data_7QSH
#
_entry.id 7QSH
#
_audit_conform.dict_name mmcif_pdbx.dic
_audit_conform.dict_version 5.385
_audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic
#
loop_
_database_2.database_id
_database_2.database_code
_database_2.pdbx_database_accession
_database_2.pdbx_DOI
PDB 7QSH pdb_00007qsh 10.2210/pdb7qsh/pdb
WWPDB D_1292120216 ? ?
#
loop_
_pdbx_audit_revision_history.ordinal
_pdbx_audit_revision_history.data_content_type
_pdbx_audit_revision_history.major_revision
_pdbx_audit_revision_history.minor_revision
_pdbx_audit_revision_history.revision_date
1 'Structure model' 1 0 2023-01-25
2 'Structure model' 1 1 2023-08-23
3 'Structure model' 1 2 2024-02-07
#
_pdbx_audit_revision_details.ordinal 1
_pdbx_audit_revision_details.revision_ordinal 1
_pdbx_audit_revision_details.data_content_type 'Structure model'
_pdbx_audit_revision_details.provider repository
_pdbx_audit_revision_details.type 'Initial release'
_pdbx_audit_revision_details.description ?
_pdbx_audit_revision_details.details ?
#
loop_
_pdbx_audit_revision_group.ordinal
_pdbx_audit_revision_group.revision_ordinal
_pdbx_audit_revision_group.data_content_type
_pdbx_audit_revision_group.group
1 2 'Structure model' 'Data collection'
2 2 'Structure model' 'Database references'
3 3 'Structure model' 'Refinement description'
#
loop_
_pdbx_audit_revision_category.ordinal
_pdbx_audit_revision_category.revision_ordinal
_pdbx_audit_revision_category.data_content_type
_pdbx_audit_revision_category.category
1 2 'Structure model' chem_comp_atom
2 2 'Structure model' chem_comp_bond
3 2 'Structure model' citation
4 2 'Structure model' citation_author
5 3 'Structure model' pdbx_initial_refinement_model
#
loop_
_pdbx_audit_revision_item.ordinal
_pdbx_audit_revision_item.revision_ordinal
_pdbx_audit_revision_item.data_content_type
_pdbx_audit_revision_item.item
1 2 'Structure model' '_citation.country'
2 2 'Structure model' '_citation.journal_abbrev'
3 2 'Structure model' '_citation.journal_id_ASTM'
4 2 'Structure model' '_citation.journal_id_CSD'
5 2 'Structure model' '_citation.journal_id_ISSN'
6 2 'Structure model' '_citation.journal_volume'
7 2 'Structure model' '_citation.page_first'
8 2 'Structure model' '_citation.page_last'
9 2 'Structure model' '_citation.pdbx_database_id_DOI'
10 2 'Structure model' '_citation.pdbx_database_id_PubMed'
11 2 'Structure model' '_citation.title'
12 2 'Structure model' '_citation.year'
13 2 'Structure model' '_citation_author.identifier_ORCID'
#
_pdbx_database_status.status_code REL
_pdbx_database_status.status_code_sf REL
_pdbx_database_status.status_code_mr ?
_pdbx_database_status.entry_id 7QSH
_pdbx_database_status.recvd_initial_deposition_date 2022-01-13
_pdbx_database_status.SG_entry N
_pdbx_database_status.deposit_site PDBE
_pdbx_database_status.process_site PDBE
_pdbx_database_status.status_code_cs ?
_pdbx_database_status.status_code_nmr_data ?
_pdbx_database_status.methods_development_category ?
_pdbx_database_status.pdb_format_compatible Y
#
_pdbx_contact_author.id 2
_pdbx_contact_author.email e.ennifar@unistra.fr
_pdbx_contact_author.name_first Eric
_pdbx_contact_author.name_last Ennifar
_pdbx_contact_author.name_mi ?
_pdbx_contact_author.role 'principal investigator/group leader'
_pdbx_contact_author.identifier_ORCID 0000-0002-5076-846X
#
loop_
_audit_author.name
_audit_author.pdbx_ordinal
_audit_author.identifier_ORCID
'Ennifar, E.' 1 ?
'Micura, R.' 2 ?
#
_citation.abstract ?
_citation.abstract_id_CAS ?
_citation.book_id_ISBN ?
_citation.book_publisher ?
_citation.book_publisher_city ?
_citation.book_title ?
_citation.coordinate_linkage ?
_citation.country UK
_citation.database_id_Medline ?
_citation.details ?
_citation.id primary
_citation.journal_abbrev 'Nucleic Acids Res.'
_citation.journal_id_ASTM NARHAD
_citation.journal_id_CSD 0389
_citation.journal_id_ISSN 1362-4962
_citation.journal_full ?
_citation.journal_issue ?
_citation.journal_volume 50
_citation.language ?
_citation.page_first 6038
_citation.page_last 6051
_citation.title
'Towards a comprehensive understanding of RNA deamination: synthesis and properties of xanthosine-modified RNA.'
_citation.year 2022
_citation.database_id_CSD ?
_citation.pdbx_database_id_DOI 10.1093/nar/gkac477
_citation.pdbx_database_id_PubMed 35687141
_citation.pdbx_database_id_patent ?
_citation.unpublished_flag ?
#
loop_
_citation_author.citation_id
_citation_author.name
_citation_author.ordinal
_citation_author.identifier_ORCID
primary 'Mair, S.' 1 ?
primary 'Erharter, K.' 2 ?
primary 'Renard, E.' 3 ?
primary 'Brillet, K.' 4 ?
primary 'Brunner, M.' 5 ?
primary 'Lusser, A.' 6 0000-0002-2226-9081
primary 'Kreutz, C.' 7 0000-0002-7018-9326
primary 'Ennifar, E.' 8 ?
primary 'Micura, R.' 9 0000-0003-2661-6105
#
loop_
_entity.id
_entity.type
_entity.src_method
_entity.pdbx_description
_entity.formula_weight
_entity.pdbx_number_of_molecules
_entity.pdbx_ec
_entity.pdbx_mutation
_entity.pdbx_fragment
_entity.details
1 polymer syn '23S ribosomal RNA Sarcin Ricin Loop 27-nucleotide fragment' 8533.146 1 ? ? ? ?
2 non-polymer syn URIDINE 244.201 1 ? ? ? ?
3 non-polymer syn
;9-[(2~{R},3~{R},4~{S},5~{R})-3,4-bis(oxidanyl)-5-[[tris(oxidanyl)-$l^{5}-phosphanyl]oxymethyl]oxolan-2-yl]-2-oxidanyl-1~{H}-purin-6-one
;
364.205 1 ? ? ? ?
4 non-polymer syn GLYCEROL 92.094 1 ? ? ? ?
5 non-polymer syn 'SULFATE ION' 96.063 1 ? ? ? ?
6 water nat water 18.015 147 ? ? ? ?
#
_entity_poly.entity_id 1
_entity_poly.type polyribonucleotide
_entity_poly.nstd_linkage no
_entity_poly.nstd_monomer yes
_entity_poly.pdbx_seq_one_letter_code 'U(XAN)CUCCUAGUACGAGAGGACCGGAGUG'
_entity_poly.pdbx_seq_one_letter_code_can UXCUCCUAGUACGAGAGGACCGGAGUG
_entity_poly.pdbx_strand_id A
_entity_poly.pdbx_target_identifier ?
#
loop_
_pdbx_entity_nonpoly.entity_id
_pdbx_entity_nonpoly.name
_pdbx_entity_nonpoly.comp_id
2 URIDINE URI
3
;9-[(2~{R},3~{R},4~{S},5~{R})-3,4-bis(oxidanyl)-5-[[tris(oxidanyl)-$l^{5}-phosphanyl]oxymethyl]oxolan-2-yl]-2-oxidanyl-1~{H}-purin-6-one
;
HYJ
4 GLYCEROL GOL
5 'SULFATE ION' SO4
6 water HOH
#
loop_
_entity_poly_seq.entity_id
_entity_poly_seq.num
_entity_poly_seq.mon_id
_entity_poly_seq.hetero
1 1 U n
1 2 XAN n
1 3 C n
1 4 U n
1 5 C n
1 6 C n
1 7 U n
1 8 A n
1 9 G n
1 10 U n
1 11 A n
1 12 C n
1 13 G n
1 14 A n
1 15 G n
1 16 A n
1 17 G n
1 18 G n
1 19 A n
1 20 C n
1 21 C n
1 22 G n
1 23 G n
1 24 A n
1 25 G n
1 26 U n
1 27 G n
#
_pdbx_entity_src_syn.entity_id 1
_pdbx_entity_src_syn.pdbx_src_id 1
_pdbx_entity_src_syn.pdbx_alt_source_flag sample
_pdbx_entity_src_syn.pdbx_beg_seq_num 1
_pdbx_entity_src_syn.pdbx_end_seq_num 27
_pdbx_entity_src_syn.organism_scientific 'synthetic construct'
_pdbx_entity_src_syn.organism_common_name ?
_pdbx_entity_src_syn.ncbi_taxonomy_id 32630
_pdbx_entity_src_syn.details ?
#
loop_
_chem_comp.id
_chem_comp.type
_chem_comp.mon_nstd_flag
_chem_comp.name
_chem_comp.pdbx_synonyms
_chem_comp.formula
_chem_comp.formula_weight
A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221
C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197
G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221
GOL non-polymer . GLYCEROL 'GLYCERIN; PROPANE-1,2,3-TRIOL' 'C3 H8 O3' 92.094
HOH non-polymer . WATER ? 'H2 O' 18.015
HYJ 'L-RNA linking' n
;9-[(2~{R},3~{R},4~{S},5~{R})-3,4-bis(oxidanyl)-5-[[tris(oxidanyl)-$l^{5}-phosphanyl]oxymethyl]oxolan-2-yl]-2-oxidanyl-1~{H}-purin-6-one
;
? 'C10 H13 N4 O9 P' 364.205
SO4 non-polymer . 'SULFATE ION' ? 'O4 S -2' 96.063
U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181
URI non-polymer . URIDINE ? 'C9 H12 N2 O6' 244.201
XAN non-polymer . XANTHINE ? 'C5 H4 N4 O2' 152.111
#
loop_
_pdbx_poly_seq_scheme.asym_id
_pdbx_poly_seq_scheme.entity_id
_pdbx_poly_seq_scheme.seq_id
_pdbx_poly_seq_scheme.mon_id
_pdbx_poly_seq_scheme.ndb_seq_num
_pdbx_poly_seq_scheme.pdb_seq_num
_pdbx_poly_seq_scheme.auth_seq_num
_pdbx_poly_seq_scheme.pdb_mon_id
_pdbx_poly_seq_scheme.auth_mon_id
_pdbx_poly_seq_scheme.pdb_strand_id
_pdbx_poly_seq_scheme.pdb_ins_code
_pdbx_poly_seq_scheme.hetero
A 1 1 U 1 2647 ? ? ? A . n
A 1 2 XAN 2 2648 ? ? ? A . n
A 1 3 C 3 2649 2649 C C A . n
A 1 4 U 4 2650 2650 U U A . n
A 1 5 C 5 2651 2651 C C A . n
A 1 6 C 6 2652 2652 C C A . n
A 1 7 U 7 2653 2653 U U A . n
A 1 8 A 8 2654 2654 A A A . n
A 1 9 G 9 2655 2655 G G A . n
A 1 10 U 10 2656 2656 U U A . n
A 1 11 A 11 2657 2657 A A A . n
A 1 12 C 12 2658 2658 C C A . n
A 1 13 G 13 2659 2659 G G A . n
A 1 14 A 14 2660 2660 A A A . n
A 1 15 G 15 2661 2661 G G A . n
A 1 16 A 16 2662 2662 A A A . n
A 1 17 G 17 2663 2663 G G A . n
A 1 18 G 18 2664 2664 G G A . n
A 1 19 A 19 2665 2665 A A A . n
A 1 20 C 20 2666 2666 C C A . n
A 1 21 C 21 2667 2667 C C A . n
A 1 22 G 22 2668 2668 G G A . n
A 1 23 G 23 2669 2669 G G A . n
A 1 24 A 24 2670 2670 A A A . n
A 1 25 G 25 2671 2671 G G A . n
A 1 26 U 26 2672 2672 U U A . n
A 1 27 G 27 2673 2673 G G A . n
#
loop_
_pdbx_nonpoly_scheme.asym_id
_pdbx_nonpoly_scheme.entity_id
_pdbx_nonpoly_scheme.mon_id
_pdbx_nonpoly_scheme.ndb_seq_num
_pdbx_nonpoly_scheme.pdb_seq_num
_pdbx_nonpoly_scheme.auth_seq_num
_pdbx_nonpoly_scheme.pdb_mon_id
_pdbx_nonpoly_scheme.auth_mon_id
_pdbx_nonpoly_scheme.pdb_strand_id
_pdbx_nonpoly_scheme.pdb_ins_code
B 2 URI 1 2701 2647 URI U A .
C 3 HYJ 1 2702 2648 HYJ XAN A .
D 4 GOL 1 2703 200 GOL GOL A .
E 5 SO4 1 2704 201 SO4 SO4 A .
F 6 HOH 1 2801 86 HOH HOH A .
F 6 HOH 2 2802 104 HOH HOH A .
F 6 HOH 3 2803 30 HOH HOH A .
F 6 HOH 4 2804 18 HOH HOH A .
F 6 HOH 5 2805 64 HOH HOH A .
F 6 HOH 6 2806 61 HOH HOH A .
F 6 HOH 7 2807 141 HOH HOH A .
F 6 HOH 8 2808 103 HOH HOH A .
F 6 HOH 9 2809 48 HOH HOH A .
F 6 HOH 10 2810 27 HOH HOH A .
F 6 HOH 11 2811 25 HOH HOH A .
F 6 HOH 12 2812 37 HOH HOH A .
F 6 HOH 13 2813 132 HOH HOH A .
F 6 HOH 14 2814 59 HOH HOH A .
F 6 HOH 15 2815 29 HOH HOH A .
F 6 HOH 16 2816 116 HOH HOH A .
F 6 HOH 17 2817 94 HOH HOH A .
F 6 HOH 18 2818 62 HOH HOH A .
F 6 HOH 19 2819 71 HOH HOH A .
F 6 HOH 20 2820 6 HOH HOH A .
F 6 HOH 21 2821 65 HOH HOH A .
F 6 HOH 22 2822 84 HOH HOH A .
F 6 HOH 23 2823 35 HOH HOH A .
F 6 HOH 24 2824 108 HOH HOH A .
F 6 HOH 25 2825 28 HOH HOH A .
F 6 HOH 26 2826 10 HOH HOH A .
F 6 HOH 27 2827 67 HOH HOH A .
F 6 HOH 28 2828 77 HOH HOH A .
F 6 HOH 29 2829 109 HOH HOH A .
F 6 HOH 30 2830 33 HOH HOH A .
F 6 HOH 31 2831 79 HOH HOH A .
F 6 HOH 32 2832 105 HOH HOH A .
F 6 HOH 33 2833 133 HOH HOH A .
F 6 HOH 34 2834 92 HOH HOH A .
F 6 HOH 35 2835 5 HOH HOH A .
F 6 HOH 36 2836 97 HOH HOH A .
F 6 HOH 37 2837 70 HOH HOH A .
F 6 HOH 38 2838 113 HOH HOH A .
F 6 HOH 39 2839 170 HOH HOH A .
F 6 HOH 40 2840 83 HOH HOH A .
F 6 HOH 41 2841 21 HOH HOH A .
F 6 HOH 42 2842 119 HOH HOH A .
F 6 HOH 43 2843 93 HOH HOH A .
F 6 HOH 44 2844 14 HOH HOH A .
F 6 HOH 45 2845 12 HOH HOH A .
F 6 HOH 46 2846 112 HOH HOH A .
F 6 HOH 47 2847 87 HOH HOH A .
F 6 HOH 48 2848 32 HOH HOH A .
F 6 HOH 49 2849 11 HOH HOH A .
F 6 HOH 50 2850 38 HOH HOH A .
F 6 HOH 51 2851 78 HOH HOH A .
F 6 HOH 52 2852 1 HOH HOH A .
F 6 HOH 53 2853 80 HOH HOH A .
F 6 HOH 54 2854 120 HOH HOH A .
F 6 HOH 55 2855 47 HOH HOH A .
F 6 HOH 56 2856 34 HOH HOH A .
F 6 HOH 57 2857 3 HOH HOH A .
F 6 HOH 58 2858 50 HOH HOH A .
F 6 HOH 59 2859 51 HOH HOH A .
F 6 HOH 60 2860 41 HOH HOH A .
F 6 HOH 61 2861 102 HOH HOH A .
F 6 HOH 62 2862 107 HOH HOH A .
F 6 HOH 63 2863 40 HOH HOH A .
F 6 HOH 64 2864 19 HOH HOH A .
F 6 HOH 65 2865 7 HOH HOH A .
F 6 HOH 66 2866 66 HOH HOH A .
F 6 HOH 67 2867 72 HOH HOH A .
F 6 HOH 68 2868 13 HOH HOH A .
F 6 HOH 69 2869 16 HOH HOH A .
F 6 HOH 70 2870 55 HOH HOH A .
F 6 HOH 71 2871 17 HOH HOH A .
F 6 HOH 72 2872 54 HOH HOH A .
F 6 HOH 73 2873 45 HOH HOH A .
F 6 HOH 74 2874 26 HOH HOH A .
F 6 HOH 75 2875 101 HOH HOH A .
F 6 HOH 76 2876 91 HOH HOH A .
F 6 HOH 77 2877 74 HOH HOH A .
F 6 HOH 78 2878 122 HOH HOH A .
F 6 HOH 79 2879 2 HOH HOH A .
F 6 HOH 80 2880 81 HOH HOH A .
F 6 HOH 81 2881 140 HOH HOH A .
F 6 HOH 82 2882 99 HOH HOH A .
F 6 HOH 83 2883 42 HOH HOH A .
F 6 HOH 84 2884 53 HOH HOH A .
F 6 HOH 85 2885 4 HOH HOH A .
F 6 HOH 86 2886 31 HOH HOH A .
F 6 HOH 87 2887 96 HOH HOH A .
F 6 HOH 88 2888 39 HOH HOH A .
F 6 HOH 89 2889 46 HOH HOH A .
F 6 HOH 90 2890 137 HOH HOH A .
F 6 HOH 91 2891 60 HOH HOH A .
F 6 HOH 92 2892 20 HOH HOH A .
F 6 HOH 93 2893 75 HOH HOH A .
F 6 HOH 94 2894 49 HOH HOH A .
F 6 HOH 95 2895 110 HOH HOH A .
F 6 HOH 96 2896 63 HOH HOH A .
F 6 HOH 97 2897 98 HOH HOH A .
F 6 HOH 98 2898 88 HOH HOH A .
F 6 HOH 99 2899 90 HOH HOH A .
F 6 HOH 100 2900 69 HOH HOH A .
F 6 HOH 101 2901 8 HOH HOH A .
F 6 HOH 102 2902 24 HOH HOH A .
F 6 HOH 103 2903 125 HOH HOH A .
F 6 HOH 104 2904 169 HOH HOH A .
F 6 HOH 105 2905 52 HOH HOH A .
F 6 HOH 106 2906 100 HOH HOH A .
F 6 HOH 107 2907 128 HOH HOH A .
F 6 HOH 108 2908 22 HOH HOH A .
F 6 HOH 109 2909 15 HOH HOH A .
F 6 HOH 110 2910 117 HOH HOH A .
F 6 HOH 111 2911 43 HOH HOH A .
F 6 HOH 112 2912 76 HOH HOH A .
F 6 HOH 113 2913 89 HOH HOH A .
F 6 HOH 114 2914 149 HOH HOH A .
F 6 HOH 115 2915 163 HOH HOH A .
F 6 HOH 116 2916 23 HOH HOH A .
F 6 HOH 117 2917 165 HOH HOH A .
F 6 HOH 118 2918 95 HOH HOH A .
F 6 HOH 119 2919 166 HOH HOH A .
F 6 HOH 120 2920 136 HOH HOH A .
F 6 HOH 121 2921 154 HOH HOH A .
F 6 HOH 122 2922 115 HOH HOH A .
F 6 HOH 123 2923 126 HOH HOH A .
F 6 HOH 124 2924 56 HOH HOH A .
F 6 HOH 125 2925 121 HOH HOH A .
F 6 HOH 126 2926 57 HOH HOH A .
F 6 HOH 127 2927 129 HOH HOH A .
F 6 HOH 128 2928 134 HOH HOH A .
F 6 HOH 129 2929 58 HOH HOH A .
F 6 HOH 130 2930 114 HOH HOH A .
F 6 HOH 131 2931 162 HOH HOH A .
F 6 HOH 132 2932 82 HOH HOH A .
F 6 HOH 133 2933 145 HOH HOH A .
F 6 HOH 134 2934 118 HOH HOH A .
F 6 HOH 135 2935 151 HOH HOH A .
F 6 HOH 136 2936 160 HOH HOH A .
F 6 HOH 137 2937 167 HOH HOH A .
F 6 HOH 138 2938 152 HOH HOH A .
F 6 HOH 139 2939 161 HOH HOH A .
F 6 HOH 140 2940 138 HOH HOH A .
F 6 HOH 141 2941 127 HOH HOH A .
F 6 HOH 142 2942 153 HOH HOH A .
F 6 HOH 143 2943 130 HOH HOH A .
F 6 HOH 144 2944 150 HOH HOH A .
F 6 HOH 145 2945 168 HOH HOH A .
F 6 HOH 146 2946 147 HOH HOH A .
F 6 HOH 147 2947 123 HOH HOH A .
#
loop_
_software.citation_id
_software.classification
_software.compiler_name
_software.compiler_version
_software.contact_author
_software.contact_author_email
_software.date
_software.description
_software.dependencies
_software.hardware
_software.language
_software.location
_software.mods
_software.name
_software.os
_software.os_version
_software.type
_software.version
_software.pdbx_ordinal
? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.19_4092 1
? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.19_4092 2
? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 3
? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? . 4
? phasing ? ? ? ? ? ? ? ? ? ? ? MOLREP ? ? ? . 5
#
_cell.angle_alpha 90.000
_cell.angle_alpha_esd ?
_cell.angle_beta 90.000
_cell.angle_beta_esd ?
_cell.angle_gamma 90.000
_cell.angle_gamma_esd ?
_cell.entry_id 7QSH
_cell.details ?
_cell.formula_units_Z ?
_cell.length_a 29.500
_cell.length_a_esd ?
_cell.length_b 29.500
_cell.length_b_esd ?
_cell.length_c 76.510
_cell.length_c_esd ?
_cell.volume 66582.829
_cell.volume_esd ?
_cell.Z_PDB 4
_cell.reciprocal_angle_alpha ?
_cell.reciprocal_angle_beta ?
_cell.reciprocal_angle_gamma ?
_cell.reciprocal_angle_alpha_esd ?
_cell.reciprocal_angle_beta_esd ?
_cell.reciprocal_angle_gamma_esd ?
_cell.reciprocal_length_a ?
_cell.reciprocal_length_b ?
_cell.reciprocal_length_c ?
_cell.reciprocal_length_a_esd ?
_cell.reciprocal_length_b_esd ?
_cell.reciprocal_length_c_esd ?
_cell.pdbx_unique_axis ?
#
_symmetry.entry_id 7QSH
_symmetry.cell_setting ?
_symmetry.Int_Tables_number 78
_symmetry.space_group_name_Hall 'P 4cw'
_symmetry.space_group_name_H-M 'P 43'
_symmetry.pdbx_full_space_group_name_H-M ?
#
_exptl.absorpt_coefficient_mu ?
_exptl.absorpt_correction_T_max ?
_exptl.absorpt_correction_T_min ?
_exptl.absorpt_correction_type ?
_exptl.absorpt_process_details ?
_exptl.entry_id 7QSH
_exptl.crystals_number 1
_exptl.details ?
_exptl.method 'X-RAY DIFFRACTION'
_exptl.method_details ?
#
_exptl_crystal.colour ?
_exptl_crystal.density_diffrn ?
_exptl_crystal.density_Matthews 1.95
_exptl_crystal.density_method ?
_exptl_crystal.density_percent_sol 36.95
_exptl_crystal.description ?
_exptl_crystal.F_000 ?
_exptl_crystal.id 1
_exptl_crystal.preparation ?
_exptl_crystal.size_max ?
_exptl_crystal.size_mid ?
_exptl_crystal.size_min ?
_exptl_crystal.size_rad ?
_exptl_crystal.colour_lustre ?
_exptl_crystal.colour_modifier ?
_exptl_crystal.colour_primary ?
_exptl_crystal.density_meas ?
_exptl_crystal.density_meas_esd ?
_exptl_crystal.density_meas_gt ?
_exptl_crystal.density_meas_lt ?
_exptl_crystal.density_meas_temp ?
_exptl_crystal.density_meas_temp_esd ?
_exptl_crystal.density_meas_temp_gt ?
_exptl_crystal.density_meas_temp_lt ?
_exptl_crystal.pdbx_crystal_image_url ?
_exptl_crystal.pdbx_crystal_image_format ?
_exptl_crystal.pdbx_mosaicity ?
_exptl_crystal.pdbx_mosaicity_esd ?
#
_exptl_crystal_grow.apparatus ?
_exptl_crystal_grow.atmosphere ?
_exptl_crystal_grow.crystal_id 1
_exptl_crystal_grow.details ?
_exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP'
_exptl_crystal_grow.method_ref ?
_exptl_crystal_grow.pH ?
_exptl_crystal_grow.pressure ?
_exptl_crystal_grow.pressure_esd ?
_exptl_crystal_grow.seeding ?
_exptl_crystal_grow.seeding_ref ?
_exptl_crystal_grow.temp 293
_exptl_crystal_grow.temp_details ?
_exptl_crystal_grow.temp_esd ?
_exptl_crystal_grow.time ?
_exptl_crystal_grow.pdbx_details 'Ammonium sulfate, magnesium acetate, MES pH5.6'
_exptl_crystal_grow.pdbx_pH_range ?
#
_diffrn.ambient_environment ?
_diffrn.ambient_temp 100
_diffrn.ambient_temp_details ?
_diffrn.ambient_temp_esd ?
_diffrn.crystal_id 1
_diffrn.crystal_support ?
_diffrn.crystal_treatment ?
_diffrn.details ?
_diffrn.id 1
_diffrn.ambient_pressure ?
_diffrn.ambient_pressure_esd ?
_diffrn.ambient_pressure_gt ?
_diffrn.ambient_pressure_lt ?
_diffrn.ambient_temp_gt ?
_diffrn.ambient_temp_lt ?
_diffrn.pdbx_serial_crystal_experiment N
#
_diffrn_detector.details ?
_diffrn_detector.detector PIXEL
_diffrn_detector.diffrn_id 1
_diffrn_detector.type 'DECTRIS PILATUS 2M'
_diffrn_detector.area_resol_mean ?
_diffrn_detector.dtime ?
_diffrn_detector.pdbx_frames_total ?
_diffrn_detector.pdbx_collection_time_total ?
_diffrn_detector.pdbx_collection_date 2021-06-18
_diffrn_detector.pdbx_frequency ?
#
_diffrn_radiation.collimation ?
_diffrn_radiation.diffrn_id 1
_diffrn_radiation.filter_edge ?
_diffrn_radiation.inhomogeneity ?
_diffrn_radiation.monochromator ?
_diffrn_radiation.polarisn_norm ?
_diffrn_radiation.polarisn_ratio ?
_diffrn_radiation.probe ?
_diffrn_radiation.type ?
_diffrn_radiation.xray_symbol ?
_diffrn_radiation.wavelength_id 1
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l M
_diffrn_radiation.pdbx_wavelength_list ?
_diffrn_radiation.pdbx_wavelength ?
_diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH'
_diffrn_radiation.pdbx_analyzer ?
_diffrn_radiation.pdbx_scattering_type x-ray
#
_diffrn_radiation_wavelength.id 1
_diffrn_radiation_wavelength.wavelength 0.9
_diffrn_radiation_wavelength.wt 1.0
#
_diffrn_source.current ?
_diffrn_source.details ?
_diffrn_source.diffrn_id 1
_diffrn_source.power ?
_diffrn_source.size ?
_diffrn_source.source SYNCHROTRON
_diffrn_source.target ?
_diffrn_source.type 'SLS BEAMLINE X06DA'
_diffrn_source.voltage ?
_diffrn_source.take-off_angle ?
_diffrn_source.pdbx_wavelength_list 0.9
_diffrn_source.pdbx_wavelength ?
_diffrn_source.pdbx_synchrotron_beamline X06DA
_diffrn_source.pdbx_synchrotron_site SLS
#
_reflns.B_iso_Wilson_estimate 7.88
_reflns.entry_id 7QSH
_reflns.data_reduction_details ?
_reflns.data_reduction_method ?
_reflns.d_resolution_high 0.86
_reflns.d_resolution_low 50
_reflns.details ?
_reflns.limit_h_max ?
_reflns.limit_h_min ?
_reflns.limit_k_max ?
_reflns.limit_k_min ?
_reflns.limit_l_max ?
_reflns.limit_l_min ?
_reflns.number_all ?
_reflns.number_obs 54707
_reflns.observed_criterion ?
_reflns.observed_criterion_F_max ?
_reflns.observed_criterion_F_min ?
_reflns.observed_criterion_I_max ?
_reflns.observed_criterion_I_min ?
_reflns.observed_criterion_sigma_F ?
_reflns.observed_criterion_sigma_I ?
_reflns.percent_possible_obs 98.9
_reflns.R_free_details ?
_reflns.Rmerge_F_all ?
_reflns.Rmerge_F_obs ?
_reflns.Friedel_coverage ?
_reflns.number_gt ?
_reflns.threshold_expression ?
_reflns.pdbx_redundancy 20
_reflns.pdbx_Rmerge_I_obs ?
_reflns.pdbx_Rmerge_I_all ?
_reflns.pdbx_Rsym_value ?
_reflns.pdbx_netI_over_av_sigmaI ?
_reflns.pdbx_netI_over_sigmaI 56
_reflns.pdbx_res_netI_over_av_sigmaI_2 ?
_reflns.pdbx_res_netI_over_sigmaI_2 ?
_reflns.pdbx_chi_squared ?
_reflns.pdbx_scaling_rejects ?
_reflns.pdbx_d_res_high_opt ?
_reflns.pdbx_d_res_low_opt ?
_reflns.pdbx_d_res_opt_method ?
_reflns.phase_calculation_details ?
_reflns.pdbx_Rrim_I_all ?
_reflns.pdbx_Rpim_I_all ?
_reflns.pdbx_d_opt ?
_reflns.pdbx_number_measured_all ?
_reflns.pdbx_diffrn_id 1
_reflns.pdbx_ordinal 1
_reflns.pdbx_CC_half 1.00
_reflns.pdbx_CC_star ?
_reflns.pdbx_R_split ?
_reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ?
_reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ?
_reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ?
_reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ?
_reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ?
_reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ?
_reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ?
_reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ?
_reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ?
_reflns.pdbx_aniso_diffraction_limit_1 ?
_reflns.pdbx_aniso_diffraction_limit_2 ?
_reflns.pdbx_aniso_diffraction_limit_3 ?
_reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ?
_reflns.pdbx_aniso_B_tensor_eigenvalue_1 ?
_reflns.pdbx_aniso_B_tensor_eigenvalue_2 ?
_reflns.pdbx_aniso_B_tensor_eigenvalue_3 ?
_reflns.pdbx_orthogonalization_convention ?
_reflns.pdbx_percent_possible_ellipsoidal ?
_reflns.pdbx_percent_possible_spherical ?
_reflns.pdbx_percent_possible_ellipsoidal_anomalous ?
_reflns.pdbx_percent_possible_spherical_anomalous ?
_reflns.pdbx_redundancy_anomalous ?
_reflns.pdbx_CC_half_anomalous ?
_reflns.pdbx_absDiff_over_sigma_anomalous ?
_reflns.pdbx_percent_possible_anomalous ?
_reflns.pdbx_observed_signal_threshold ?
_reflns.pdbx_signal_type ?
_reflns.pdbx_signal_details ?
_reflns.pdbx_signal_software_id ?
#
_reflns_shell.d_res_high 0.86
_reflns_shell.d_res_low 0.88
_reflns_shell.meanI_over_sigI_all ?
_reflns_shell.meanI_over_sigI_obs ?
_reflns_shell.number_measured_all ?
_reflns_shell.number_measured_obs ?
_reflns_shell.number_possible ?
_reflns_shell.number_unique_all ?
_reflns_shell.number_unique_obs 3549
_reflns_shell.percent_possible_all ?
_reflns_shell.percent_possible_obs ?
_reflns_shell.Rmerge_F_all ?
_reflns_shell.Rmerge_F_obs ?
_reflns_shell.Rmerge_I_all ?
_reflns_shell.Rmerge_I_obs ?
_reflns_shell.meanI_over_sigI_gt ?
_reflns_shell.meanI_over_uI_all ?
_reflns_shell.meanI_over_uI_gt ?
_reflns_shell.number_measured_gt ?
_reflns_shell.number_unique_gt ?
_reflns_shell.percent_possible_gt ?
_reflns_shell.Rmerge_F_gt ?
_reflns_shell.Rmerge_I_gt ?
_reflns_shell.pdbx_redundancy ?
_reflns_shell.pdbx_Rsym_value ?
_reflns_shell.pdbx_chi_squared ?
_reflns_shell.pdbx_netI_over_sigmaI_all ?
_reflns_shell.pdbx_netI_over_sigmaI_obs ?
_reflns_shell.pdbx_Rrim_I_all ?
_reflns_shell.pdbx_Rpim_I_all ?
_reflns_shell.pdbx_rejects ?
_reflns_shell.pdbx_ordinal 1
_reflns_shell.pdbx_diffrn_id 1
_reflns_shell.pdbx_CC_half .049
_reflns_shell.pdbx_CC_star ?
_reflns_shell.pdbx_R_split ?
_reflns_shell.pdbx_percent_possible_ellipsoidal ?
_reflns_shell.pdbx_percent_possible_spherical ?
_reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ?
_reflns_shell.pdbx_percent_possible_spherical_anomalous ?
_reflns_shell.pdbx_redundancy_anomalous ?
_reflns_shell.pdbx_CC_half_anomalous ?
_reflns_shell.pdbx_absDiff_over_sigma_anomalous ?
_reflns_shell.pdbx_percent_possible_anomalous ?
#
_refine.aniso_B[1][1] ?
_refine.aniso_B[1][2] ?
_refine.aniso_B[1][3] ?
_refine.aniso_B[2][2] ?
_refine.aniso_B[2][3] ?
_refine.aniso_B[3][3] ?
_refine.B_iso_max ?
_refine.B_iso_mean 13.38
_refine.B_iso_min ?
_refine.correlation_coeff_Fo_to_Fc ?
_refine.correlation_coeff_Fo_to_Fc_free ?
_refine.details ?
_refine.diff_density_max ?
_refine.diff_density_max_esd ?
_refine.diff_density_min ?
_refine.diff_density_min_esd ?
_refine.diff_density_rms ?
_refine.diff_density_rms_esd ?
_refine.entry_id 7QSH
_refine.pdbx_refine_id 'X-RAY DIFFRACTION'
_refine.ls_abs_structure_details ?
_refine.ls_abs_structure_Flack ?
_refine.ls_abs_structure_Flack_esd ?
_refine.ls_abs_structure_Rogers ?
_refine.ls_abs_structure_Rogers_esd ?
_refine.ls_d_res_high 0.86
_refine.ls_d_res_low 29.50
_refine.ls_extinction_coef ?
_refine.ls_extinction_coef_esd ?
_refine.ls_extinction_expression ?
_refine.ls_extinction_method ?
_refine.ls_goodness_of_fit_all ?
_refine.ls_goodness_of_fit_all_esd ?
_refine.ls_goodness_of_fit_obs ?
_refine.ls_goodness_of_fit_obs_esd ?
_refine.ls_hydrogen_treatment ?
_refine.ls_matrix_type ?
_refine.ls_number_constraints ?
_refine.ls_number_parameters ?
_refine.ls_number_reflns_all ?
_refine.ls_number_reflns_obs 54705
_refine.ls_number_reflns_R_free 2736
_refine.ls_number_reflns_R_work 51969
_refine.ls_number_restraints ?
_refine.ls_percent_reflns_obs 98.94
_refine.ls_percent_reflns_R_free 5.00
_refine.ls_R_factor_all ?
_refine.ls_R_factor_obs 0.1476
_refine.ls_R_factor_R_free 0.1663
_refine.ls_R_factor_R_free_error ?
_refine.ls_R_factor_R_free_error_details ?
_refine.ls_R_factor_R_work 0.1466
_refine.ls_R_Fsqd_factor_obs ?
_refine.ls_R_I_factor_obs ?
_refine.ls_redundancy_reflns_all ?
_refine.ls_redundancy_reflns_obs ?
_refine.ls_restrained_S_all ?
_refine.ls_restrained_S_obs ?
_refine.ls_shift_over_esd_max ?
_refine.ls_shift_over_esd_mean ?
_refine.ls_structure_factor_coef ?
_refine.ls_weighting_details ?
_refine.ls_weighting_scheme ?
_refine.ls_wR_factor_all ?
_refine.ls_wR_factor_obs ?
_refine.ls_wR_factor_R_free ?
_refine.ls_wR_factor_R_work ?
_refine.occupancy_max ?
_refine.occupancy_min ?
_refine.solvent_model_details 'FLAT BULK SOLVENT MODEL'
_refine.solvent_model_param_bsol ?
_refine.solvent_model_param_ksol ?
_refine.pdbx_R_complete ?
_refine.ls_R_factor_gt ?
_refine.ls_goodness_of_fit_gt ?
_refine.ls_goodness_of_fit_ref ?
_refine.ls_shift_over_su_max ?
_refine.ls_shift_over_su_max_lt ?
_refine.ls_shift_over_su_mean ?
_refine.ls_shift_over_su_mean_lt ?
_refine.pdbx_ls_sigma_I ?
_refine.pdbx_ls_sigma_F 1.35
_refine.pdbx_ls_sigma_Fsqd ?
_refine.pdbx_data_cutoff_high_absF ?
_refine.pdbx_data_cutoff_high_rms_absF ?
_refine.pdbx_data_cutoff_low_absF ?
_refine.pdbx_isotropic_thermal_model ?
_refine.pdbx_ls_cross_valid_method 'FREE R-VALUE'
_refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT'
_refine.pdbx_starting_model 3DVZ
_refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2'
_refine.pdbx_R_Free_selection_details ?
_refine.pdbx_stereochem_target_val_spec_case ?
_refine.pdbx_overall_ESU_R ?
_refine.pdbx_overall_ESU_R_Free ?
_refine.pdbx_solvent_vdw_probe_radii 0.6000
_refine.pdbx_solvent_ion_probe_radii ?
_refine.pdbx_solvent_shrinkage_radii 0.4000
_refine.pdbx_real_space_R ?
_refine.pdbx_density_correlation ?
_refine.pdbx_pd_number_of_powder_patterns ?
_refine.pdbx_pd_number_of_points ?
_refine.pdbx_pd_meas_number_of_points ?
_refine.pdbx_pd_proc_ls_prof_R_factor ?
_refine.pdbx_pd_proc_ls_prof_wR_factor ?
_refine.pdbx_pd_Marquardt_correlation_coeff ?
_refine.pdbx_pd_Fsqrd_R_factor ?
_refine.pdbx_pd_ls_matrix_band_width ?
_refine.pdbx_overall_phase_error 18.2879
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI ?
_refine.pdbx_overall_SU_R_free_Blow_DPI ?
_refine.pdbx_overall_SU_R_Blow_DPI ?
_refine.pdbx_TLS_residual_ADP_flag ?
_refine.pdbx_diffrn_id 1
_refine.overall_SU_B ?
_refine.overall_SU_ML 0.0940
_refine.overall_SU_R_Cruickshank_DPI ?
_refine.overall_SU_R_free ?
_refine.overall_FOM_free_R_set ?
_refine.overall_FOM_work_R_set ?
_refine.pdbx_average_fsc_overall ?
_refine.pdbx_average_fsc_work ?
_refine.pdbx_average_fsc_free ?
#
_refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION'
_refine_hist.cycle_id LAST
_refine_hist.details ?
_refine_hist.d_res_high 0.86
_refine_hist.d_res_low 29.50
_refine_hist.number_atoms_solvent 147
_refine_hist.number_atoms_total 737
_refine_hist.number_reflns_all ?
_refine_hist.number_reflns_obs ?
_refine_hist.number_reflns_R_free ?
_refine_hist.number_reflns_R_work ?
_refine_hist.R_factor_all ?
_refine_hist.R_factor_obs ?
_refine_hist.R_factor_R_free ?
_refine_hist.R_factor_R_work ?
_refine_hist.pdbx_number_residues_total ?
_refine_hist.pdbx_B_iso_mean_ligand ?
_refine_hist.pdbx_B_iso_mean_solvent ?
_refine_hist.pdbx_number_atoms_protein 0
_refine_hist.pdbx_number_atoms_nucleic_acid 539
_refine_hist.pdbx_number_atoms_ligand 51
_refine_hist.pdbx_number_atoms_lipid ?
_refine_hist.pdbx_number_atoms_carb ?
_refine_hist.pdbx_pseudo_atom_details ?
#
loop_
_refine_ls_restr.pdbx_refine_id
_refine_ls_restr.criterion
_refine_ls_restr.dev_ideal
_refine_ls_restr.dev_ideal_target
_refine_ls_restr.number
_refine_ls_restr.rejects
_refine_ls_restr.type
_refine_ls_restr.weight
_refine_ls_restr.pdbx_restraint_function
'X-RAY DIFFRACTION' ? 0.0051 ? 918 ? f_bond_d ? ?
'X-RAY DIFFRACTION' ? 1.4213 ? 1427 ? f_angle_d ? ?
'X-RAY DIFFRACTION' ? 0.0449 ? 186 ? f_chiral_restr ? ?
'X-RAY DIFFRACTION' ? 0.0198 ? 40 ? f_plane_restr ? ?
'X-RAY DIFFRACTION' ? 10.9542 ? 434 ? f_dihedral_angle_d ? ?
#
loop_
_refine_ls_shell.pdbx_refine_id
_refine_ls_shell.d_res_high
_refine_ls_shell.d_res_low
_refine_ls_shell.number_reflns_all
_refine_ls_shell.number_reflns_obs
_refine_ls_shell.number_reflns_R_free
_refine_ls_shell.number_reflns_R_work
_refine_ls_shell.percent_reflns_obs
_refine_ls_shell.percent_reflns_R_free
_refine_ls_shell.R_factor_all
_refine_ls_shell.R_factor_obs
_refine_ls_shell.R_factor_R_free
_refine_ls_shell.R_factor_R_free_error
_refine_ls_shell.R_factor_R_work
_refine_ls_shell.redundancy_reflns_all
_refine_ls_shell.redundancy_reflns_obs
_refine_ls_shell.wR_factor_all
_refine_ls_shell.wR_factor_obs
_refine_ls_shell.wR_factor_R_free
_refine_ls_shell.wR_factor_R_work
_refine_ls_shell.pdbx_R_complete
_refine_ls_shell.pdbx_total_number_of_bins_used
_refine_ls_shell.pdbx_phase_error
_refine_ls_shell.pdbx_fsc_work
_refine_ls_shell.pdbx_fsc_free
'X-RAY DIFFRACTION' 0.86 0.87 . . 116 2202 83.44 . . . 0.3330 . 0.3497 . . . . . . . . . . .
'X-RAY DIFFRACTION' 0.87 0.89 . . 134 2544 96.12 . . . 0.3070 . 0.2952 . . . . . . . . . . .
'X-RAY DIFFRACTION' 0.89 0.91 . . 135 2573 99.34 . . . 0.2599 . 0.2593 . . . . . . . . . . .
'X-RAY DIFFRACTION' 0.91 0.93 . . 139 2638 100.00 . . . 0.2319 . 0.2271 . . . . . . . . . . .
'X-RAY DIFFRACTION' 0.93 0.95 . . 138 2610 100.00 . . . 0.2181 . 0.2156 . . . . . . . . . . .
'X-RAY DIFFRACTION' 0.95 0.97 . . 136 2599 100.00 . . . 0.2563 . 0.2128 . . . . . . . . . . .
'X-RAY DIFFRACTION' 0.97 0.99 . . 140 2642 100.00 . . . 0.2239 . 0.2052 . . . . . . . . . . .
'X-RAY DIFFRACTION' 0.99 1.02 . . 138 2637 100.00 . . . 0.1831 . 0.1877 . . . . . . . . . . .
'X-RAY DIFFRACTION' 1.02 1.05 . . 138 2622 100.00 . . . 0.1866 . 0.1806 . . . . . . . . . . .
'X-RAY DIFFRACTION' 1.05 1.08 . . 137 2595 100.00 . . . 0.1823 . 0.1698 . . . . . . . . . . .
'X-RAY DIFFRACTION' 1.08 1.12 . . 139 2633 100.00 . . . 0.1582 . 0.1626 . . . . . . . . . . .
'X-RAY DIFFRACTION' 1.12 1.17 . . 136 2599 100.00 . . . 0.1456 . 0.1571 . . . . . . . . . . .
'X-RAY DIFFRACTION' 1.17 1.22 . . 140 2647 100.00 . . . 0.1679 . 0.1515 . . . . . . . . . . .
'X-RAY DIFFRACTION' 1.22 1.28 . . 138 2621 100.00 . . . 0.1466 . 0.1480 . . . . . . . . . . .
'X-RAY DIFFRACTION' 1.28 1.37 . . 137 2618 100.00 . . . 0.1645 . 0.1510 . . . . . . . . . . .
'X-RAY DIFFRACTION' 1.37 1.47 . . 139 2642 100.00 . . . 0.1673 . 0.1522 . . . . . . . . . . .
'X-RAY DIFFRACTION' 1.47 1.62 . . 138 2609 100.00 . . . 0.1464 . 0.1368 . . . . . . . . . . .
'X-RAY DIFFRACTION' 1.62 1.85 . . 139 2644 100.00 . . . 0.1317 . 0.1220 . . . . . . . . . . .
'X-RAY DIFFRACTION' 1.85 2.33 . . 138 2633 100.00 . . . 0.1719 . 0.1346 . . . . . . . . . . .
'X-RAY DIFFRACTION' 2.33 29.50 . . 141 2661 99.93 . . . 0.1598 . 0.1219 . . . . . . . . . . .
#
_struct.entry_id 7QSH
_struct.title
'23S ribosomal RNA Sarcin Ricin Loop 27-nt fragment containing a Xanthosine residue at position 2648'
_struct.pdbx_model_details ?
_struct.pdbx_formula_weight ?
_struct.pdbx_formula_weight_method ?
_struct.pdbx_model_type_details ?
_struct.pdbx_CASP_flag N
#
_struct_keywords.entry_id 7QSH
_struct_keywords.text 'RNA, modified base'
_struct_keywords.pdbx_keywords RNA
#
loop_
_struct_asym.id
_struct_asym.pdbx_blank_PDB_chainid_flag
_struct_asym.pdbx_modified
_struct_asym.entity_id
_struct_asym.details
A N N 1 ?
B N N 2 ?
C N N 3 ?
D N N 4 ?
E N N 5 ?
F N N 6 ?
#
_struct_ref.id 1
_struct_ref.db_name PDB
_struct_ref.db_code 7QSH
_struct_ref.pdbx_db_accession 7QSH
_struct_ref.pdbx_db_isoform ?
_struct_ref.entity_id 1
_struct_ref.pdbx_seq_one_letter_code ?
_struct_ref.pdbx_align_begin 1
#
_struct_ref_seq.align_id 1
_struct_ref_seq.ref_id 1
_struct_ref_seq.pdbx_PDB_id_code 7QSH
_struct_ref_seq.pdbx_strand_id A
_struct_ref_seq.seq_align_beg 1
_struct_ref_seq.pdbx_seq_align_beg_ins_code ?
_struct_ref_seq.seq_align_end 27
_struct_ref_seq.pdbx_seq_align_end_ins_code ?
_struct_ref_seq.pdbx_db_accession 7QSH
_struct_ref_seq.db_align_beg 2647
_struct_ref_seq.pdbx_db_align_beg_ins_code ?
_struct_ref_seq.db_align_end 2673
_struct_ref_seq.pdbx_db_align_end_ins_code ?
_struct_ref_seq.pdbx_auth_seq_align_beg 2647
_struct_ref_seq.pdbx_auth_seq_align_end 2673
#
_pdbx_struct_assembly.id 1
_pdbx_struct_assembly.details author_defined_assembly
_pdbx_struct_assembly.method_details ?
_pdbx_struct_assembly.oligomeric_details monomeric
_pdbx_struct_assembly.oligomeric_count 1
#
_pdbx_struct_assembly_gen.assembly_id 1
_pdbx_struct_assembly_gen.oper_expression 1
_pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F
#
_pdbx_struct_assembly_auth_evidence.id 1
_pdbx_struct_assembly_auth_evidence.assembly_id 1
_pdbx_struct_assembly_auth_evidence.experimental_support none
_pdbx_struct_assembly_auth_evidence.details ?
#
_pdbx_struct_oper_list.id 1
_pdbx_struct_oper_list.type 'identity operation'
_pdbx_struct_oper_list.name 1_555
_pdbx_struct_oper_list.symmetry_operation x,y,z
_pdbx_struct_oper_list.matrix[1][1] 1.0000000000
_pdbx_struct_oper_list.matrix[1][2] 0.0000000000
_pdbx_struct_oper_list.matrix[1][3] 0.0000000000
_pdbx_struct_oper_list.vector[1] 0.0000000000
_pdbx_struct_oper_list.matrix[2][1] 0.0000000000
_pdbx_struct_oper_list.matrix[2][2] 1.0000000000
_pdbx_struct_oper_list.matrix[2][3] 0.0000000000
_pdbx_struct_oper_list.vector[2] 0.0000000000
_pdbx_struct_oper_list.matrix[3][1] 0.0000000000
_pdbx_struct_oper_list.matrix[3][2] 0.0000000000
_pdbx_struct_oper_list.matrix[3][3] 1.0000000000
_pdbx_struct_oper_list.vector[3] 0.0000000000
#
loop_
_struct_conn.id
_struct_conn.conn_type_id
_struct_conn.pdbx_leaving_atom_flag
_struct_conn.pdbx_PDB_id
_struct_conn.ptnr1_label_asym_id
_struct_conn.ptnr1_label_comp_id
_struct_conn.ptnr1_label_seq_id
_struct_conn.ptnr1_label_atom_id
_struct_conn.pdbx_ptnr1_label_alt_id
_struct_conn.pdbx_ptnr1_PDB_ins_code
_struct_conn.pdbx_ptnr1_standard_comp_id
_struct_conn.ptnr1_symmetry
_struct_conn.ptnr2_label_asym_id
_struct_conn.ptnr2_label_comp_id
_struct_conn.ptnr2_label_seq_id
_struct_conn.ptnr2_label_atom_id
_struct_conn.pdbx_ptnr2_label_alt_id
_struct_conn.pdbx_ptnr2_PDB_ins_code
_struct_conn.ptnr1_auth_asym_id
_struct_conn.ptnr1_auth_comp_id
_struct_conn.ptnr1_auth_seq_id
_struct_conn.ptnr2_auth_asym_id
_struct_conn.ptnr2_auth_comp_id
_struct_conn.ptnr2_auth_seq_id
_struct_conn.ptnr2_symmetry
_struct_conn.pdbx_ptnr3_label_atom_id
_struct_conn.pdbx_ptnr3_label_seq_id
_struct_conn.pdbx_ptnr3_label_comp_id
_struct_conn.pdbx_ptnr3_label_asym_id
_struct_conn.pdbx_ptnr3_label_alt_id
_struct_conn.pdbx_ptnr3_PDB_ins_code
_struct_conn.details
_struct_conn.pdbx_dist_value
_struct_conn.pdbx_value_order
_struct_conn.pdbx_role
covale1 covale one ? A C 3 P A ? ? 1_555 C HYJ . "O3'" A ? A C 2649 A HYJ 2702 1_555 ? ? ? ? ? ? ?
1.599 ? ?
covale2 covale one ? A C 3 P B ? ? 1_555 C HYJ . "O3'" B ? A C 2649 A HYJ 2702 1_555 ? ? ? ? ? ? ?
1.605 ? ?
covale3 covale one ? B URI . "O3'" A ? ? 1_555 C HYJ . P A ? A URI 2701 A HYJ 2702 1_555 ? ? ? ? ? ? ?
1.607 ? ?
covale4 covale one ? B URI . "O3'" B ? ? 1_555 C HYJ . P B ? A URI 2701 A HYJ 2702 1_555 ? ? ? ? ? ? ?
1.612 ? ?
hydrog1 hydrog ? ? A C 3 N3 A ? ? 1_555 A G 25 N1 A ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog2 hydrog ? ? A C 3 N3 B ? ? 1_555 A G 25 N1 B ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog3 hydrog ? ? A C 3 N4 A ? ? 1_555 A G 25 O6 A ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog4 hydrog ? ? A C 3 N4 B ? ? 1_555 A G 25 O6 B ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog5 hydrog ? ? A C 3 O2 A ? ? 1_555 A G 25 N2 A ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog6 hydrog ? ? A C 3 O2 B ? ? 1_555 A G 25 N2 B ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog7 hydrog ? ? A U 4 N3 A ? ? 1_555 A A 24 N1 A ? A U 2650 A A 2670 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog8 hydrog ? ? A U 4 N3 B ? ? 1_555 A A 24 N1 B ? A U 2650 A A 2670 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog9 hydrog ? ? A U 4 O4 A ? ? 1_555 A A 24 N6 A ? A U 2650 A A 2670 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog10 hydrog ? ? A U 4 O4 B ? ? 1_555 A A 24 N6 B ? A U 2650 A A 2670 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog11 hydrog ? ? A C 5 N3 A ? ? 1_555 A G 23 N1 A ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog12 hydrog ? ? A C 5 N3 B ? ? 1_555 A G 23 N1 B ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog13 hydrog ? ? A C 5 N4 A ? ? 1_555 A G 23 O6 A ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog14 hydrog ? ? A C 5 N4 B ? ? 1_555 A G 23 O6 B ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog15 hydrog ? ? A C 5 O2 A ? ? 1_555 A G 23 N2 A ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog16 hydrog ? ? A C 5 O2 B ? ? 1_555 A G 23 N2 B ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog17 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 22 N1 A ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog18 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 22 N1 B ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog19 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 22 O6 A ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog20 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 22 O6 B ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog21 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 22 N2 A ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog22 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 22 N2 B ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog23 hydrog ? ? A U 7 O2 ? ? ? 1_555 A C 21 N4 ? ? A U 2653 A C 2667 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ?
? ?
hydrog24 hydrog ? ? A U 10 N3 ? ? ? 1_555 A A 19 N7 ? ? A U 2656 A A 2665 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ?
? ?
hydrog25 hydrog ? ? A U 10 O2 ? ? ? 1_555 A A 19 N6 ? ? A U 2656 A A 2665 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ?
? ?
hydrog26 hydrog ? ? A A 11 N6 ? ? ? 1_555 A G 18 N3 ? ? A A 2657 A G 2664 1_555 ? ? ? ? ? ? TYPE_11_PAIR ?
? ?
hydrog27 hydrog ? ? A A 11 N7 ? ? ? 1_555 A G 18 N2 ? ? A A 2657 A G 2664 1_555 ? ? ? ? ? ? TYPE_11_PAIR ?
? ?
hydrog28 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 2658 A G 2663 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog29 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 2658 A G 2663 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog30 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 2658 A G 2663 1_555 ? ? ? ? ? ? WATSON-CRICK ?
? ?
hydrog31 hydrog ? ? A G 13 N2 ? ? ? 1_555 A A 16 N7 ? ? A G 2659 A A 2662 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ?
? ?
#
loop_
_struct_conn_type.id
_struct_conn_type.criteria
_struct_conn_type.reference
covale ? ?
hydrog ? ?
#
_pdbx_validate_rmsd_angle.id 1
_pdbx_validate_rmsd_angle.PDB_model_num 1
_pdbx_validate_rmsd_angle.auth_atom_id_1 "O5'"
_pdbx_validate_rmsd_angle.auth_asym_id_1 A
_pdbx_validate_rmsd_angle.auth_comp_id_1 G
_pdbx_validate_rmsd_angle.auth_seq_id_1 2655
_pdbx_validate_rmsd_angle.PDB_ins_code_1 ?
_pdbx_validate_rmsd_angle.label_alt_id_1 ?
_pdbx_validate_rmsd_angle.auth_atom_id_2 P
_pdbx_validate_rmsd_angle.auth_asym_id_2 A
_pdbx_validate_rmsd_angle.auth_comp_id_2 G
_pdbx_validate_rmsd_angle.auth_seq_id_2 2655
_pdbx_validate_rmsd_angle.PDB_ins_code_2 ?
_pdbx_validate_rmsd_angle.label_alt_id_2 ?
_pdbx_validate_rmsd_angle.auth_atom_id_3 OP2
_pdbx_validate_rmsd_angle.auth_asym_id_3 A
_pdbx_validate_rmsd_angle.auth_comp_id_3 G
_pdbx_validate_rmsd_angle.auth_seq_id_3 2655
_pdbx_validate_rmsd_angle.PDB_ins_code_3 ?
_pdbx_validate_rmsd_angle.label_alt_id_3 ?
_pdbx_validate_rmsd_angle.angle_value 99.45
_pdbx_validate_rmsd_angle.angle_target_value 105.70
_pdbx_validate_rmsd_angle.angle_deviation -6.25
_pdbx_validate_rmsd_angle.angle_standard_deviation 0.90
_pdbx_validate_rmsd_angle.linker_flag N
#
_pdbx_validate_polymer_linkage.id 1
_pdbx_validate_polymer_linkage.PDB_model_num 1
_pdbx_validate_polymer_linkage.auth_atom_id_1 "O3'"
_pdbx_validate_polymer_linkage.auth_asym_id_1 A
_pdbx_validate_polymer_linkage.auth_comp_id_1 U
_pdbx_validate_polymer_linkage.auth_seq_id_1 2672
_pdbx_validate_polymer_linkage.PDB_ins_code_1 ?
_pdbx_validate_polymer_linkage.label_alt_id_1 B
_pdbx_validate_polymer_linkage.auth_atom_id_2 P
_pdbx_validate_polymer_linkage.auth_asym_id_2 A
_pdbx_validate_polymer_linkage.auth_comp_id_2 G
_pdbx_validate_polymer_linkage.auth_seq_id_2 2673
_pdbx_validate_polymer_linkage.PDB_ins_code_2 ?
_pdbx_validate_polymer_linkage.label_alt_id_2 B
_pdbx_validate_polymer_linkage.dist 2.78
#
loop_
_space_group_symop.id
_space_group_symop.operation_xyz
1 x,y,z
2 -y,x,z+3/4
3 y,-x,z+1/4
4 -x,-y,z+1/2
#
_pdbx_entry_details.entry_id 7QSH
_pdbx_entry_details.has_ligand_of_interest Y
_pdbx_entry_details.compound_details ?
_pdbx_entry_details.source_details ?
_pdbx_entry_details.nonpolymer_details ?
_pdbx_entry_details.sequence_details ?
#
loop_
_pdbx_unobs_or_zero_occ_residues.id
_pdbx_unobs_or_zero_occ_residues.PDB_model_num
_pdbx_unobs_or_zero_occ_residues.polymer_flag
_pdbx_unobs_or_zero_occ_residues.occupancy_flag
_pdbx_unobs_or_zero_occ_residues.auth_asym_id
_pdbx_unobs_or_zero_occ_residues.auth_comp_id
_pdbx_unobs_or_zero_occ_residues.auth_seq_id
_pdbx_unobs_or_zero_occ_residues.PDB_ins_code
_pdbx_unobs_or_zero_occ_residues.label_asym_id
_pdbx_unobs_or_zero_occ_residues.label_comp_id
_pdbx_unobs_or_zero_occ_residues.label_seq_id
1 1 Y 1 A U 2647 ? A U 1
2 1 Y 1 A XAN 2648 ? A XAN 2
#
loop_
_chem_comp_atom.comp_id
_chem_comp_atom.atom_id
_chem_comp_atom.type_symbol
_chem_comp_atom.pdbx_aromatic_flag
_chem_comp_atom.pdbx_stereo_config
_chem_comp_atom.pdbx_ordinal
A OP3 O N N 1
A P P N N 2
A OP1 O N N 3
A OP2 O N N 4
A "O5'" O N N 5
A "C5'" C N N 6
A "C4'" C N R 7
A "O4'" O N N 8
A "C3'" C N S 9
A "O3'" O N N 10
A "C2'" C N R 11
A "O2'" O N N 12
A "C1'" C N R 13
A N9 N Y N 14
A C8 C Y N 15
A N7 N Y N 16
A C5 C Y N 17
A C6 C Y N 18
A N6 N N N 19
A N1 N Y N 20
A C2 C Y N 21
A N3 N Y N 22
A C4 C Y N 23
A HOP3 H N N 24
A HOP2 H N N 25
A "H5'" H N N 26
A "H5''" H N N 27
A "H4'" H N N 28
A "H3'" H N N 29
A "HO3'" H N N 30
A "H2'" H N N 31
A "HO2'" H N N 32
A "H1'" H N N 33
A H8 H N N 34
A H61 H N N 35
A H62 H N N 36
A H2 H N N 37
C OP3 O N N 38
C P P N N 39
C OP1 O N N 40
C OP2 O N N 41
C "O5'" O N N 42
C "C5'" C N N 43
C "C4'" C N R 44
C "O4'" O N N 45
C "C3'" C N S 46
C "O3'" O N N 47
C "C2'" C N R 48
C "O2'" O N N 49
C "C1'" C N R 50
C N1 N N N 51
C C2 C N N 52
C O2 O N N 53
C N3 N N N 54
C C4 C N N 55
C N4 N N N 56
C C5 C N N 57
C C6 C N N 58
C HOP3 H N N 59
C HOP2 H N N 60
C "H5'" H N N 61
C "H5''" H N N 62
C "H4'" H N N 63
C "H3'" H N N 64
C "HO3'" H N N 65
C "H2'" H N N 66
C "HO2'" H N N 67
C "H1'" H N N 68
C H41 H N N 69
C H42 H N N 70
C H5 H N N 71
C H6 H N N 72
G OP3 O N N 73
G P P N N 74
G OP1 O N N 75
G OP2 O N N 76
G "O5'" O N N 77
G "C5'" C N N 78
G "C4'" C N R 79
G "O4'" O N N 80
G "C3'" C N S 81
G "O3'" O N N 82
G "C2'" C N R 83
G "O2'" O N N 84
G "C1'" C N R 85
G N9 N Y N 86
G C8 C Y N 87
G N7 N Y N 88
G C5 C Y N 89
G C6 C N N 90
G O6 O N N 91
G N1 N N N 92
G C2 C N N 93
G N2 N N N 94
G N3 N N N 95
G C4 C Y N 96
G HOP3 H N N 97
G HOP2 H N N 98
G "H5'" H N N 99
G "H5''" H N N 100
G "H4'" H N N 101
G "H3'" H N N 102
G "HO3'" H N N 103
G "H2'" H N N 104
G "HO2'" H N N 105
G "H1'" H N N 106
G H8 H N N 107
G H1 H N N 108
G H21 H N N 109
G H22 H N N 110
GOL C1 C N N 111
GOL O1 O N N 112
GOL C2 C N N 113
GOL O2 O N N 114
GOL C3 C N N 115
GOL O3 O N N 116
GOL H11 H N N 117
GOL H12 H N N 118
GOL HO1 H N N 119
GOL H2 H N N 120
GOL HO2 H N N 121
GOL H31 H N N 122
GOL H32 H N N 123
GOL HO3 H N N 124
HOH O O N N 125
HOH H1 H N N 126
HOH H2 H N N 127
HYJ N9 N Y N 128
HYJ C4 C Y N 129
HYJ N3 N N N 130
HYJ C2 C N N 131
HYJ O2 O N N 132
HYJ N1 N N N 133
HYJ C6 C N N 134
HYJ O6 O N N 135
HYJ C5 C Y N 136
HYJ N7 N Y N 137
HYJ C8 C Y N 138
HYJ "C1'" C N R 139
HYJ "C2'" C N R 140
HYJ "C3'" C N S 141
HYJ "C4'" C N R 142
HYJ "C5'" C N N 143
HYJ "O2'" O N N 144
HYJ "O3'" O N N 145
HYJ "O4'" O N N 146
HYJ "O5'" O N N 147
HYJ OP1 O N N 148
HYJ OP2 O N N 149
HYJ P P N N 150
HYJ HO2 H N N 151
HYJ H1 H N N 152
HYJ H8 H N N 153
HYJ "H1'" H N N 154
HYJ "H2'" H N N 155
HYJ "H3'" H N N 156
HYJ "H4'" H N N 157
HYJ "H5'2" H N N 158
HYJ "H5'1" H N N 159
HYJ "HO2'" H N N 160
HYJ H2 H N N 161
HYJ H3 H N N 162
HYJ OP3 O N N 163
HYJ H6 H N N 164
SO4 S S N N 165
SO4 O1 O N N 166
SO4 O2 O N N 167
SO4 O3 O N N 168
SO4 O4 O N N 169
U OP3 O N N 170
U P P N N 171
U OP1 O N N 172
U OP2 O N N 173
U "O5'" O N N 174
U "C5'" C N N 175
U "C4'" C N R 176
U "O4'" O N N 177
U "C3'" C N S 178
U "O3'" O N N 179
U "C2'" C N R 180
U "O2'" O N N 181
U "C1'" C N R 182
U N1 N N N 183
U C2 C N N 184
U O2 O N N 185
U N3 N N N 186
U C4 C N N 187
U O4 O N N 188
U C5 C N N 189
U C6 C N N 190
U HOP3 H N N 191
U HOP2 H N N 192
U "H5'" H N N 193
U "H5''" H N N 194
U "H4'" H N N 195
U "H3'" H N N 196
U "HO3'" H N N 197
U "H2'" H N N 198
U "HO2'" H N N 199
U "H1'" H N N 200
U H3 H N N 201
U H5 H N N 202
U H6 H N N 203
URI N1 N N N 204
URI C2 C N N 205
URI N3 N N N 206
URI C4 C N N 207
URI C5 C N N 208
URI C6 C N N 209
URI O2 O N N 210
URI O4 O N N 211
URI "C1'" C N R 212
URI "C2'" C N R 213
URI "C3'" C N S 214
URI "C4'" C N R 215
URI "O2'" O N N 216
URI "O3'" O N N 217
URI "O4'" O N N 218
URI "C5'" C N N 219
URI "O5'" O N N 220
URI H3 H N N 221
URI H5 H N N 222
URI H6 H N N 223
URI "H1'" H N N 224
URI "H2'" H N N 225
URI "H3'" H N N 226
URI "H4'" H N N 227
URI "HO2'" H N N 228
URI "HO3'" H N N 229
URI "H5'1" H N N 230
URI "H5'2" H N N 231
URI "HO5'" H N N 232
XAN N9 N Y N 233
XAN C4 C Y N 234
XAN N3 N Y N 235
XAN C2 C Y N 236
XAN O2 O N N 237
XAN N1 N Y N 238
XAN C6 C Y N 239
XAN O6 O N N 240
XAN C5 C Y N 241
XAN N7 N Y N 242
XAN C8 C Y N 243
XAN HN9 H N N 244
XAN HN3 H N N 245
XAN HN1 H N N 246
XAN H8 H N N 247
#
loop_
_chem_comp_bond.comp_id
_chem_comp_bond.atom_id_1
_chem_comp_bond.atom_id_2
_chem_comp_bond.value_order
_chem_comp_bond.pdbx_aromatic_flag
_chem_comp_bond.pdbx_stereo_config
_chem_comp_bond.pdbx_ordinal
A OP3 P sing N N 1
A OP3 HOP3 sing N N 2
A P OP1 doub N N 3
A P OP2 sing N N 4
A P "O5'" sing N N 5
A OP2 HOP2 sing N N 6
A "O5'" "C5'" sing N N 7
A "C5'" "C4'" sing N N 8
A "C5'" "H5'" sing N N 9
A "C5'" "H5''" sing N N 10
A "C4'" "O4'" sing N N 11
A "C4'" "C3'" sing N N 12
A "C4'" "H4'" sing N N 13
A "O4'" "C1'" sing N N 14
A "C3'" "O3'" sing N N 15
A "C3'" "C2'" sing N N 16
A "C3'" "H3'" sing N N 17
A "O3'" "HO3'" sing N N 18
A "C2'" "O2'" sing N N 19
A "C2'" "C1'" sing N N 20
A "C2'" "H2'" sing N N 21
A "O2'" "HO2'" sing N N 22
A "C1'" N9 sing N N 23
A "C1'" "H1'" sing N N 24
A N9 C8 sing Y N 25
A N9 C4 sing Y N 26
A C8 N7 doub Y N 27
A C8 H8 sing N N 28
A N7 C5 sing Y N 29
A C5 C6 sing Y N 30
A C5 C4 doub Y N 31
A C6 N6 sing N N 32
A C6 N1 doub Y N 33
A N6 H61 sing N N 34
A N6 H62 sing N N 35
A N1 C2 sing Y N 36
A C2 N3 doub Y N 37
A C2 H2 sing N N 38
A N3 C4 sing Y N 39
C OP3 P sing N N 40
C OP3 HOP3 sing N N 41
C P OP1 doub N N 42
C P OP2 sing N N 43
C P "O5'" sing N N 44
C OP2 HOP2 sing N N 45
C "O5'" "C5'" sing N N 46
C "C5'" "C4'" sing N N 47
C "C5'" "H5'" sing N N 48
C "C5'" "H5''" sing N N 49
C "C4'" "O4'" sing N N 50
C "C4'" "C3'" sing N N 51
C "C4'" "H4'" sing N N 52
C "O4'" "C1'" sing N N 53
C "C3'" "O3'" sing N N 54
C "C3'" "C2'" sing N N 55
C "C3'" "H3'" sing N N 56
C "O3'" "HO3'" sing N N 57
C "C2'" "O2'" sing N N 58
C "C2'" "C1'" sing N N 59
C "C2'" "H2'" sing N N 60
C "O2'" "HO2'" sing N N 61
C "C1'" N1 sing N N 62
C "C1'" "H1'" sing N N 63
C N1 C2 sing N N 64
C N1 C6 sing N N 65
C C2 O2 doub N N 66
C C2 N3 sing N N 67
C N3 C4 doub N N 68
C C4 N4 sing N N 69
C C4 C5 sing N N 70
C N4 H41 sing N N 71
C N4 H42 sing N N 72
C C5 C6 doub N N 73
C C5 H5 sing N N 74
C C6 H6 sing N N 75
G OP3 P sing N N 76
G OP3 HOP3 sing N N 77
G P OP1 doub N N 78
G P OP2 sing N N 79
G P "O5'" sing N N 80
G OP2 HOP2 sing N N 81
G "O5'" "C5'" sing N N 82
G "C5'" "C4'" sing N N 83
G "C5'" "H5'" sing N N 84
G "C5'" "H5''" sing N N 85
G "C4'" "O4'" sing N N 86
G "C4'" "C3'" sing N N 87
G "C4'" "H4'" sing N N 88
G "O4'" "C1'" sing N N 89
G "C3'" "O3'" sing N N 90
G "C3'" "C2'" sing N N 91
G "C3'" "H3'" sing N N 92
G "O3'" "HO3'" sing N N 93
G "C2'" "O2'" sing N N 94
G "C2'" "C1'" sing N N 95
G "C2'" "H2'" sing N N 96
G "O2'" "HO2'" sing N N 97
G "C1'" N9 sing N N 98
G "C1'" "H1'" sing N N 99
G N9 C8 sing Y N 100
G N9 C4 sing Y N 101
G C8 N7 doub Y N 102
G C8 H8 sing N N 103
G N7 C5 sing Y N 104
G C5 C6 sing N N 105
G C5 C4 doub Y N 106
G C6 O6 doub N N 107
G C6 N1 sing N N 108
G N1 C2 sing N N 109
G N1 H1 sing N N 110
G C2 N2 sing N N 111
G C2 N3 doub N N 112
G N2 H21 sing N N 113
G N2 H22 sing N N 114
G N3 C4 sing N N 115
GOL C1 O1 sing N N 116
GOL C1 C2 sing N N 117
GOL C1 H11 sing N N 118
GOL C1 H12 sing N N 119
GOL O1 HO1 sing N N 120
GOL C2 O2 sing N N 121
GOL C2 C3 sing N N 122
GOL C2 H2 sing N N 123
GOL O2 HO2 sing N N 124
GOL C3 O3 sing N N 125
GOL C3 H31 sing N N 126
GOL C3 H32 sing N N 127
GOL O3 HO3 sing N N 128
HOH O H1 sing N N 129
HOH O H2 sing N N 130
HYJ O2 C2 sing N N 131
HYJ C2 N1 sing N N 132
HYJ C2 N3 doub N N 133
HYJ N1 C6 sing N N 134
HYJ N3 C4 sing N N 135
HYJ C6 O6 doub N N 136
HYJ C6 C5 sing N N 137
HYJ C4 C5 doub Y N 138
HYJ C4 N9 sing Y N 139
HYJ C5 N7 sing Y N 140
HYJ "C1'" N9 sing N N 141
HYJ "C1'" "O4'" sing N N 142
HYJ "C1'" "C2'" sing N N 143
HYJ N9 C8 sing Y N 144
HYJ "O4'" "C4'" sing N N 145
HYJ N7 C8 doub Y N 146
HYJ "O2'" "C2'" sing N N 147
HYJ "C2'" "C3'" sing N N 148
HYJ "C4'" "C5'" sing N N 149
HYJ "C4'" "C3'" sing N N 150
HYJ "C5'" "O5'" sing N N 151
HYJ "O5'" P sing N N 152
HYJ "C3'" "O3'" sing N N 153
HYJ P OP2 doub N N 154
HYJ P OP1 sing N N 155
HYJ O2 HO2 sing N N 156
HYJ N1 H1 sing N N 157
HYJ C8 H8 sing N N 158
HYJ "C1'" "H1'" sing N N 159
HYJ "C2'" "H2'" sing N N 160
HYJ "C3'" "H3'" sing N N 161
HYJ "C4'" "H4'" sing N N 162
HYJ "C5'" "H5'2" sing N N 163
HYJ "C5'" "H5'1" sing N N 164
HYJ "O2'" "HO2'" sing N N 165
HYJ "O3'" H2 sing N N 166
HYJ OP1 H3 sing N N 167
HYJ P OP3 sing N N 168
HYJ OP3 H6 sing N N 169
SO4 S O1 doub N N 170
SO4 S O2 doub N N 171
SO4 S O3 sing N N 172
SO4 S O4 sing N N 173
U OP3 P sing N N 174
U OP3 HOP3 sing N N 175
U P OP1 doub N N 176
U P OP2 sing N N 177
U P "O5'" sing N N 178
U OP2 HOP2 sing N N 179
U "O5'" "C5'" sing N N 180
U "C5'" "C4'" sing N N 181
U "C5'" "H5'" sing N N 182
U "C5'" "H5''" sing N N 183
U "C4'" "O4'" sing N N 184
U "C4'" "C3'" sing N N 185
U "C4'" "H4'" sing N N 186
U "O4'" "C1'" sing N N 187
U "C3'" "O3'" sing N N 188
U "C3'" "C2'" sing N N 189
U "C3'" "H3'" sing N N 190
U "O3'" "HO3'" sing N N 191
U "C2'" "O2'" sing N N 192
U "C2'" "C1'" sing N N 193
U "C2'" "H2'" sing N N 194
U "O2'" "HO2'" sing N N 195
U "C1'" N1 sing N N 196
U "C1'" "H1'" sing N N 197
U N1 C2 sing N N 198
U N1 C6 sing N N 199
U C2 O2 doub N N 200
U C2 N3 sing N N 201
U N3 C4 sing N N 202
U N3 H3 sing N N 203
U C4 O4 doub N N 204
U C4 C5 sing N N 205
U C5 C6 doub N N 206
U C5 H5 sing N N 207
U C6 H6 sing N N 208
URI N1 C2 sing N N 209
URI N1 C6 sing N N 210
URI N1 "C1'" sing N N 211
URI C2 N3 sing N N 212
URI C2 O2 doub N N 213
URI N3 C4 sing N N 214
URI N3 H3 sing N N 215
URI C4 C5 sing N N 216
URI C4 O4 doub N N 217
URI C5 C6 doub N N 218
URI C5 H5 sing N N 219
URI C6 H6 sing N N 220
URI "C1'" "C2'" sing N N 221
URI "C1'" "O4'" sing N N 222
URI "C1'" "H1'" sing N N 223
URI "C2'" "C3'" sing N N 224
URI "C2'" "O2'" sing N N 225
URI "C2'" "H2'" sing N N 226
URI "C3'" "C4'" sing N N 227
URI "C3'" "O3'" sing N N 228
URI "C3'" "H3'" sing N N 229
URI "C4'" "O4'" sing N N 230
URI "C4'" "C5'" sing N N 231
URI "C4'" "H4'" sing N N 232
URI "O2'" "HO2'" sing N N 233
URI "O3'" "HO3'" sing N N 234
URI "C5'" "O5'" sing N N 235
URI "C5'" "H5'1" sing N N 236
URI "C5'" "H5'2" sing N N 237
URI "O5'" "HO5'" sing N N 238
XAN N9 C4 sing Y N 239
XAN N9 C8 sing Y N 240
XAN N9 HN9 sing N N 241
XAN C4 N3 sing Y N 242
XAN C4 C5 doub Y N 243
XAN N3 C2 sing Y N 244
XAN N3 HN3 sing N N 245
XAN C2 O2 doub N N 246
XAN C2 N1 sing Y N 247
XAN N1 C6 sing Y N 248
XAN N1 HN1 sing N N 249
XAN C6 O6 doub N N 250
XAN C6 C5 sing Y N 251
XAN C5 N7 sing Y N 252
XAN N7 C8 doub Y N 253
XAN C8 H8 sing N N 254
#
loop_
_ndb_struct_conf_na.entry_id
_ndb_struct_conf_na.feature
7QSH 'double helix'
7QSH 'a-form double helix'
7QSH tetraloop
7QSH 'mismatched base pair'
7QSH 'internal loop'
#
loop_
_ndb_struct_na_base_pair.model_number
_ndb_struct_na_base_pair.i_label_asym_id
_ndb_struct_na_base_pair.i_label_comp_id
_ndb_struct_na_base_pair.i_label_seq_id
_ndb_struct_na_base_pair.i_symmetry
_ndb_struct_na_base_pair.j_label_asym_id
_ndb_struct_na_base_pair.j_label_comp_id
_ndb_struct_na_base_pair.j_label_seq_id
_ndb_struct_na_base_pair.j_symmetry
_ndb_struct_na_base_pair.shear
_ndb_struct_na_base_pair.stretch
_ndb_struct_na_base_pair.stagger
_ndb_struct_na_base_pair.buckle
_ndb_struct_na_base_pair.propeller
_ndb_struct_na_base_pair.opening
_ndb_struct_na_base_pair.pair_number
_ndb_struct_na_base_pair.pair_name
_ndb_struct_na_base_pair.i_auth_asym_id
_ndb_struct_na_base_pair.i_auth_seq_id
_ndb_struct_na_base_pair.i_PDB_ins_code
_ndb_struct_na_base_pair.j_auth_asym_id
_ndb_struct_na_base_pair.j_auth_seq_id
_ndb_struct_na_base_pair.j_PDB_ins_code
_ndb_struct_na_base_pair.hbond_type_28
_ndb_struct_na_base_pair.hbond_type_12
1 A C 3 1_555 A G 25 1_555 -0.165 -0.045 0.270 1.817 -13.567 -3.662 1 A_C2649:G2671_A A 2649 ? A 2671 ? 19 1
1 A U 4 1_555 A A 24 1_555 -0.306 0.142 -0.007 6.808 -9.961 -2.943 2 A_U2650:A2670_A A 2650 ? A 2670 ? 20 1
1 A C 5 1_555 A G 23 1_555 0.278 -0.072 0.072 5.435 -16.736 2.346 3 A_C2651:G2669_A A 2651 ? A 2669 ? 19 1
1 A C 6 1_555 A G 22 1_555 0.202 -0.206 -0.076 -2.035 -9.951 -2.537 4 A_C2652:G2668_A A 2652 ? A 2668 ? 19 1
1 A U 7 1_555 A C 21 1_555 5.896 -2.193 -0.271 -3.975 -13.510 -15.233 5 A_U2653:C2667_A A 2653 ? A 2667 ? ? ?
1 A U 10 1_555 A A 19 1_555 4.101 -1.823 -0.808 7.469 -20.166 -102.864 6 A_U2656:A2665_A A 2656 ? A 2665 ? 24 4
1 A A 11 1_555 A G 18 1_555 -6.823 -4.294 -0.160 -1.473 4.645 -2.626 7 A_A2657:G2664_A A 2657 ? A 2664 ? 11 9
1 A C 12 1_555 A G 17 1_555 0.109 -0.104 -0.165 7.210 -2.383 0.309 8 A_C2658:G2663_A A 2658 ? A 2663 ? 19 1
1 A G 13 1_555 A A 16 1_555 7.221 -5.245 0.658 17.982 -6.123 -19.819 9 A_G2659:A2662_A A 2659 ? A 2662 ? ? 10
#
loop_
_ndb_struct_na_base_pair_step.model_number
_ndb_struct_na_base_pair_step.i_label_asym_id_1
_ndb_struct_na_base_pair_step.i_label_comp_id_1
_ndb_struct_na_base_pair_step.i_label_seq_id_1
_ndb_struct_na_base_pair_step.i_symmetry_1
_ndb_struct_na_base_pair_step.j_label_asym_id_1
_ndb_struct_na_base_pair_step.j_label_comp_id_1
_ndb_struct_na_base_pair_step.j_label_seq_id_1
_ndb_struct_na_base_pair_step.j_symmetry_1
_ndb_struct_na_base_pair_step.i_label_asym_id_2
_ndb_struct_na_base_pair_step.i_label_comp_id_2
_ndb_struct_na_base_pair_step.i_label_seq_id_2
_ndb_struct_na_base_pair_step.i_symmetry_2
_ndb_struct_na_base_pair_step.j_label_asym_id_2
_ndb_struct_na_base_pair_step.j_label_comp_id_2
_ndb_struct_na_base_pair_step.j_label_seq_id_2
_ndb_struct_na_base_pair_step.j_symmetry_2
_ndb_struct_na_base_pair_step.shift
_ndb_struct_na_base_pair_step.slide
_ndb_struct_na_base_pair_step.rise
_ndb_struct_na_base_pair_step.tilt
_ndb_struct_na_base_pair_step.roll
_ndb_struct_na_base_pair_step.twist
_ndb_struct_na_base_pair_step.x_displacement
_ndb_struct_na_base_pair_step.y_displacement
_ndb_struct_na_base_pair_step.helical_rise
_ndb_struct_na_base_pair_step.inclination
_ndb_struct_na_base_pair_step.tip
_ndb_struct_na_base_pair_step.helical_twist
_ndb_struct_na_base_pair_step.step_number
_ndb_struct_na_base_pair_step.step_name
_ndb_struct_na_base_pair_step.i_auth_asym_id_1
_ndb_struct_na_base_pair_step.i_auth_seq_id_1
_ndb_struct_na_base_pair_step.i_PDB_ins_code_1
_ndb_struct_na_base_pair_step.j_auth_asym_id_1
_ndb_struct_na_base_pair_step.j_auth_seq_id_1
_ndb_struct_na_base_pair_step.j_PDB_ins_code_1
_ndb_struct_na_base_pair_step.i_auth_asym_id_2
_ndb_struct_na_base_pair_step.i_auth_seq_id_2
_ndb_struct_na_base_pair_step.i_PDB_ins_code_2
_ndb_struct_na_base_pair_step.j_auth_asym_id_2
_ndb_struct_na_base_pair_step.j_auth_seq_id_2
_ndb_struct_na_base_pair_step.j_PDB_ins_code_2
1 A C 3 1_555 A G 25 1_555 A U 4 1_555 A A 24 1_555 0.155 -2.237 3.028 1.278 7.857 23.321 -7.216 -0.042 2.174 18.750 -3.049
24.624 1 AA_C2649U2650:A2670G2671_AA A 2649 ? A 2671 ? A 2650 ? A 2670 ?
1 A U 4 1_555 A A 24 1_555 A C 5 1_555 A G 23 1_555 0.649 -1.369 3.199 -1.361 2.500 35.917 -2.554 -1.234 3.074 4.046 2.203
36.026 2 AA_U2650C2651:G2669A2670_AA A 2650 ? A 2670 ? A 2651 ? A 2669 ?
1 A C 5 1_555 A G 23 1_555 A C 6 1_555 A G 22 1_555 -0.691 -1.970 3.291 1.155 7.736 33.049 -4.536 1.357 2.747 13.366 -1.995
33.936 3 AA_C2651C2652:G2668G2669_AA A 2651 ? A 2669 ? A 2652 ? A 2668 ?
1 A C 6 1_555 A G 22 1_555 A U 7 1_555 A C 21 1_555 -0.716 -1.103 3.465 7.109 9.916 54.231 -1.775 1.192 3.126 10.726 -7.690
55.485 4 AA_C2652U2653:C2667G2668_AA A 2652 ? A 2668 ? A 2653 ? A 2667 ?
1 A U 7 1_555 A C 21 1_555 A U 10 1_555 A A 19 1_555 0.656 -0.953 6.173 6.263 -4.395 31.611 -0.220 0.942 6.257 -7.924 -11.291
32.500 5 AA_U2653U2656:A2665C2667_AA A 2653 ? A 2667 ? A 2656 ? A 2665 ?
1 A U 10 1_555 A A 19 1_555 A A 11 1_555 A G 18 1_555 5.096 -1.295 3.591 -2.229 -1.172 -11.135 8.581 21.679 4.363 5.939 -11.301
-11.416 6 AA_U2656A2657:G2664A2665_AA A 2656 ? A 2665 ? A 2657 ? A 2664 ?
1 A A 11 1_555 A G 18 1_555 A C 12 1_555 A G 17 1_555 -0.004 -1.137 3.173 -3.064 3.789 59.313 -1.329 -0.144 3.098 3.821 3.090
59.495 7 AA_A2657C2658:G2663G2664_AA A 2657 ? A 2664 ? A 2658 ? A 2663 ?
1 A C 12 1_555 A G 17 1_555 A G 13 1_555 A A 16 1_555 -2.688 -1.330 2.980 -7.450 5.543 50.293 -1.907 2.627 3.168 6.459 8.680
51.088 8 AA_C2658G2659:A2662G2663_AA A 2658 ? A 2663 ? A 2659 ? A 2662 ?
#
loop_
_pdbx_audit_support.funding_organization
_pdbx_audit_support.country
_pdbx_audit_support.grant_number
_pdbx_audit_support.ordinal
'Austrian Science Fund' Austria P31691 1
'Austrian Science Fund' Austria F8011-B 2
'Austrian Science Fund' Austria P32773 3
'Austrian Science Fund' Austria P30087 4
'Austrian Research Promotion Agency' Austria 'West Austrian BioNMR 858017' 5
#
_pdbx_entity_instance_feature.ordinal 1
_pdbx_entity_instance_feature.comp_id HYJ
_pdbx_entity_instance_feature.asym_id ?
_pdbx_entity_instance_feature.seq_num ?
_pdbx_entity_instance_feature.auth_comp_id HYJ
_pdbx_entity_instance_feature.auth_asym_id ?
_pdbx_entity_instance_feature.auth_seq_num ?
_pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION'
_pdbx_entity_instance_feature.details ?
#
_pdbx_initial_refinement_model.id 1
_pdbx_initial_refinement_model.entity_id_list ?
_pdbx_initial_refinement_model.type 'experimental model'
_pdbx_initial_refinement_model.source_name PDB
_pdbx_initial_refinement_model.accession_code 3DVZ
_pdbx_initial_refinement_model.details ?
#
_space_group.name_H-M_alt 'P 43'
_space_group.name_Hall 'P 4cw'
_space_group.IT_number 78
_space_group.crystal_system tetragonal
_space_group.id 1
#
_atom_sites.entry_id 7QSH
_atom_sites.Cartn_transf_matrix[1][1] ?
_atom_sites.Cartn_transf_matrix[1][2] ?
_atom_sites.Cartn_transf_matrix[1][3] ?
_atom_sites.Cartn_transf_matrix[2][1] ?
_atom_sites.Cartn_transf_matrix[2][2] ?
_atom_sites.Cartn_transf_matrix[2][3] ?
_atom_sites.Cartn_transf_matrix[3][1] ?
_atom_sites.Cartn_transf_matrix[3][2] ?
_atom_sites.Cartn_transf_matrix[3][3] ?
_atom_sites.Cartn_transf_vector[1] ?
_atom_sites.Cartn_transf_vector[2] ?
_atom_sites.Cartn_transf_vector[3] ?
_atom_sites.fract_transf_matrix[1][1] 0.033898
_atom_sites.fract_transf_matrix[1][2] 0.000000
_atom_sites.fract_transf_matrix[1][3] 0.000000
_atom_sites.fract_transf_matrix[2][1] 0.000000
_atom_sites.fract_transf_matrix[2][2] 0.033898
_atom_sites.fract_transf_matrix[2][3] 0.000000
_atom_sites.fract_transf_matrix[3][1] 0.000000
_atom_sites.fract_transf_matrix[3][2] 0.000000
_atom_sites.fract_transf_matrix[3][3] 0.013070
_atom_sites.fract_transf_vector[1] 0.00000
_atom_sites.fract_transf_vector[2] 0.00000
_atom_sites.fract_transf_vector[3] 0.00000
_atom_sites.solution_primary ?
_atom_sites.solution_secondary ?
_atom_sites.solution_hydrogens ?
_atom_sites.special_details ?
#
loop_
_atom_type.symbol
_atom_type.scat_dispersion_real
_atom_type.scat_dispersion_imag
_atom_type.scat_Cromer_Mann_a1
_atom_type.scat_Cromer_Mann_a2
_atom_type.scat_Cromer_Mann_a3
_atom_type.scat_Cromer_Mann_a4
_atom_type.scat_Cromer_Mann_b1
_atom_type.scat_Cromer_Mann_b2
_atom_type.scat_Cromer_Mann_b3
_atom_type.scat_Cromer_Mann_b4
_atom_type.scat_Cromer_Mann_c
_atom_type.scat_source
_atom_type.scat_dispersion_source
C ? ? 2.51340 1.74867 1.72398 ? 31.80534 0.44561 10.58317 ? 0.0
;3-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31.
;
?
H ? ? 0.53795 0.34799 0.11320 ? 10.08003 29.74760 2.57510 ? 0.0
;3-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31.
;
?
N ? ? 2.99955 2.25584 1.72788 ? 23.27268 7.45433 0.31622 ? 0.0
;3-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31.
;
?
O ? ? 3.21184 3.04156 1.73156 ? 18.83700 5.90590 0.24126 ? 0.0
;3-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31.
;
?
P ? ? 5.27941 5.27355 4.40635 ? 36.77753 2.58877 0.47041 ? 0.0
;3-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31.
;
?
S ? ? 6.83013 6.13863 2.99358 ? 0.66409 30.18870 3.52397 ? 0.0
;3-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31.
;
?
#
loop_