data_7QSH # _entry.id 7QSH # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.385 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7QSH pdb_00007qsh 10.2210/pdb7qsh/pdb WWPDB D_1292120216 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-01-25 2 'Structure model' 1 1 2023-08-23 3 'Structure model' 1 2 2024-02-07 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' chem_comp_atom 2 2 'Structure model' chem_comp_bond 3 2 'Structure model' citation 4 2 'Structure model' citation_author 5 3 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_ASTM' 4 2 'Structure model' '_citation.journal_id_CSD' 5 2 'Structure model' '_citation.journal_id_ISSN' 6 2 'Structure model' '_citation.journal_volume' 7 2 'Structure model' '_citation.page_first' 8 2 'Structure model' '_citation.page_last' 9 2 'Structure model' '_citation.pdbx_database_id_DOI' 10 2 'Structure model' '_citation.pdbx_database_id_PubMed' 11 2 'Structure model' '_citation.title' 12 2 'Structure model' '_citation.year' 13 2 'Structure model' '_citation_author.identifier_ORCID' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7QSH _pdbx_database_status.recvd_initial_deposition_date 2022-01-13 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email e.ennifar@unistra.fr _pdbx_contact_author.name_first Eric _pdbx_contact_author.name_last Ennifar _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5076-846X # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Ennifar, E.' 1 ? 'Micura, R.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 50 _citation.language ? _citation.page_first 6038 _citation.page_last 6051 _citation.title 'Towards a comprehensive understanding of RNA deamination: synthesis and properties of xanthosine-modified RNA.' _citation.year 2022 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkac477 _citation.pdbx_database_id_PubMed 35687141 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Mair, S.' 1 ? primary 'Erharter, K.' 2 ? primary 'Renard, E.' 3 ? primary 'Brillet, K.' 4 ? primary 'Brunner, M.' 5 ? primary 'Lusser, A.' 6 0000-0002-2226-9081 primary 'Kreutz, C.' 7 0000-0002-7018-9326 primary 'Ennifar, E.' 8 ? primary 'Micura, R.' 9 0000-0003-2661-6105 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn '23S ribosomal RNA Sarcin Ricin Loop 27-nucleotide fragment' 8533.146 1 ? ? ? ? 2 non-polymer syn URIDINE 244.201 1 ? ? ? ? 3 non-polymer syn ;9-[(2~{R},3~{R},4~{S},5~{R})-3,4-bis(oxidanyl)-5-[[tris(oxidanyl)-$l^{5}-phosphanyl]oxymethyl]oxolan-2-yl]-2-oxidanyl-1~{H}-purin-6-one ; 364.205 1 ? ? ? ? 4 non-polymer syn GLYCEROL 92.094 1 ? ? ? ? 5 non-polymer syn 'SULFATE ION' 96.063 1 ? ? ? ? 6 water nat water 18.015 147 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code 'U(XAN)CUCCUAGUACGAGAGGACCGGAGUG' _entity_poly.pdbx_seq_one_letter_code_can UXCUCCUAGUACGAGAGGACCGGAGUG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 URIDINE URI 3 ;9-[(2~{R},3~{R},4~{S},5~{R})-3,4-bis(oxidanyl)-5-[[tris(oxidanyl)-$l^{5}-phosphanyl]oxymethyl]oxolan-2-yl]-2-oxidanyl-1~{H}-purin-6-one ; HYJ 4 GLYCEROL GOL 5 'SULFATE ION' SO4 6 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 U n 1 2 XAN n 1 3 C n 1 4 U n 1 5 C n 1 6 C n 1 7 U n 1 8 A n 1 9 G n 1 10 U n 1 11 A n 1 12 C n 1 13 G n 1 14 A n 1 15 G n 1 16 A n 1 17 G n 1 18 G n 1 19 A n 1 20 C n 1 21 C n 1 22 G n 1 23 G n 1 24 A n 1 25 G n 1 26 U n 1 27 G n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 27 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GOL non-polymer . GLYCEROL 'GLYCERIN; PROPANE-1,2,3-TRIOL' 'C3 H8 O3' 92.094 HOH non-polymer . WATER ? 'H2 O' 18.015 HYJ 'L-RNA linking' n ;9-[(2~{R},3~{R},4~{S},5~{R})-3,4-bis(oxidanyl)-5-[[tris(oxidanyl)-$l^{5}-phosphanyl]oxymethyl]oxolan-2-yl]-2-oxidanyl-1~{H}-purin-6-one ; ? 'C10 H13 N4 O9 P' 364.205 SO4 non-polymer . 'SULFATE ION' ? 'O4 S -2' 96.063 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 URI non-polymer . URIDINE ? 'C9 H12 N2 O6' 244.201 XAN non-polymer . XANTHINE ? 'C5 H4 N4 O2' 152.111 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 U 1 2647 ? ? ? A . n A 1 2 XAN 2 2648 ? ? ? A . n A 1 3 C 3 2649 2649 C C A . n A 1 4 U 4 2650 2650 U U A . n A 1 5 C 5 2651 2651 C C A . n A 1 6 C 6 2652 2652 C C A . n A 1 7 U 7 2653 2653 U U A . n A 1 8 A 8 2654 2654 A A A . n A 1 9 G 9 2655 2655 G G A . n A 1 10 U 10 2656 2656 U U A . n A 1 11 A 11 2657 2657 A A A . n A 1 12 C 12 2658 2658 C C A . n A 1 13 G 13 2659 2659 G G A . n A 1 14 A 14 2660 2660 A A A . n A 1 15 G 15 2661 2661 G G A . n A 1 16 A 16 2662 2662 A A A . n A 1 17 G 17 2663 2663 G G A . n A 1 18 G 18 2664 2664 G G A . n A 1 19 A 19 2665 2665 A A A . n A 1 20 C 20 2666 2666 C C A . n A 1 21 C 21 2667 2667 C C A . n A 1 22 G 22 2668 2668 G G A . n A 1 23 G 23 2669 2669 G G A . n A 1 24 A 24 2670 2670 A A A . n A 1 25 G 25 2671 2671 G G A . n A 1 26 U 26 2672 2672 U U A . n A 1 27 G 27 2673 2673 G G A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 URI 1 2701 2647 URI U A . C 3 HYJ 1 2702 2648 HYJ XAN A . D 4 GOL 1 2703 200 GOL GOL A . E 5 SO4 1 2704 201 SO4 SO4 A . F 6 HOH 1 2801 86 HOH HOH A . F 6 HOH 2 2802 104 HOH HOH A . F 6 HOH 3 2803 30 HOH HOH A . F 6 HOH 4 2804 18 HOH HOH A . F 6 HOH 5 2805 64 HOH HOH A . F 6 HOH 6 2806 61 HOH HOH A . F 6 HOH 7 2807 141 HOH HOH A . F 6 HOH 8 2808 103 HOH HOH A . F 6 HOH 9 2809 48 HOH HOH A . F 6 HOH 10 2810 27 HOH HOH A . F 6 HOH 11 2811 25 HOH HOH A . F 6 HOH 12 2812 37 HOH HOH A . F 6 HOH 13 2813 132 HOH HOH A . F 6 HOH 14 2814 59 HOH HOH A . F 6 HOH 15 2815 29 HOH HOH A . F 6 HOH 16 2816 116 HOH HOH A . F 6 HOH 17 2817 94 HOH HOH A . F 6 HOH 18 2818 62 HOH HOH A . F 6 HOH 19 2819 71 HOH HOH A . F 6 HOH 20 2820 6 HOH HOH A . F 6 HOH 21 2821 65 HOH HOH A . F 6 HOH 22 2822 84 HOH HOH A . F 6 HOH 23 2823 35 HOH HOH A . F 6 HOH 24 2824 108 HOH HOH A . F 6 HOH 25 2825 28 HOH HOH A . F 6 HOH 26 2826 10 HOH HOH A . F 6 HOH 27 2827 67 HOH HOH A . F 6 HOH 28 2828 77 HOH HOH A . F 6 HOH 29 2829 109 HOH HOH A . F 6 HOH 30 2830 33 HOH HOH A . F 6 HOH 31 2831 79 HOH HOH A . F 6 HOH 32 2832 105 HOH HOH A . F 6 HOH 33 2833 133 HOH HOH A . F 6 HOH 34 2834 92 HOH HOH A . F 6 HOH 35 2835 5 HOH HOH A . F 6 HOH 36 2836 97 HOH HOH A . F 6 HOH 37 2837 70 HOH HOH A . F 6 HOH 38 2838 113 HOH HOH A . F 6 HOH 39 2839 170 HOH HOH A . F 6 HOH 40 2840 83 HOH HOH A . F 6 HOH 41 2841 21 HOH HOH A . F 6 HOH 42 2842 119 HOH HOH A . F 6 HOH 43 2843 93 HOH HOH A . F 6 HOH 44 2844 14 HOH HOH A . F 6 HOH 45 2845 12 HOH HOH A . F 6 HOH 46 2846 112 HOH HOH A . F 6 HOH 47 2847 87 HOH HOH A . F 6 HOH 48 2848 32 HOH HOH A . F 6 HOH 49 2849 11 HOH HOH A . F 6 HOH 50 2850 38 HOH HOH A . F 6 HOH 51 2851 78 HOH HOH A . F 6 HOH 52 2852 1 HOH HOH A . F 6 HOH 53 2853 80 HOH HOH A . F 6 HOH 54 2854 120 HOH HOH A . F 6 HOH 55 2855 47 HOH HOH A . F 6 HOH 56 2856 34 HOH HOH A . F 6 HOH 57 2857 3 HOH HOH A . F 6 HOH 58 2858 50 HOH HOH A . F 6 HOH 59 2859 51 HOH HOH A . F 6 HOH 60 2860 41 HOH HOH A . F 6 HOH 61 2861 102 HOH HOH A . F 6 HOH 62 2862 107 HOH HOH A . F 6 HOH 63 2863 40 HOH HOH A . F 6 HOH 64 2864 19 HOH HOH A . F 6 HOH 65 2865 7 HOH HOH A . F 6 HOH 66 2866 66 HOH HOH A . F 6 HOH 67 2867 72 HOH HOH A . F 6 HOH 68 2868 13 HOH HOH A . F 6 HOH 69 2869 16 HOH HOH A . F 6 HOH 70 2870 55 HOH HOH A . F 6 HOH 71 2871 17 HOH HOH A . F 6 HOH 72 2872 54 HOH HOH A . F 6 HOH 73 2873 45 HOH HOH A . F 6 HOH 74 2874 26 HOH HOH A . F 6 HOH 75 2875 101 HOH HOH A . F 6 HOH 76 2876 91 HOH HOH A . F 6 HOH 77 2877 74 HOH HOH A . F 6 HOH 78 2878 122 HOH HOH A . F 6 HOH 79 2879 2 HOH HOH A . F 6 HOH 80 2880 81 HOH HOH A . F 6 HOH 81 2881 140 HOH HOH A . F 6 HOH 82 2882 99 HOH HOH A . F 6 HOH 83 2883 42 HOH HOH A . F 6 HOH 84 2884 53 HOH HOH A . F 6 HOH 85 2885 4 HOH HOH A . F 6 HOH 86 2886 31 HOH HOH A . F 6 HOH 87 2887 96 HOH HOH A . F 6 HOH 88 2888 39 HOH HOH A . F 6 HOH 89 2889 46 HOH HOH A . F 6 HOH 90 2890 137 HOH HOH A . F 6 HOH 91 2891 60 HOH HOH A . F 6 HOH 92 2892 20 HOH HOH A . F 6 HOH 93 2893 75 HOH HOH A . F 6 HOH 94 2894 49 HOH HOH A . F 6 HOH 95 2895 110 HOH HOH A . F 6 HOH 96 2896 63 HOH HOH A . F 6 HOH 97 2897 98 HOH HOH A . F 6 HOH 98 2898 88 HOH HOH A . F 6 HOH 99 2899 90 HOH HOH A . F 6 HOH 100 2900 69 HOH HOH A . F 6 HOH 101 2901 8 HOH HOH A . F 6 HOH 102 2902 24 HOH HOH A . F 6 HOH 103 2903 125 HOH HOH A . F 6 HOH 104 2904 169 HOH HOH A . F 6 HOH 105 2905 52 HOH HOH A . F 6 HOH 106 2906 100 HOH HOH A . F 6 HOH 107 2907 128 HOH HOH A . F 6 HOH 108 2908 22 HOH HOH A . F 6 HOH 109 2909 15 HOH HOH A . F 6 HOH 110 2910 117 HOH HOH A . F 6 HOH 111 2911 43 HOH HOH A . F 6 HOH 112 2912 76 HOH HOH A . F 6 HOH 113 2913 89 HOH HOH A . F 6 HOH 114 2914 149 HOH HOH A . F 6 HOH 115 2915 163 HOH HOH A . F 6 HOH 116 2916 23 HOH HOH A . F 6 HOH 117 2917 165 HOH HOH A . F 6 HOH 118 2918 95 HOH HOH A . F 6 HOH 119 2919 166 HOH HOH A . F 6 HOH 120 2920 136 HOH HOH A . F 6 HOH 121 2921 154 HOH HOH A . F 6 HOH 122 2922 115 HOH HOH A . F 6 HOH 123 2923 126 HOH HOH A . F 6 HOH 124 2924 56 HOH HOH A . F 6 HOH 125 2925 121 HOH HOH A . F 6 HOH 126 2926 57 HOH HOH A . F 6 HOH 127 2927 129 HOH HOH A . F 6 HOH 128 2928 134 HOH HOH A . F 6 HOH 129 2929 58 HOH HOH A . F 6 HOH 130 2930 114 HOH HOH A . F 6 HOH 131 2931 162 HOH HOH A . F 6 HOH 132 2932 82 HOH HOH A . F 6 HOH 133 2933 145 HOH HOH A . F 6 HOH 134 2934 118 HOH HOH A . F 6 HOH 135 2935 151 HOH HOH A . F 6 HOH 136 2936 160 HOH HOH A . F 6 HOH 137 2937 167 HOH HOH A . F 6 HOH 138 2938 152 HOH HOH A . F 6 HOH 139 2939 161 HOH HOH A . F 6 HOH 140 2940 138 HOH HOH A . F 6 HOH 141 2941 127 HOH HOH A . F 6 HOH 142 2942 153 HOH HOH A . F 6 HOH 143 2943 130 HOH HOH A . F 6 HOH 144 2944 150 HOH HOH A . F 6 HOH 145 2945 168 HOH HOH A . F 6 HOH 146 2946 147 HOH HOH A . F 6 HOH 147 2947 123 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.19_4092 1 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.19_4092 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 3 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? . 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? MOLREP ? ? ? . 5 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 7QSH _cell.details ? _cell.formula_units_Z ? _cell.length_a 29.500 _cell.length_a_esd ? _cell.length_b 29.500 _cell.length_b_esd ? _cell.length_c 76.510 _cell.length_c_esd ? _cell.volume 66582.829 _cell.volume_esd ? _cell.Z_PDB 4 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7QSH _symmetry.cell_setting ? _symmetry.Int_Tables_number 78 _symmetry.space_group_name_Hall 'P 4cw' _symmetry.space_group_name_H-M 'P 43' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7QSH _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 1.95 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 36.95 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'Ammonium sulfate, magnesium acetate, MES pH5.6' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 2M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2021-06-18 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.9 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SLS BEAMLINE X06DA' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.9 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline X06DA _diffrn_source.pdbx_synchrotron_site SLS # _reflns.B_iso_Wilson_estimate 7.88 _reflns.entry_id 7QSH _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 0.86 _reflns.d_resolution_low 50 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 54707 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 98.9 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 20 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 56 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 1.00 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 0.86 _reflns_shell.d_res_low 0.88 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 3549 _reflns_shell.percent_possible_all ? _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half .049 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 13.38 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7QSH _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 0.86 _refine.ls_d_res_low 29.50 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 54705 _refine.ls_number_reflns_R_free 2736 _refine.ls_number_reflns_R_work 51969 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 98.94 _refine.ls_percent_reflns_R_free 5.00 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.1476 _refine.ls_R_factor_R_free 0.1663 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1466 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.35 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 3DVZ _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 0.6000 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.4000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 18.2879 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.0940 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 0.86 _refine_hist.d_res_low 29.50 _refine_hist.number_atoms_solvent 147 _refine_hist.number_atoms_total 737 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 539 _refine_hist.pdbx_number_atoms_ligand 51 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0051 ? 918 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.4213 ? 1427 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0449 ? 186 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0198 ? 40 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 10.9542 ? 434 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 0.86 0.87 . . 116 2202 83.44 . . . 0.3330 . 0.3497 . . . . . . . . . . . 'X-RAY DIFFRACTION' 0.87 0.89 . . 134 2544 96.12 . . . 0.3070 . 0.2952 . . . . . . . . . . . 'X-RAY DIFFRACTION' 0.89 0.91 . . 135 2573 99.34 . . . 0.2599 . 0.2593 . . . . . . . . . . . 'X-RAY DIFFRACTION' 0.91 0.93 . . 139 2638 100.00 . . . 0.2319 . 0.2271 . . . . . . . . . . . 'X-RAY DIFFRACTION' 0.93 0.95 . . 138 2610 100.00 . . . 0.2181 . 0.2156 . . . . . . . . . . . 'X-RAY DIFFRACTION' 0.95 0.97 . . 136 2599 100.00 . . . 0.2563 . 0.2128 . . . . . . . . . . . 'X-RAY DIFFRACTION' 0.97 0.99 . . 140 2642 100.00 . . . 0.2239 . 0.2052 . . . . . . . . . . . 'X-RAY DIFFRACTION' 0.99 1.02 . . 138 2637 100.00 . . . 0.1831 . 0.1877 . . . . . . . . . . . 'X-RAY DIFFRACTION' 1.02 1.05 . . 138 2622 100.00 . . . 0.1866 . 0.1806 . . . . . . . . . . . 'X-RAY DIFFRACTION' 1.05 1.08 . . 137 2595 100.00 . . . 0.1823 . 0.1698 . . . . . . . . . . . 'X-RAY DIFFRACTION' 1.08 1.12 . . 139 2633 100.00 . . . 0.1582 . 0.1626 . . . . . . . . . . . 'X-RAY DIFFRACTION' 1.12 1.17 . . 136 2599 100.00 . . . 0.1456 . 0.1571 . . . . . . . . . . . 'X-RAY DIFFRACTION' 1.17 1.22 . . 140 2647 100.00 . . . 0.1679 . 0.1515 . . . . . . . . . . . 'X-RAY DIFFRACTION' 1.22 1.28 . . 138 2621 100.00 . . . 0.1466 . 0.1480 . . . . . . . . . . . 'X-RAY DIFFRACTION' 1.28 1.37 . . 137 2618 100.00 . . . 0.1645 . 0.1510 . . . . . . . . . . . 'X-RAY DIFFRACTION' 1.37 1.47 . . 139 2642 100.00 . . . 0.1673 . 0.1522 . . . . . . . . . . . 'X-RAY DIFFRACTION' 1.47 1.62 . . 138 2609 100.00 . . . 0.1464 . 0.1368 . . . . . . . . . . . 'X-RAY DIFFRACTION' 1.62 1.85 . . 139 2644 100.00 . . . 0.1317 . 0.1220 . . . . . . . . . . . 'X-RAY DIFFRACTION' 1.85 2.33 . . 138 2633 100.00 . . . 0.1719 . 0.1346 . . . . . . . . . . . 'X-RAY DIFFRACTION' 2.33 29.50 . . 141 2661 99.93 . . . 0.1598 . 0.1219 . . . . . . . . . . . # _struct.entry_id 7QSH _struct.title '23S ribosomal RNA Sarcin Ricin Loop 27-nt fragment containing a Xanthosine residue at position 2648' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7QSH _struct_keywords.text 'RNA, modified base' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 5 ? F N N 6 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7QSH _struct_ref.pdbx_db_accession 7QSH _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7QSH _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 27 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7QSH _struct_ref_seq.db_align_beg 2647 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 2673 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 2647 _struct_ref_seq.pdbx_auth_seq_align_end 2673 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale one ? A C 3 P A ? ? 1_555 C HYJ . "O3'" A ? A C 2649 A HYJ 2702 1_555 ? ? ? ? ? ? ? 1.599 ? ? covale2 covale one ? A C 3 P B ? ? 1_555 C HYJ . "O3'" B ? A C 2649 A HYJ 2702 1_555 ? ? ? ? ? ? ? 1.605 ? ? covale3 covale one ? B URI . "O3'" A ? ? 1_555 C HYJ . P A ? A URI 2701 A HYJ 2702 1_555 ? ? ? ? ? ? ? 1.607 ? ? covale4 covale one ? B URI . "O3'" B ? ? 1_555 C HYJ . P B ? A URI 2701 A HYJ 2702 1_555 ? ? ? ? ? ? ? 1.612 ? ? hydrog1 hydrog ? ? A C 3 N3 A ? ? 1_555 A G 25 N1 A ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A C 3 N3 B ? ? 1_555 A G 25 N1 B ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A C 3 N4 A ? ? 1_555 A G 25 O6 A ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 3 N4 B ? ? 1_555 A G 25 O6 B ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 3 O2 A ? ? 1_555 A G 25 N2 A ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 3 O2 B ? ? 1_555 A G 25 N2 B ? A C 2649 A G 2671 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 4 N3 A ? ? 1_555 A A 24 N1 A ? A U 2650 A A 2670 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 4 N3 B ? ? 1_555 A A 24 N1 B ? A U 2650 A A 2670 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 4 O4 A ? ? 1_555 A A 24 N6 A ? A U 2650 A A 2670 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 4 O4 B ? ? 1_555 A A 24 N6 B ? A U 2650 A A 2670 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 5 N3 A ? ? 1_555 A G 23 N1 A ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N3 B ? ? 1_555 A G 23 N1 B ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 N4 A ? ? 1_555 A G 23 O6 A ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 5 N4 B ? ? 1_555 A G 23 O6 B ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 5 O2 A ? ? 1_555 A G 23 N2 A ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 5 O2 B ? ? 1_555 A G 23 N2 B ? A C 2651 A G 2669 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 22 N1 A ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 22 N1 B ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 22 O6 A ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 22 O6 B ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 22 N2 A ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 22 N2 B ? A C 2652 A G 2668 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A U 7 O2 ? ? ? 1_555 A C 21 N4 ? ? A U 2653 A C 2667 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog24 hydrog ? ? A U 10 N3 ? ? ? 1_555 A A 19 N7 ? ? A U 2656 A A 2665 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog25 hydrog ? ? A U 10 O2 ? ? ? 1_555 A A 19 N6 ? ? A U 2656 A A 2665 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog26 hydrog ? ? A A 11 N6 ? ? ? 1_555 A G 18 N3 ? ? A A 2657 A G 2664 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog27 hydrog ? ? A A 11 N7 ? ? ? 1_555 A G 18 N2 ? ? A A 2657 A G 2664 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog28 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 17 N1 ? ? A C 2658 A G 2663 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 17 O6 ? ? A C 2658 A G 2663 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 17 N2 ? ? A C 2658 A G 2663 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 13 N2 ? ? ? 1_555 A A 16 N7 ? ? A G 2659 A A 2662 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 "O5'" _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 G _pdbx_validate_rmsd_angle.auth_seq_id_1 2655 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 P _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 G _pdbx_validate_rmsd_angle.auth_seq_id_2 2655 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 OP2 _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 G _pdbx_validate_rmsd_angle.auth_seq_id_3 2655 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 99.45 _pdbx_validate_rmsd_angle.angle_target_value 105.70 _pdbx_validate_rmsd_angle.angle_deviation -6.25 _pdbx_validate_rmsd_angle.angle_standard_deviation 0.90 _pdbx_validate_rmsd_angle.linker_flag N # _pdbx_validate_polymer_linkage.id 1 _pdbx_validate_polymer_linkage.PDB_model_num 1 _pdbx_validate_polymer_linkage.auth_atom_id_1 "O3'" _pdbx_validate_polymer_linkage.auth_asym_id_1 A _pdbx_validate_polymer_linkage.auth_comp_id_1 U _pdbx_validate_polymer_linkage.auth_seq_id_1 2672 _pdbx_validate_polymer_linkage.PDB_ins_code_1 ? _pdbx_validate_polymer_linkage.label_alt_id_1 B _pdbx_validate_polymer_linkage.auth_atom_id_2 P _pdbx_validate_polymer_linkage.auth_asym_id_2 A _pdbx_validate_polymer_linkage.auth_comp_id_2 G _pdbx_validate_polymer_linkage.auth_seq_id_2 2673 _pdbx_validate_polymer_linkage.PDB_ins_code_2 ? _pdbx_validate_polymer_linkage.label_alt_id_2 B _pdbx_validate_polymer_linkage.dist 2.78 # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 -y,x,z+3/4 3 y,-x,z+1/4 4 -x,-y,z+1/2 # _pdbx_entry_details.entry_id 7QSH _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _pdbx_unobs_or_zero_occ_residues.id _pdbx_unobs_or_zero_occ_residues.PDB_model_num _pdbx_unobs_or_zero_occ_residues.polymer_flag _pdbx_unobs_or_zero_occ_residues.occupancy_flag _pdbx_unobs_or_zero_occ_residues.auth_asym_id _pdbx_unobs_or_zero_occ_residues.auth_comp_id _pdbx_unobs_or_zero_occ_residues.auth_seq_id _pdbx_unobs_or_zero_occ_residues.PDB_ins_code _pdbx_unobs_or_zero_occ_residues.label_asym_id _pdbx_unobs_or_zero_occ_residues.label_comp_id _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 1 Y 1 A U 2647 ? A U 1 2 1 Y 1 A XAN 2648 ? A XAN 2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GOL C1 C N N 111 GOL O1 O N N 112 GOL C2 C N N 113 GOL O2 O N N 114 GOL C3 C N N 115 GOL O3 O N N 116 GOL H11 H N N 117 GOL H12 H N N 118 GOL HO1 H N N 119 GOL H2 H N N 120 GOL HO2 H N N 121 GOL H31 H N N 122 GOL H32 H N N 123 GOL HO3 H N N 124 HOH O O N N 125 HOH H1 H N N 126 HOH H2 H N N 127 HYJ N9 N Y N 128 HYJ C4 C Y N 129 HYJ N3 N N N 130 HYJ C2 C N N 131 HYJ O2 O N N 132 HYJ N1 N N N 133 HYJ C6 C N N 134 HYJ O6 O N N 135 HYJ C5 C Y N 136 HYJ N7 N Y N 137 HYJ C8 C Y N 138 HYJ "C1'" C N R 139 HYJ "C2'" C N R 140 HYJ "C3'" C N S 141 HYJ "C4'" C N R 142 HYJ "C5'" C N N 143 HYJ "O2'" O N N 144 HYJ "O3'" O N N 145 HYJ "O4'" O N N 146 HYJ "O5'" O N N 147 HYJ OP1 O N N 148 HYJ OP2 O N N 149 HYJ P P N N 150 HYJ HO2 H N N 151 HYJ H1 H N N 152 HYJ H8 H N N 153 HYJ "H1'" H N N 154 HYJ "H2'" H N N 155 HYJ "H3'" H N N 156 HYJ "H4'" H N N 157 HYJ "H5'2" H N N 158 HYJ "H5'1" H N N 159 HYJ "HO2'" H N N 160 HYJ H2 H N N 161 HYJ H3 H N N 162 HYJ OP3 O N N 163 HYJ H6 H N N 164 SO4 S S N N 165 SO4 O1 O N N 166 SO4 O2 O N N 167 SO4 O3 O N N 168 SO4 O4 O N N 169 U OP3 O N N 170 U P P N N 171 U OP1 O N N 172 U OP2 O N N 173 U "O5'" O N N 174 U "C5'" C N N 175 U "C4'" C N R 176 U "O4'" O N N 177 U "C3'" C N S 178 U "O3'" O N N 179 U "C2'" C N R 180 U "O2'" O N N 181 U "C1'" C N R 182 U N1 N N N 183 U C2 C N N 184 U O2 O N N 185 U N3 N N N 186 U C4 C N N 187 U O4 O N N 188 U C5 C N N 189 U C6 C N N 190 U HOP3 H N N 191 U HOP2 H N N 192 U "H5'" H N N 193 U "H5''" H N N 194 U "H4'" H N N 195 U "H3'" H N N 196 U "HO3'" H N N 197 U "H2'" H N N 198 U "HO2'" H N N 199 U "H1'" H N N 200 U H3 H N N 201 U H5 H N N 202 U H6 H N N 203 URI N1 N N N 204 URI C2 C N N 205 URI N3 N N N 206 URI C4 C N N 207 URI C5 C N N 208 URI C6 C N N 209 URI O2 O N N 210 URI O4 O N N 211 URI "C1'" C N R 212 URI "C2'" C N R 213 URI "C3'" C N S 214 URI "C4'" C N R 215 URI "O2'" O N N 216 URI "O3'" O N N 217 URI "O4'" O N N 218 URI "C5'" C N N 219 URI "O5'" O N N 220 URI H3 H N N 221 URI H5 H N N 222 URI H6 H N N 223 URI "H1'" H N N 224 URI "H2'" H N N 225 URI "H3'" H N N 226 URI "H4'" H N N 227 URI "HO2'" H N N 228 URI "HO3'" H N N 229 URI "H5'1" H N N 230 URI "H5'2" H N N 231 URI "HO5'" H N N 232 XAN N9 N Y N 233 XAN C4 C Y N 234 XAN N3 N Y N 235 XAN C2 C Y N 236 XAN O2 O N N 237 XAN N1 N Y N 238 XAN C6 C Y N 239 XAN O6 O N N 240 XAN C5 C Y N 241 XAN N7 N Y N 242 XAN C8 C Y N 243 XAN HN9 H N N 244 XAN HN3 H N N 245 XAN HN1 H N N 246 XAN H8 H N N 247 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GOL C1 O1 sing N N 116 GOL C1 C2 sing N N 117 GOL C1 H11 sing N N 118 GOL C1 H12 sing N N 119 GOL O1 HO1 sing N N 120 GOL C2 O2 sing N N 121 GOL C2 C3 sing N N 122 GOL C2 H2 sing N N 123 GOL O2 HO2 sing N N 124 GOL C3 O3 sing N N 125 GOL C3 H31 sing N N 126 GOL C3 H32 sing N N 127 GOL O3 HO3 sing N N 128 HOH O H1 sing N N 129 HOH O H2 sing N N 130 HYJ O2 C2 sing N N 131 HYJ C2 N1 sing N N 132 HYJ C2 N3 doub N N 133 HYJ N1 C6 sing N N 134 HYJ N3 C4 sing N N 135 HYJ C6 O6 doub N N 136 HYJ C6 C5 sing N N 137 HYJ C4 C5 doub Y N 138 HYJ C4 N9 sing Y N 139 HYJ C5 N7 sing Y N 140 HYJ "C1'" N9 sing N N 141 HYJ "C1'" "O4'" sing N N 142 HYJ "C1'" "C2'" sing N N 143 HYJ N9 C8 sing Y N 144 HYJ "O4'" "C4'" sing N N 145 HYJ N7 C8 doub Y N 146 HYJ "O2'" "C2'" sing N N 147 HYJ "C2'" "C3'" sing N N 148 HYJ "C4'" "C5'" sing N N 149 HYJ "C4'" "C3'" sing N N 150 HYJ "C5'" "O5'" sing N N 151 HYJ "O5'" P sing N N 152 HYJ "C3'" "O3'" sing N N 153 HYJ P OP2 doub N N 154 HYJ P OP1 sing N N 155 HYJ O2 HO2 sing N N 156 HYJ N1 H1 sing N N 157 HYJ C8 H8 sing N N 158 HYJ "C1'" "H1'" sing N N 159 HYJ "C2'" "H2'" sing N N 160 HYJ "C3'" "H3'" sing N N 161 HYJ "C4'" "H4'" sing N N 162 HYJ "C5'" "H5'2" sing N N 163 HYJ "C5'" "H5'1" sing N N 164 HYJ "O2'" "HO2'" sing N N 165 HYJ "O3'" H2 sing N N 166 HYJ OP1 H3 sing N N 167 HYJ P OP3 sing N N 168 HYJ OP3 H6 sing N N 169 SO4 S O1 doub N N 170 SO4 S O2 doub N N 171 SO4 S O3 sing N N 172 SO4 S O4 sing N N 173 U OP3 P sing N N 174 U OP3 HOP3 sing N N 175 U P OP1 doub N N 176 U P OP2 sing N N 177 U P "O5'" sing N N 178 U OP2 HOP2 sing N N 179 U "O5'" "C5'" sing N N 180 U "C5'" "C4'" sing N N 181 U "C5'" "H5'" sing N N 182 U "C5'" "H5''" sing N N 183 U "C4'" "O4'" sing N N 184 U "C4'" "C3'" sing N N 185 U "C4'" "H4'" sing N N 186 U "O4'" "C1'" sing N N 187 U "C3'" "O3'" sing N N 188 U "C3'" "C2'" sing N N 189 U "C3'" "H3'" sing N N 190 U "O3'" "HO3'" sing N N 191 U "C2'" "O2'" sing N N 192 U "C2'" "C1'" sing N N 193 U "C2'" "H2'" sing N N 194 U "O2'" "HO2'" sing N N 195 U "C1'" N1 sing N N 196 U "C1'" "H1'" sing N N 197 U N1 C2 sing N N 198 U N1 C6 sing N N 199 U C2 O2 doub N N 200 U C2 N3 sing N N 201 U N3 C4 sing N N 202 U N3 H3 sing N N 203 U C4 O4 doub N N 204 U C4 C5 sing N N 205 U C5 C6 doub N N 206 U C5 H5 sing N N 207 U C6 H6 sing N N 208 URI N1 C2 sing N N 209 URI N1 C6 sing N N 210 URI N1 "C1'" sing N N 211 URI C2 N3 sing N N 212 URI C2 O2 doub N N 213 URI N3 C4 sing N N 214 URI N3 H3 sing N N 215 URI C4 C5 sing N N 216 URI C4 O4 doub N N 217 URI C5 C6 doub N N 218 URI C5 H5 sing N N 219 URI C6 H6 sing N N 220 URI "C1'" "C2'" sing N N 221 URI "C1'" "O4'" sing N N 222 URI "C1'" "H1'" sing N N 223 URI "C2'" "C3'" sing N N 224 URI "C2'" "O2'" sing N N 225 URI "C2'" "H2'" sing N N 226 URI "C3'" "C4'" sing N N 227 URI "C3'" "O3'" sing N N 228 URI "C3'" "H3'" sing N N 229 URI "C4'" "O4'" sing N N 230 URI "C4'" "C5'" sing N N 231 URI "C4'" "H4'" sing N N 232 URI "O2'" "HO2'" sing N N 233 URI "O3'" "HO3'" sing N N 234 URI "C5'" "O5'" sing N N 235 URI "C5'" "H5'1" sing N N 236 URI "C5'" "H5'2" sing N N 237 URI "O5'" "HO5'" sing N N 238 XAN N9 C4 sing Y N 239 XAN N9 C8 sing Y N 240 XAN N9 HN9 sing N N 241 XAN C4 N3 sing Y N 242 XAN C4 C5 doub Y N 243 XAN N3 C2 sing Y N 244 XAN N3 HN3 sing N N 245 XAN C2 O2 doub N N 246 XAN C2 N1 sing Y N 247 XAN N1 C6 sing Y N 248 XAN N1 HN1 sing N N 249 XAN C6 O6 doub N N 250 XAN C6 C5 sing Y N 251 XAN C5 N7 sing Y N 252 XAN N7 C8 doub Y N 253 XAN C8 H8 sing N N 254 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7QSH 'double helix' 7QSH 'a-form double helix' 7QSH tetraloop 7QSH 'mismatched base pair' 7QSH 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A C 3 1_555 A G 25 1_555 -0.165 -0.045 0.270 1.817 -13.567 -3.662 1 A_C2649:G2671_A A 2649 ? A 2671 ? 19 1 1 A U 4 1_555 A A 24 1_555 -0.306 0.142 -0.007 6.808 -9.961 -2.943 2 A_U2650:A2670_A A 2650 ? A 2670 ? 20 1 1 A C 5 1_555 A G 23 1_555 0.278 -0.072 0.072 5.435 -16.736 2.346 3 A_C2651:G2669_A A 2651 ? A 2669 ? 19 1 1 A C 6 1_555 A G 22 1_555 0.202 -0.206 -0.076 -2.035 -9.951 -2.537 4 A_C2652:G2668_A A 2652 ? A 2668 ? 19 1 1 A U 7 1_555 A C 21 1_555 5.896 -2.193 -0.271 -3.975 -13.510 -15.233 5 A_U2653:C2667_A A 2653 ? A 2667 ? ? ? 1 A U 10 1_555 A A 19 1_555 4.101 -1.823 -0.808 7.469 -20.166 -102.864 6 A_U2656:A2665_A A 2656 ? A 2665 ? 24 4 1 A A 11 1_555 A G 18 1_555 -6.823 -4.294 -0.160 -1.473 4.645 -2.626 7 A_A2657:G2664_A A 2657 ? A 2664 ? 11 9 1 A C 12 1_555 A G 17 1_555 0.109 -0.104 -0.165 7.210 -2.383 0.309 8 A_C2658:G2663_A A 2658 ? A 2663 ? 19 1 1 A G 13 1_555 A A 16 1_555 7.221 -5.245 0.658 17.982 -6.123 -19.819 9 A_G2659:A2662_A A 2659 ? A 2662 ? ? 10 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A C 3 1_555 A G 25 1_555 A U 4 1_555 A A 24 1_555 0.155 -2.237 3.028 1.278 7.857 23.321 -7.216 -0.042 2.174 18.750 -3.049 24.624 1 AA_C2649U2650:A2670G2671_AA A 2649 ? A 2671 ? A 2650 ? A 2670 ? 1 A U 4 1_555 A A 24 1_555 A C 5 1_555 A G 23 1_555 0.649 -1.369 3.199 -1.361 2.500 35.917 -2.554 -1.234 3.074 4.046 2.203 36.026 2 AA_U2650C2651:G2669A2670_AA A 2650 ? A 2670 ? A 2651 ? A 2669 ? 1 A C 5 1_555 A G 23 1_555 A C 6 1_555 A G 22 1_555 -0.691 -1.970 3.291 1.155 7.736 33.049 -4.536 1.357 2.747 13.366 -1.995 33.936 3 AA_C2651C2652:G2668G2669_AA A 2651 ? A 2669 ? A 2652 ? A 2668 ? 1 A C 6 1_555 A G 22 1_555 A U 7 1_555 A C 21 1_555 -0.716 -1.103 3.465 7.109 9.916 54.231 -1.775 1.192 3.126 10.726 -7.690 55.485 4 AA_C2652U2653:C2667G2668_AA A 2652 ? A 2668 ? A 2653 ? A 2667 ? 1 A U 7 1_555 A C 21 1_555 A U 10 1_555 A A 19 1_555 0.656 -0.953 6.173 6.263 -4.395 31.611 -0.220 0.942 6.257 -7.924 -11.291 32.500 5 AA_U2653U2656:A2665C2667_AA A 2653 ? A 2667 ? A 2656 ? A 2665 ? 1 A U 10 1_555 A A 19 1_555 A A 11 1_555 A G 18 1_555 5.096 -1.295 3.591 -2.229 -1.172 -11.135 8.581 21.679 4.363 5.939 -11.301 -11.416 6 AA_U2656A2657:G2664A2665_AA A 2656 ? A 2665 ? A 2657 ? A 2664 ? 1 A A 11 1_555 A G 18 1_555 A C 12 1_555 A G 17 1_555 -0.004 -1.137 3.173 -3.064 3.789 59.313 -1.329 -0.144 3.098 3.821 3.090 59.495 7 AA_A2657C2658:G2663G2664_AA A 2657 ? A 2664 ? A 2658 ? A 2663 ? 1 A C 12 1_555 A G 17 1_555 A G 13 1_555 A A 16 1_555 -2.688 -1.330 2.980 -7.450 5.543 50.293 -1.907 2.627 3.168 6.459 8.680 51.088 8 AA_C2658G2659:A2662G2663_AA A 2658 ? A 2663 ? A 2659 ? A 2662 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'Austrian Science Fund' Austria P31691 1 'Austrian Science Fund' Austria F8011-B 2 'Austrian Science Fund' Austria P32773 3 'Austrian Science Fund' Austria P30087 4 'Austrian Research Promotion Agency' Austria 'West Austrian BioNMR 858017' 5 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id HYJ _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id HYJ _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 3DVZ _pdbx_initial_refinement_model.details ? # _space_group.name_H-M_alt 'P 43' _space_group.name_Hall 'P 4cw' _space_group.IT_number 78 _space_group.crystal_system tetragonal _space_group.id 1 # _atom_sites.entry_id 7QSH _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.033898 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.033898 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.013070 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source C ? ? 2.51340 1.74867 1.72398 ? 31.80534 0.44561 10.58317 ? 0.0 ;3-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? H ? ? 0.53795 0.34799 0.11320 ? 10.08003 29.74760 2.57510 ? 0.0 ;3-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 2.99955 2.25584 1.72788 ? 23.27268 7.45433 0.31622 ? 0.0 ;3-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 3.21184 3.04156 1.73156 ? 18.83700 5.90590 0.24126 ? 0.0 ;3-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 5.27941 5.27355 4.40635 ? 36.77753 2.58877 0.47041 ? 0.0 ;3-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? S ? ? 6.83013 6.13863 2.99358 ? 0.66409 30.18870 3.52397 ? 0.0 ;3-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_