ? A 13 ? 8 1 1 A A 23 1_555 A G 9 1_555 5.700 -5.777 -0.466 -0.091 5.177 179.791 16 A_A23:G9_A A 23 ? A 9 ? ? ? 1 A G 24 1_555 A U 11 1_555 0.667 -0.343 -1.619 -15.823 -23.370 -0.533 17 A_G24:U11_A A 24 ? A 11 ? ? 1 1 A C 25 1_555 A C 10 1_555 1.713 -1.127 -0.869 -7.230 -15.086 -4.037 18 A_C25:C10_A A 25 ? A 10 ? ? ? 1 A G 26 1_555 A U 44 1_555 -1.950 0.002 0.428 26.832 -16.594 -18.569 19 A_G26:U44_A A 26 ? A 44 ? 28 1 1 A C 27 1_555 A G 43 1_555 -0.568 0.151 -0.264 25.591 -24.239 0.249 20 A_C27:G43_A A 27 ? A 43 ? 19 1 1 A C 28 1_555 A G 42 1_555 -0.900 0.341 -0.315 13.123 -9.493 -3.513 21 A_C28:G42_A A 28 ? A 42 ? 19 1 1 A U 29 1_555 A A 41 1_555 0.646 0.020 -1.003 12.086 -17.074 -20.688 22 A_U29:A41_A A 29 ? A 41 ? 20 1 1 A G 30 1_555 A C 40 1_555 1.401 0.512 0.165 1.478 -2.284 0.684 23 A_G30:C40_A A 30 ? A 40 ? 19 1 1 A G 31 1_555 A C 39 1_555 -0.374 0.205 -0.148 -7.019 -20.811 10.559 24 A_G31:C39_A A 31 ? A 39 ? 19 1 1 A C 32 1_555 A A 38 1_555 6.007 -1.559 0.073 -29.702 -10.582 -11.481 25 A_C32:A38_A A 32 ? A 38 ? ? ? 1 A G 19 1_555 A C 56 1_555 0.529 -0.102 -0.267 -23.670 -26.508 -4.260 26 A_G19:C56_A A 19 ? A 56 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 72 1_555 A G 2 1_555 A C 71 1_555 0.786 -2.176 3.404 0.857 5.628 39.297 -3.859 -1.058 3.092 8.315 -1.267 39.691 1 AA_G1G2:C71C72_AA A 1 ? A 72 ? A 2 ? A 71 ? 1 A G 2 1_555 A C 71 1_555 A C 3 1_555 A C 70 1_555 0.040 -2.770 2.762 -1.560 -1.204 16.761 -8.748 -1.030 2.936 -4.112 5.326 16.876 2 AA_G2C3:C70C71_AA A 2 ? A 71 ? A 3 ? A 70 ? 1 A C 3 1_555 A C 70 1_555 A C 4 1_555 A G 69 1_555 0.597 -1.920 3.207 0.510 5.449 42.063 -3.179 -0.776 2.954 7.553 -0.707 42.402 3 AA_C3C4:G69C70_AA A 3 ? A 70 ? A 4 ? A 69 ? 1 A C 4 1_555 A G 69 1_555 A C 5 1_555 A G 68 1_555 0.113 -1.817 2.884 3.353 1.885 28.875 -3.971 0.409 2.758 3.760 -6.687 29.125 4 AA_C4C5:G68G69_AA A 4 ? A 69 ? A 5 ? A 68 ? 1 A C 5 1_555 A G 68 1_555 A G 6 1_555 A G 67 1_555 0.004 -1.819 3.771 2.938 15.322 38.022 -4.362 0.332 2.854 22.400 -4.295 40.989 5 AA_C5G6:G67G68_AA A 5 ? A 68 ? A 6 ? A 67 ? 1 A G 6 1_555 A G 67 1_555 A U 7 1_555 A C 66 1_555 -0.361 -2.128 2.948 -0.218 20.017 21.598 -7.021 0.682 0.748 43.285 0.471 29.367 6 AA_G6U7:C66G67_AA A 6 ? A 67 ? A 7 ? A 66 ? 1 A U 7 1_555 A C 66 1_555 A G 49 1_555 A U 65 1_555 0.059 -2.148 3.204 -1.968 5.906 32.591 -4.678 -0.409 2.774 10.405 3.468 33.164 7 AA_U7G49:U65C66_AA A 7 ? A 66 ? A 49 ? A 65 ? 1 A G 49 1_555 A U 65 1_555 A A 50 1_555 A U 64 1_555 0.064 -2.097 3.867 0.357 4.592 39.166 -3.730 -0.046 3.609 6.821 -0.531 39.425 8 AA_G49A50:U64U65_AA A 49 ? A 65 ? A 50 ? A 64 ? 1 A A 50 1_555 A U 64 1_555 A G 51 1_555 A C 63 1_555 -0.699 -1.872 3.298 -1.347 5.649 29.727 -4.680 1.076 2.929 10.879 2.595 30.277 9 AA_A50G51:C63U64_AA A 50 ? A 64 ? A 51 ? A 63 ? 1 A G 51 1_555 A C 63 1_555 A G 52 1_555 A C 62 1_555 0.344 -2.066 3.392 0.502 8.122 29.501 -5.455 -0.557 2.744 15.579 -0.964 30.579 10 AA_G51G52:C62C63_AA A 51 ? A 63 ? A 52 ? A 62 ? 1 A G 52 1_555 A C 62 1_555 A G 53 1_555 A C 61 1_555 0.813 -1.960 3.188 -2.687 4.273 31.492 -4.287 -1.932 2.827 7.811 4.911 31.884 11 AA_G52G53:C61C62_AA A 52 ? A 62 ? A 53 ? A 61 ? 1 A G 53 1_555 A C 61 1_555 A U 54 1_555 A A 58 1_555 -2.087 -2.177 3.088 -0.986 1.469 93.298 -1.523 1.418 3.078 1.010 0.678 93.311 12 AA_G53U54:A58C61_AA A 53 ? A 61 ? A 54 ? A 58 ? 1 A U 54 1_555 A A 58 1_555 A U 55 1_555 A G 18 1_555 1.935 -1.629 3.484 14.283 2.036 38.930 -2.555 -0.967 3.847 2.935 -20.590 41.420 13 AA_U54U55:G18A58_AA A 54 ? A 58 ? A 55 ? A 18 ? 1 A G 22 1_555 A A 13 1_555 A A 23 1_555 A G 9 1_555 -0.707 1.671 3.785 3.226 1.370 -64.404 -1.633 -0.504 3.780 -1.284 3.024 -64.489 14 AA_G22A23:G9A13_AA A 22 ? A 13 ? A 23 ? A 9 ? 1 A A 23 1_555 A G 9 1_555 A G 24 1_555 A U 11 1_555 0.239 -4.561 3.382 -4.141 18.572 130.591 -2.634 -0.160 3.030 10.202 2.275 131.315 15 AA_A23G24:U11G9_AA A 23 ? A 9 ? A 24 ? A 11 ? 1 A G 24 1_555 A U 11 1_555 A C 25 1_555 A C 10 1_555 0.439 -1.054 2.966 -2.533 6.089 40.947 -2.061 -0.858 2.757 8.636 3.593 41.453 16 AA_G24C25:C10U11_AA A 24 ? A 11 ? A 25 ? A 10 ? 1 A C 25 1_555 A C 10 1_555 A G 26 1_555 A U 44 1_555 3.198 -2.430 2.387 -23.864 5.390 49.556 -2.793 -4.168 0.644 6.027 26.680 54.922 17 AA_C25G26:U44C10_AA A 25 ? A 10 ? A 26 ? A 44 ? 1 A G 26 1_555 A U 44 1_555 A C 27 1_555 A G 43 1_555 1.163 -1.754 3.110 2.775 2.394 42.415 -2.645 -1.337 3.077 3.302 -3.827 42.566 18 AA_G26C27:G43U44_AA A 26 ? A 44 ? A 27 ? A 43 ? 1 A C 27 1_555 A G 43 1_555 A C 28 1_555 A G 42 1_555 -0.641 -1.758 3.647 -2.398 8.423 33.000 -4.411 0.690 3.153 14.513 4.132 34.111 19 AA_C27C28:G42G43_AA A 27 ? A 43 ? A 28 ? A 42 ? 1 A C 28 1_555 A G 42 1_555 A U 29 1_555 A A 41 1_555 -1.145 -1.407 3.334 3.312 8.382 38.209 -3.059 2.086 2.868 12.591 -4.975 39.219 20 AA_C28U29:A41G42_AA A 28 ? A 42 ? A 29 ? A 41 ? 1 A U 29 1_555 A A 41 1_555 A G 30 1_555 A C 40 1_555 0.738 -2.164 3.551 -6.566 9.779 27.306 -6.180 -2.754 2.412 19.599 13.159 29.694 21 AA_U29G30:C40A41_AA A 29 ? A 41 ? A 30 ? A 40 ? 1 A G 30 1_555 A C 40 1_555 A G 31 1_555 A C 39 1_555 1.097 -1.681 3.375 3.889 9.884 28.177 -5.205 -1.341 2.764 19.450 -7.653 30.075 22 AA_G30G31:C39C40_AA A 30 ? A 40 ? A 31 ? A 39 ? 1 A G 31 1_555 A C 39 1_555 A C 32 1_555 A A 38 1_555 -0.968 -1.335 4.156 3.091 3.405 60.026 -1.540 1.156 4.032 3.398 -3.085 60.185 23 AA_G31C32:A38C39_AA A 31 ? A 39 ? A 32 ? A 38 ? # _pdbx_audit_support.funding_organization 'Canadian Institutes of Health Research (CIHR)' _pdbx_audit_support.country Canada _pdbx_audit_support.grant_number 'FDN 143277' _pdbx_audit_support.ordinal 1 # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name 'MAGNESIUM ION' _pdbx_entity_nonpoly.comp_id MG # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 3L0U _pdbx_initial_refinement_model.details 'PDB entry 3L0U' # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? #