data_7TG9 # _entry.id 7TG9 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.406 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7TG9 pdb_00007tg9 10.2210/pdb7tg9/pdb WWPDB D_1000262222 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date _pdbx_audit_revision_history.part_number 1 'Structure model' 1 0 2023-01-25 ? 2 'Structure model' 1 1 2024-05-22 ? 3 'Structure model' 1 2 2025-10-29 ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 3 'Structure model' 'Database references' 3 3 'Structure model' 'Structure summary' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' chem_comp_atom 2 2 'Structure model' chem_comp_bond 3 3 'Structure model' citation 4 3 'Structure model' citation_author 5 3 'Structure model' pdbx_entry_details # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 3 'Structure model' '_citation.country' 2 3 'Structure model' '_citation.journal_abbrev' 3 3 'Structure model' '_citation.journal_id_CSD' 4 3 'Structure model' '_citation.journal_id_ISSN' 5 3 'Structure model' '_citation.journal_volume' 6 3 'Structure model' '_citation.page_first' 7 3 'Structure model' '_citation.page_last' 8 3 'Structure model' '_citation.pdbx_database_id_DOI' 9 3 'Structure model' '_citation.pdbx_database_id_PubMed' 10 3 'Structure model' '_citation.title' 11 3 'Structure model' '_citation.year' 12 3 'Structure model' '_pdbx_entry_details.has_protein_modification' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7TG9 _pdbx_database_status.recvd_initial_deposition_date 2022-01-07 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _pdbx_database_related.db_name _pdbx_database_related.details _pdbx_database_related.db_id _pdbx_database_related.content_type PDB 'Grown at pH 11 without soaking' 7SM5 unspecified PDB 'Same conditions, different soaking time' 7TG4 unspecified # _pdbx_contact_author.id 3 _pdbx_contact_author.email ncs01@nyu.edu _pdbx_contact_author.name_first Nadrian _pdbx_contact_author.name_last Seeman _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-9680-4649 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Lu, B.' 1 0000-0001-6424-2197 'Vecchioni, S.' 2 0000-0001-8243-650X 'Seeman, N.C.' 3 0000-0002-9680-4649 'Sha, R.' 4 0000-0002-0807-734X 'Ohayon, Y.P.' 5 0000-0001-7500-4282 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country DE _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Small _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 1613-6829 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 21 _citation.language ? _citation.page_first e2411518 _citation.page_last e2411518 _citation.title 'Transmetalation for DNA-Based Molecular Electronics.' _citation.year 2025 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1002/smll.202411518 _citation.pdbx_database_id_PubMed 40364470 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'De, A.' 1 ? primary 'Lu, B.' 2 0000-0001-6424-2197 primary 'Ohayon, Y.P.' 3 0000-0001-7500-4282 primary 'Woloszyn, K.' 4 0000-0003-1200-583X primary 'Livernois, W.' 5 0000-0001-8637-1213 primary 'Perren, L.' 6 0000-0001-9169-1780 primary 'Yang, C.F.' 7 0009-0009-7382-9921 primary 'Mao, C.' 8 0000-0001-7516-8666 primary 'Botana, A.S.' 9 0000-0001-5973-3039 primary 'Hihath, J.' 10 0000-0002-2949-9293 primary 'Canary, J.W.' 11 0000-0002-0352-8543 primary 'Sha, R.' 12 0000-0002-0807-734X primary 'Anantram, M.P.' 13 ? primary 'Vecchioni, S.' 14 0000-0001-8243-650X # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*GP*AP*GP*CP*AP*GP*CP*CP*TP*GP*TP*TP*TP*GP*GP*AP*CP*AP*TP*CP*A)-3') ; 6463.185 1 ? ? ? ? 2 polymer syn ;DNA (5'-D(P*CP*CP*AP*TP*AP*CP*A)-3') ; 2066.401 1 ? ? ? ? 3 polymer syn ;DNA (5'-D(P*GP*GP*CP*TP*GP*CP*T)-3') ; 2129.409 1 ? ? ? ? 4 polymer syn ;DNA (5'-D(P*CP*TP*GP*AP*TP*GP*T)-3') ; 2128.421 1 ? ? ? ? 5 non-polymer syn 'MERCURY (II) ION' 200.590 2 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no no ;(DG)(DA)(DG)(DC)(DA)(DG)(DC)(DC)(DT)(DG)(DT)(DT)(DT)(DG)(DG)(DA)(DC)(DA)(DT)(DC) (DA) ; GAGCAGCCTGTTTGGACATCA A ? 2 polydeoxyribonucleotide no no '(DC)(DC)(DA)(DT)(DA)(DC)(DA)' CCATACA B ? 3 polydeoxyribonucleotide no no '(DG)(DG)(DC)(DT)(DG)(DC)(DT)' GGCTGCT C ? 4 polydeoxyribonucleotide no no '(DC)(DT)(DG)(DA)(DT)(DG)(DT)' CTGATGT D ? # _pdbx_entity_nonpoly.entity_id 5 _pdbx_entity_nonpoly.name 'MERCURY (II) ION' _pdbx_entity_nonpoly.comp_id HG # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DA n 1 3 DG n 1 4 DC n 1 5 DA n 1 6 DG n 1 7 DC n 1 8 DC n 1 9 DT n 1 10 DG n 1 11 DT n 1 12 DT n 1 13 DT n 1 14 DG n 1 15 DG n 1 16 DA n 1 17 DC n 1 18 DA n 1 19 DT n 1 20 DC n 1 21 DA n 2 1 DC n 2 2 DC n 2 3 DA n 2 4 DT n 2 5 DA n 2 6 DC n 2 7 DA n 3 1 DG n 3 2 DG n 3 3 DC n 3 4 DT n 3 5 DG n 3 6 DC n 3 7 DT n 4 1 DC n 4 2 DT n 4 3 DG n 4 4 DA n 4 5 DT n 4 6 DG n 4 7 DT n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 21 'synthetic construct' ? 32630 ? 2 1 sample 1 7 'synthetic construct' ? 32630 ? 3 1 sample 1 7 'synthetic construct' ? 32630 ? 4 1 sample 1 7 'synthetic construct' ? 32630 ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 HG non-polymer . 'MERCURY (II) ION' ? 'Hg 2' 200.590 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DA 2 2 2 DA DA A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DC 4 4 4 DC DC A . n A 1 5 DA 5 5 5 DA DA A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DC 7 7 7 DC DC A . n A 1 8 DC 8 8 8 DC DC A . n A 1 9 DT 9 9 9 DT DT A . n A 1 10 DG 10 10 10 DG DG A . n A 1 11 DT 11 11 11 DT DT A . n A 1 12 DT 12 12 12 DT DT A . n A 1 13 DT 13 13 13 DT DT A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DA 16 16 16 DA DA A . n A 1 17 DC 17 17 17 DC DC A . n A 1 18 DA 18 18 18 DA DA A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DC 20 20 20 DC DC A . n A 1 21 DA 21 21 21 DA DA A . n B 2 1 DC 1 1 1 DC DC B . n B 2 2 DC 2 2 2 DC DC B . n B 2 3 DA 3 3 3 DA DA B . n B 2 4 DT 4 4 4 DT DT B . n B 2 5 DA 5 5 5 DA DA B . n B 2 6 DC 6 6 6 DC DC B . n B 2 7 DA 7 7 7 DA DA B . n C 3 1 DG 1 8 8 DG DG C . n C 3 2 DG 2 9 9 DG DG C . n C 3 3 DC 3 10 10 DC DC C . n C 3 4 DT 4 11 11 DT DT C . n C 3 5 DG 5 12 12 DG DG C . n C 3 6 DC 6 13 13 DC DC C . n C 3 7 DT 7 14 14 DT DT C . n D 4 1 DC 1 1 1 DC DC D . n D 4 2 DT 2 2 2 DT DT D . n D 4 3 DG 3 3 3 DG DG D . n D 4 4 DA 4 4 4 DA DA D . n D 4 5 DT 5 5 5 DT DT D . n D 4 6 DG 6 6 6 DG DG D . n D 4 7 DT 7 7 7 DT DT D . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id HG _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id HG _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code E 5 HG 1 101 1 HG HG B . F 5 HG 1 102 2 HG HG B . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.19.2_4158 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? autoPROC ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? STARANISO ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? AutoSol ? ? ? . 4 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 7TG9 _cell.details ? _cell.formula_units_Z ? _cell.length_a 105.830 _cell.length_a_esd ? _cell.length_b 105.830 _cell.length_b_esd ? _cell.length_c 89.406 _cell.length_c_esd ? _cell.volume 867191.254 _cell.volume_esd ? _cell.Z_PDB 9 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7TG9 _symmetry.cell_setting ? _symmetry.Int_Tables_number 146 _symmetry.space_group_name_Hall 'R 3' _symmetry.space_group_name_H-M 'H 3' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7TG9 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 7.54 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 83.68 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 11 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details '338-293 at 0.4/hr' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'Tris, magnesium sulfate, silver nitrate, mercury chloride' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER2 X 9M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2021-11-14 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.00743 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 17-ID' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.00743 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 17-ID _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate 274.95 _reflns.entry_id 7TG9 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 4.69 _reflns.d_resolution_low 64.00 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 2674 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 85.1 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 10.1 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 9.7 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.998 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 4.69 _reflns_shell.d_res_low 5.35 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 382 _reflns_shell.percent_possible_all ? _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.576 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 264.56 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7TG9 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 4.69 _refine.ls_d_res_low 32.30 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 2462 _refine.ls_number_reflns_R_free 110 _refine.ls_number_reflns_R_work 2352 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 62.71 _refine.ls_percent_reflns_R_free 4.47 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.1652 _refine.ls_R_factor_R_free 0.1723 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1648 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.96 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct SAD _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 26.1643 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.0000 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 4.69 _refine_hist.d_res_low 32.30 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 860 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 858 _refine_hist.pdbx_number_atoms_ligand 2 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0162 ? 958 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.5606 ? 1471 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0833 ? 167 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0098 ? 42 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 41.5731 ? 407 ? f_dihedral_angle_d ? ? # _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.d_res_high 4.69 _refine_ls_shell.d_res_low 32.30 _refine_ls_shell.number_reflns_all ? _refine_ls_shell.number_reflns_obs ? _refine_ls_shell.number_reflns_R_free 110 _refine_ls_shell.number_reflns_R_work 2352 _refine_ls_shell.percent_reflns_obs 62.71 _refine_ls_shell.percent_reflns_R_free ? _refine_ls_shell.R_factor_all ? _refine_ls_shell.R_factor_obs ? _refine_ls_shell.R_factor_R_free 0.1723 _refine_ls_shell.R_factor_R_free_error ? _refine_ls_shell.R_factor_R_work 0.1648 _refine_ls_shell.redundancy_reflns_all ? _refine_ls_shell.redundancy_reflns_obs ? _refine_ls_shell.wR_factor_all ? _refine_ls_shell.wR_factor_obs ? _refine_ls_shell.wR_factor_R_free ? _refine_ls_shell.wR_factor_R_work ? _refine_ls_shell.pdbx_R_complete ? _refine_ls_shell.pdbx_total_number_of_bins_used ? _refine_ls_shell.pdbx_phase_error ? _refine_ls_shell.pdbx_fsc_work ? _refine_ls_shell.pdbx_fsc_free ? # _struct.entry_id 7TG9 _struct.title ;[T:Ag+/Hg2+:T--(pH11-pH7; 300s in metals)] Metal-mediated DNA base pair in tensegrity triangle grown at pH 11 and soaked in pH 7 with Ag+ and Hg2+ for 300s ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7TG9 _struct_keywords.text 'tensegrity triangle, self-assembling crystal, metal-mediated mismatch, DNA' _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 5 ? F N N 5 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 7TG9 7TG9 ? 1 ? 1 2 PDB 7TG9 7TG9 ? 2 ? 1 3 PDB 7TG9 7TG9 ? 3 ? 1 4 PDB 7TG9 7TG9 ? 4 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 7TG9 A 1 ? 21 ? 7TG9 1 ? 21 ? 1 21 2 2 7TG9 B 1 ? 7 ? 7TG9 1 ? 7 ? 1 7 3 3 7TG9 C 1 ? 7 ? 7TG9 8 ? 14 ? 8 14 4 4 7TG9 D 1 ? 7 ? 7TG9 1 ? 7 ? 1 7 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dodecameric _pdbx_struct_assembly.oligomeric_count 12 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1,2,3 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details ? # loop_ _pdbx_struct_oper_list.id _pdbx_struct_oper_list.type _pdbx_struct_oper_list.name _pdbx_struct_oper_list.symmetry_operation _pdbx_struct_oper_list.matrix[1][1] _pdbx_struct_oper_list.matrix[1][2] _pdbx_struct_oper_list.matrix[1][3] _pdbx_struct_oper_list.vector[1] _pdbx_struct_oper_list.matrix[2][1] _pdbx_struct_oper_list.matrix[2][2] _pdbx_struct_oper_list.matrix[2][3] _pdbx_struct_oper_list.vector[2] _pdbx_struct_oper_list.matrix[3][1] _pdbx_struct_oper_list.matrix[3][2] _pdbx_struct_oper_list.matrix[3][3] _pdbx_struct_oper_list.vector[3] 1 'identity operation' 1_555 x,y,z 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 2 'crystal symmetry operation' 2_555 -y,x-y,z -0.5000000000 -0.8660254038 0.0000000000 0.0000000000 0.8660254038 -0.5000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 3 'crystal symmetry operation' 3_555 -x+y,-x,z -0.5000000000 0.8660254038 0.0000000000 0.0000000000 -0.8660254038 -0.5000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A DT 12 O4 ? ? ? 1_555 F HG . HG ? ? A DT 12 B HG 102 1_555 ? ? ? ? ? ? ? 2.860 ? ? metalc2 metalc ? ? B DT 4 O2 ? ? ? 1_555 E HG . HG ? ? B DT 4 B HG 101 1_555 ? ? ? ? ? ? ? 2.184 ? ? metalc3 metalc ? ? B DT 4 N3 ? ? ? 1_555 E HG . HG ? ? B DT 4 B HG 101 1_555 ? ? ? ? ? ? ? 2.714 ? ? metalc4 metalc ? ? B DT 4 O4 ? ? ? 1_555 F HG . HG ? ? B DT 4 B HG 102 1_555 ? ? ? ? ? ? ? 2.218 ? ? hydrog1 hydrog ? ? A DA 2 N1 ? ? ? 1_555 C DT 7 N3 ? ? A DA 2 C DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DA 2 N6 ? ? ? 1_555 C DT 7 O4 ? ? A DA 2 C DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DG 3 N1 ? ? ? 1_555 C DC 6 N3 ? ? A DG 3 C DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DG 3 N2 ? ? ? 1_555 C DC 6 O2 ? ? A DG 3 C DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DG 3 O6 ? ? ? 1_555 C DC 6 N4 ? ? A DG 3 C DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DC 4 N3 ? ? ? 1_555 C DG 5 N1 ? ? A DC 4 C DG 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DC 4 N4 ? ? ? 1_555 C DG 5 O6 ? ? A DC 4 C DG 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DC 4 O2 ? ? ? 1_555 C DG 5 N2 ? ? A DC 4 C DG 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DA 5 N1 ? ? ? 1_555 C DT 4 N3 ? ? A DA 5 C DT 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DA 5 N6 ? ? ? 1_555 C DT 4 O4 ? ? A DA 5 C DT 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DG 6 N1 ? ? ? 1_555 C DC 3 N3 ? ? A DG 6 C DC 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DG 6 N2 ? ? ? 1_555 C DC 3 O2 ? ? A DG 6 C DC 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DG 6 O6 ? ? ? 1_555 C DC 3 N4 ? ? A DG 6 C DC 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DC 7 N3 ? ? ? 1_555 C DG 2 N1 ? ? A DC 7 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DC 7 N4 ? ? ? 1_555 C DG 2 O6 ? ? A DC 7 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 7 O2 ? ? ? 1_555 C DG 2 N2 ? ? A DC 7 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DC 8 N3 ? ? ? 1_555 C DG 1 N1 ? ? A DC 8 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DC 8 N4 ? ? ? 1_555 C DG 1 O6 ? ? A DC 8 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DC 8 O2 ? ? ? 1_555 C DG 1 N2 ? ? A DC 8 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DT 9 N3 ? ? ? 1_555 B DA 7 N1 ? ? A DT 9 B DA 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DT 9 O4 ? ? ? 1_555 B DA 7 N6 ? ? A DT 9 B DA 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DG 10 N1 ? ? ? 1_555 B DC 6 N3 ? ? A DG 10 B DC 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DG 10 N2 ? ? ? 1_555 B DC 6 O2 ? ? A DG 10 B DC 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DG 10 O6 ? ? ? 1_555 B DC 6 N4 ? ? A DG 10 B DC 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DT 11 N3 ? ? ? 1_555 B DA 5 N1 ? ? A DT 11 B DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DT 11 O4 ? ? ? 1_555 B DA 5 N6 ? ? A DT 11 B DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DT 13 N3 ? ? ? 1_555 B DA 3 N1 ? ? A DT 13 B DA 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DT 13 O4 ? ? ? 1_555 B DA 3 N6 ? ? A DT 13 B DA 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DG 14 N1 ? ? ? 1_555 B DC 2 N3 ? ? A DG 14 B DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A DG 14 N2 ? ? ? 1_555 B DC 2 O2 ? ? A DG 14 B DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A DG 14 O6 ? ? ? 1_555 B DC 2 N4 ? ? A DG 14 B DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A DG 15 N1 ? ? ? 1_555 B DC 1 N3 ? ? A DG 15 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DG 15 N2 ? ? ? 1_555 B DC 1 O2 ? ? A DG 15 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DG 15 O6 ? ? ? 1_555 B DC 1 N4 ? ? A DG 15 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DA 16 N1 ? ? ? 1_555 D DT 7 N3 ? ? A DA 16 D DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DA 16 N6 ? ? ? 1_555 D DT 7 O4 ? ? A DA 16 D DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DC 17 N3 ? ? ? 1_555 D DG 6 N1 ? ? A DC 17 D DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DC 17 N4 ? ? ? 1_555 D DG 6 O6 ? ? A DC 17 D DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DC 17 O2 ? ? ? 1_555 D DG 6 N2 ? ? A DC 17 D DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DA 18 N1 ? ? ? 1_555 D DT 5 N3 ? ? A DA 18 D DT 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DA 18 N6 ? ? ? 1_555 D DT 5 O4 ? ? A DA 18 D DT 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DT 19 N3 ? ? ? 1_555 D DA 4 N1 ? ? A DT 19 D DA 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DT 19 O4 ? ? ? 1_555 D DA 4 N6 ? ? A DT 19 D DA 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DC 20 N3 ? ? ? 1_555 D DG 3 N1 ? ? A DC 20 D DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A DC 20 N4 ? ? ? 1_555 D DG 3 O6 ? ? A DC 20 D DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A DC 20 O2 ? ? ? 1_555 D DG 3 N2 ? ? A DC 20 D DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A DA 21 N1 ? ? ? 1_555 D DT 2 N3 ? ? A DA 21 D DT 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A DA 21 N6 ? ? ? 1_555 D DT 2 O4 ? ? A DA 21 D DT 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 O4 ? A DT 12 ? A DT 12 ? 1_555 HG ? F HG . ? B HG 102 ? 1_555 O4 ? B DT 4 ? B DT 4 ? 1_555 95.9 ? 2 O2 ? B DT 4 ? B DT 4 ? 1_555 HG ? E HG . ? B HG 101 ? 1_555 N3 ? B DT 4 ? B DT 4 ? 1_555 54.2 ? # _pdbx_entry_details.entry_id 7TG9 _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 "O3'" A DG 10 ? ? "C3'" A DG 10 ? ? 1.369 1.419 -0.050 0.006 N 2 1 "C1'" A DT 11 ? ? N1 A DT 11 ? ? 1.597 1.488 0.109 0.013 N 3 1 "C5'" A DT 12 ? ? "C4'" A DT 12 ? ? 1.599 1.512 0.087 0.007 N 4 1 "C1'" A DT 12 ? ? N1 A DT 12 ? ? 1.576 1.488 0.088 0.013 N 5 1 "O3'" A DC 20 ? ? "C3'" A DC 20 ? ? 1.368 1.419 -0.051 0.006 N 6 1 "O3'" B DC 2 ? ? "C3'" B DC 2 ? ? 1.366 1.419 -0.053 0.006 N 7 1 "O3'" B DT 4 ? ? "C3'" B DT 4 ? ? 1.534 1.435 0.099 0.013 N 8 1 P D DC 1 ? ? OP3 D DC 1 ? ? 1.481 1.607 -0.126 0.012 N 9 1 N9 D DA 4 ? ? C4 D DA 4 ? ? 1.333 1.374 -0.041 0.006 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A DA 2 ? ? "C1'" A DA 2 ? ? N9 A DA 2 ? ? 111.23 108.30 2.93 0.30 N 2 1 "O4'" A DG 3 ? ? "C1'" A DG 3 ? ? N9 A DG 3 ? ? 110.66 108.30 2.36 0.30 N 3 1 "O4'" A DA 5 ? ? "C1'" A DA 5 ? ? N9 A DA 5 ? ? 110.63 108.30 2.33 0.30 N 4 1 "O4'" A DG 6 ? ? "C1'" A DG 6 ? ? N9 A DG 6 ? ? 110.42 108.30 2.12 0.30 N 5 1 "O4'" A DC 7 ? ? "C1'" A DC 7 ? ? N1 A DC 7 ? ? 113.40 108.30 5.10 0.30 N 6 1 "O4'" A DG 10 ? ? "C1'" A DG 10 ? ? N9 A DG 10 ? ? 110.16 108.30 1.86 0.30 N 7 1 "O4'" A DT 11 ? ? "C1'" A DT 11 ? ? N1 A DT 11 ? ? 113.86 108.30 5.56 0.30 N 8 1 "O5'" A DT 12 ? ? P A DT 12 ? ? OP1 A DT 12 ? ? 98.66 105.70 -7.04 0.90 N 9 1 "C5'" A DT 12 ? ? "C4'" A DT 12 ? ? "O4'" A DT 12 ? ? 117.11 109.80 7.31 1.10 N 10 1 "O4'" A DT 12 ? ? "C1'" A DT 12 ? ? N1 A DT 12 ? ? 112.56 108.30 4.26 0.30 N 11 1 N3 A DT 13 ? ? C4 A DT 13 ? ? O4 A DT 13 ? ? 124.06 119.90 4.16 0.60 N 12 1 "O4'" A DG 15 ? ? "C1'" A DG 15 ? ? N9 A DG 15 ? ? 110.17 108.30 1.87 0.30 N 13 1 "O4'" B DT 4 ? ? "C1'" B DT 4 ? ? N1 B DT 4 ? ? 114.99 108.30 6.69 0.30 N 14 1 "O4'" B DA 7 ? ? "C1'" B DA 7 ? ? N9 B DA 7 ? ? 111.73 108.30 3.43 0.30 N 15 1 "O4'" D DC 1 ? ? "C1'" D DC 1 ? ? N1 D DC 1 ? ? 111.46 108.30 3.16 0.30 N 16 1 "C3'" D DG 3 ? ? "C2'" D DG 3 ? ? "C1'" D DG 3 ? ? 97.14 102.40 -5.26 0.80 N 17 1 "O4'" D DG 3 ? ? "C1'" D DG 3 ? ? N9 D DG 3 ? ? 111.41 108.30 3.11 0.30 N 18 1 "O4'" D DG 6 ? ? "C1'" D DG 6 ? ? N9 D DG 6 ? ? 110.33 108.30 2.03 0.30 N # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 -y,x-y,z 3 -x+y,-x,z 4 x+1/3,y+2/3,z+2/3 5 -y+1/3,x-y+2/3,z+2/3 6 -x+y+1/3,-x+2/3,z+2/3 7 x+2/3,y+1/3,z+1/3 8 -y+2/3,x-y+1/3,z+1/3 9 -x+y+2/3,-x+1/3,z+1/3 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal DA OP3 O N N 1 DA P P N N 2 DA OP1 O N N 3 DA OP2 O N N 4 DA "O5'" O N N 5 DA "C5'" C N N 6 DA "C4'" C N R 7 DA "O4'" O N N 8 DA "C3'" C N S 9 DA "O3'" O N N 10 DA "C2'" C N N 11 DA "C1'" C N R 12 DA N9 N Y N 13 DA C8 C Y N 14 DA N7 N Y N 15 DA C5 C Y N 16 DA C6 C Y N 17 DA N6 N N N 18 DA N1 N Y N 19 DA C2 C Y N 20 DA N3 N Y N 21 DA C4 C Y N 22 DA HOP3 H N N 23 DA HOP2 H N N 24 DA "H5'" H N N 25 DA "H5''" H N N 26 DA "H4'" H N N 27 DA "H3'" H N N 28 DA "HO3'" H N N 29 DA "H2'" H N N 30 DA "H2''" H N N 31 DA "H1'" H N N 32 DA H8 H N N 33 DA H61 H N N 34 DA H62 H N N 35 DA H2 H N N 36 DC OP3 O N N 37 DC P P N N 38 DC OP1 O N N 39 DC OP2 O N N 40 DC "O5'" O N N 41 DC "C5'" C N N 42 DC "C4'" C N R 43 DC "O4'" O N N 44 DC "C3'" C N S 45 DC "O3'" O N N 46 DC "C2'" C N N 47 DC "C1'" C N R 48 DC N1 N N N 49 DC C2 C N N 50 DC O2 O N N 51 DC N3 N N N 52 DC C4 C N N 53 DC N4 N N N 54 DC C5 C N N 55 DC C6 C N N 56 DC HOP3 H N N 57 DC HOP2 H N N 58 DC "H5'" H N N 59 DC "H5''" H N N 60 DC "H4'" H N N 61 DC "H3'" H N N 62 DC "HO3'" H N N 63 DC "H2'" H N N 64 DC "H2''" H N N 65 DC "H1'" H N N 66 DC H41 H N N 67 DC H42 H N N 68 DC H5 H N N 69 DC H6 H N N 70 DG OP3 O N N 71 DG P P N N 72 DG OP1 O N N 73 DG OP2 O N N 74 DG "O5'" O N N 75 DG "C5'" C N N 76 DG "C4'" C N R 77 DG "O4'" O N N 78 DG "C3'" C N S 79 DG "O3'" O N N 80 DG "C2'" C N N 81 DG "C1'" C N R 82 DG N9 N Y N 83 DG C8 C Y N 84 DG N7 N Y N 85 DG C5 C Y N 86 DG C6 C N N 87 DG O6 O N N 88 DG N1 N N N 89 DG C2 C N N 90 DG N2 N N N 91 DG N3 N N N 92 DG C4 C Y N 93 DG HOP3 H N N 94 DG HOP2 H N N 95 DG "H5'" H N N 96 DG "H5''" H N N 97 DG "H4'" H N N 98 DG "H3'" H N N 99 DG "HO3'" H N N 100 DG "H2'" H N N 101 DG "H2''" H N N 102 DG "H1'" H N N 103 DG H8 H N N 104 DG H1 H N N 105 DG H21 H N N 106 DG H22 H N N 107 DT OP3 O N N 108 DT P P N N 109 DT OP1 O N N 110 DT OP2 O N N 111 DT "O5'" O N N 112 DT "C5'" C N N 113 DT "C4'" C N R 114 DT "O4'" O N N 115 DT "C3'" C N S 116 DT "O3'" O N N 117 DT "C2'" C N N 118 DT "C1'" C N R 119 DT N1 N N N 120 DT C2 C N N 121 DT O2 O N N 122 DT N3 N N N 123 DT C4 C N N 124 DT O4 O N N 125 DT C5 C N N 126 DT C7 C N N 127 DT C6 C N N 128 DT HOP3 H N N 129 DT HOP2 H N N 130 DT "H5'" H N N 131 DT "H5''" H N N 132 DT "H4'" H N N 133 DT "H3'" H N N 134 DT "HO3'" H N N 135 DT "H2'" H N N 136 DT "H2''" H N N 137 DT "H1'" H N N 138 DT H3 H N N 139 DT H71 H N N 140 DT H72 H N N 141 DT H73 H N N 142 DT H6 H N N 143 HG HG HG N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal DA OP3 P sing N N 1 DA OP3 HOP3 sing N N 2 DA P OP1 doub N N 3 DA P OP2 sing N N 4 DA P "O5'" sing N N 5 DA OP2 HOP2 sing N N 6 DA "O5'" "C5'" sing N N 7 DA "C5'" "C4'" sing N N 8 DA "C5'" "H5'" sing N N 9 DA "C5'" "H5''" sing N N 10 DA "C4'" "O4'" sing N N 11 DA "C4'" "C3'" sing N N 12 DA "C4'" "H4'" sing N N 13 DA "O4'" "C1'" sing N N 14 DA "C3'" "O3'" sing N N 15 DA "C3'" "C2'" sing N N 16 DA "C3'" "H3'" sing N N 17 DA "O3'" "HO3'" sing N N 18 DA "C2'" "C1'" sing N N 19 DA "C2'" "H2'" sing N N 20 DA "C2'" "H2''" sing N N 21 DA "C1'" N9 sing N N 22 DA "C1'" "H1'" sing N N 23 DA N9 C8 sing Y N 24 DA N9 C4 sing Y N 25 DA C8 N7 doub Y N 26 DA C8 H8 sing N N 27 DA N7 C5 sing Y N 28 DA C5 C6 sing Y N 29 DA C5 C4 doub Y N 30 DA C6 N6 sing N N 31 DA C6 N1 doub Y N 32 DA N6 H61 sing N N 33 DA N6 H62 sing N N 34 DA N1 C2 sing Y N 35 DA C2 N3 doub Y N 36 DA C2 H2 sing N N 37 DA N3 C4 sing Y N 38 DC OP3 P sing N N 39 DC OP3 HOP3 sing N N 40 DC P OP1 doub N N 41 DC P OP2 sing N N 42 DC P "O5'" sing N N 43 DC OP2 HOP2 sing N N 44 DC "O5'" "C5'" sing N N 45 DC "C5'" "C4'" sing N N 46 DC "C5'" "H5'" sing N N 47 DC "C5'" "H5''" sing N N 48 DC "C4'" "O4'" sing N N 49 DC "C4'" "C3'" sing N N 50 DC "C4'" "H4'" sing N N 51 DC "O4'" "C1'" sing N N 52 DC "C3'" "O3'" sing N N 53 DC "C3'" "C2'" sing N N 54 DC "C3'" "H3'" sing N N 55 DC "O3'" "HO3'" sing N N 56 DC "C2'" "C1'" sing N N 57 DC "C2'" "H2'" sing N N 58 DC "C2'" "H2''" sing N N 59 DC "C1'" N1 sing N N 60 DC "C1'" "H1'" sing N N 61 DC N1 C2 sing N N 62 DC N1 C6 sing N N 63 DC C2 O2 doub N N 64 DC C2 N3 sing N N 65 DC N3 C4 doub N N 66 DC C4 N4 sing N N 67 DC C4 C5 sing N N 68 DC N4 H41 sing N N 69 DC N4 H42 sing N N 70 DC C5 C6 doub N N 71 DC C5 H5 sing N N 72 DC C6 H6 sing N N 73 DG OP3 P sing N N 74 DG OP3 HOP3 sing N N 75 DG P OP1 doub N N 76 DG P OP2 sing N N 77 DG P "O5'" sing N N 78 DG OP2 HOP2 sing N N 79 DG "O5'" "C5'" sing N N 80 DG "C5'" "C4'" sing N N 81 DG "C5'" "H5'" sing N N 82 DG "C5'" "H5''" sing N N 83 DG "C4'" "O4'" sing N N 84 DG "C4'" "C3'" sing N N 85 DG "C4'" "H4'" sing N N 86 DG "O4'" "C1'" sing N N 87 DG "C3'" "O3'" sing N N 88 DG "C3'" "C2'" sing N N 89 DG "C3'" "H3'" sing N N 90 DG "O3'" "HO3'" sing N N 91 DG "C2'" "C1'" sing N N 92 DG "C2'" "H2'" sing N N 93 DG "C2'" "H2''" sing N N 94 DG "C1'" N9 sing N N 95 DG "C1'" "H1'" sing N N 96 DG N9 C8 sing Y N 97 DG N9 C4 sing Y N 98 DG C8 N7 doub Y N 99 DG C8 H8 sing N N 100 DG N7 C5 sing Y N 101 DG C5 C6 sing N N 102 DG C5 C4 doub Y N 103 DG C6 O6 doub N N 104 DG C6 N1 sing N N 105 DG N1 C2 sing N N 106 DG N1 H1 sing N N 107 DG C2 N2 sing N N 108 DG C2 N3 doub N N 109 DG N2 H21 sing N N 110 DG N2 H22 sing N N 111 DG N3 C4 sing N N 112 DT OP3 P sing N N 113 DT OP3 HOP3 sing N N 114 DT P OP1 doub N N 115 DT P OP2 sing N N 116 DT P "O5'" sing N N 117 DT OP2 HOP2 sing N N 118 DT "O5'" "C5'" sing N N 119 DT "C5'" "C4'" sing N N 120 DT "C5'" "H5'" sing N N 121 DT "C5'" "H5''" sing N N 122 DT "C4'" "O4'" sing N N 123 DT "C4'" "C3'" sing N N 124 DT "C4'" "H4'" sing N N 125 DT "O4'" "C1'" sing N N 126 DT "C3'" "O3'" sing N N 127 DT "C3'" "C2'" sing N N 128 DT "C3'" "H3'" sing N N 129 DT "O3'" "HO3'" sing N N 130 DT "C2'" "C1'" sing N N 131 DT "C2'" "H2'" sing N N 132 DT "C2'" "H2''" sing N N 133 DT "C1'" N1 sing N N 134 DT "C1'" "H1'" sing N N 135 DT N1 C2 sing N N 136 DT N1 C6 sing N N 137 DT C2 O2 doub N N 138 DT C2 N3 sing N N 139 DT N3 C4 sing N N 140 DT N3 H3 sing N N 141 DT C4 O4 doub N N 142 DT C4 C5 sing N N 143 DT C5 C7 sing N N 144 DT C5 C6 doub N N 145 DT C7 H71 sing N N 146 DT C7 H72 sing N N 147 DT C7 H73 sing N N 148 DT C6 H6 sing N N 149 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7TG9 'double helix' 7TG9 'a-form double helix' 7TG9 'b-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DA 2 1_555 C DT 7 1_555 0.147 -0.313 -1.219 -12.945 -15.874 -7.723 1 A_DA2:DT14_C A 2 ? C 14 ? 20 1 1 A DG 3 1_555 C DC 6 1_555 -0.229 -0.281 -1.030 -12.035 -11.227 8.675 2 A_DG3:DC13_C A 3 ? C 13 ? 19 1 1 A DC 4 1_555 C DG 5 1_555 0.138 -0.448 -0.718 -4.705 -4.872 -3.607 3 A_DC4:DG12_C A 4 ? C 12 ? 19 1 1 A DA 5 1_555 C DT 4 1_555 0.345 -0.296 0.139 6.091 -4.607 -11.080 4 A_DA5:DT11_C A 5 ? C 11 ? 20 1 1 A DG 6 1_555 C DC 3 1_555 -0.008 -0.569 1.533 26.332 -5.339 -1.459 5 A_DG6:DC10_C A 6 ? C 10 ? 19 1 1 A DC 7 1_555 C DG 2 1_555 0.346 -0.593 1.037 22.632 -10.699 5.916 6 A_DC7:DG9_C A 7 ? C 9 ? 19 1 1 A DC 8 1_555 C DG 1 1_555 -0.101 -0.386 0.301 -4.783 -27.246 -0.760 7 A_DC8:DG8_C A 8 ? C 8 ? 19 1 1 A DT 9 1_555 B DA 7 1_555 -0.361 -0.475 0.194 6.294 -9.988 -4.746 8 A_DT9:DA7_B A 9 ? B 7 ? 20 1 1 A DG 10 1_555 B DC 6 1_555 -0.306 -0.165 0.044 -8.562 -13.048 8.642 9 A_DG10:DC6_B A 10 ? B 6 ? 19 1 1 A DT 11 1_555 B DA 5 1_555 -0.559 -0.446 -0.568 -0.825 -3.203 -4.488 10 A_DT11:DA5_B A 11 ? B 5 ? 20 1 1 A DT 13 1_555 B DA 3 1_555 -0.196 -0.762 -0.467 -22.026 3.941 -3.205 11 A_DT13:DA3_B A 13 ? B 3 ? 20 1 1 A DG 14 1_555 B DC 2 1_555 -0.166 -0.666 -1.772 -14.414 -14.116 -5.336 12 A_DG14:DC2_B A 14 ? B 2 ? 19 1 1 A DG 15 1_555 B DC 1 1_555 -0.237 -0.429 -0.064 1.899 -17.768 -1.814 13 A_DG15:DC1_B A 15 ? B 1 ? 19 1 1 A DA 16 1_555 D DT 7 1_555 0.889 -0.953 2.025 17.219 -14.158 -15.169 14 A_DA16:DT7_D A 16 ? D 7 ? 20 1 1 A DC 17 1_555 D DG 6 1_555 0.256 -0.289 0.485 -7.899 -15.872 0.835 15 A_DC17:DG6_D A 17 ? D 6 ? 19 1 1 A DA 18 1_555 D DT 5 1_555 0.267 -0.547 0.282 -1.283 -6.954 4.298 16 A_DA18:DT5_D A 18 ? D 5 ? 20 1 1 A DT 19 1_555 D DA 4 1_555 -0.204 -0.527 0.189 4.981 -4.917 2.134 17 A_DT19:DA4_D A 19 ? D 4 ? 20 1 1 A DC 20 1_555 D DG 3 1_555 0.157 -0.275 -0.131 5.641 -14.584 0.145 18 A_DC20:DG3_D A 20 ? D 3 ? 19 1 1 A DA 21 1_555 D DT 2 1_555 0.118 -0.327 0.760 -8.638 -7.971 -9.676 19 A_DA21:DT2_D A 21 ? D 2 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DA 2 1_555 C DT 7 1_555 A DG 3 1_555 C DC 6 1_555 0.665 0.429 3.497 -8.498 5.694 37.247 -0.095 -2.117 3.300 8.715 13.007 38.578 1 AA_DA2DG3:DC13DT14_CC A 2 ? C 14 ? A 3 ? C 13 ? 1 A DG 3 1_555 C DC 6 1_555 A DC 4 1_555 C DG 5 1_555 -0.616 -1.524 2.891 -4.423 -0.567 28.445 -2.951 0.344 2.980 -1.146 8.931 28.785 2 AA_DG3DC4:DG12DC13_CC A 3 ? C 13 ? A 4 ? C 12 ? 1 A DC 4 1_555 C DG 5 1_555 A DA 5 1_555 C DT 4 1_555 -0.148 -0.138 3.030 -3.118 11.384 32.700 -1.844 -0.193 2.828 19.446 5.327 34.711 3 AA_DC4DA5:DT11DG12_CC A 4 ? C 12 ? A 5 ? C 11 ? 1 A DA 5 1_555 C DT 4 1_555 A DG 6 1_555 C DC 3 1_555 0.207 -1.418 2.225 -18.280 3.465 35.044 -2.361 -1.704 1.768 5.317 28.050 39.540 4 AA_DA5DG6:DC10DT11_CC A 5 ? C 11 ? A 6 ? C 10 ? 1 A DG 6 1_555 C DC 3 1_555 A DC 7 1_555 C DG 2 1_555 1.044 -2.067 3.161 -2.011 1.105 26.256 -4.811 -2.797 2.986 2.427 4.417 26.354 5 AA_DG6DC7:DG9DC10_CC A 6 ? C 10 ? A 7 ? C 9 ? 1 A DC 7 1_555 C DG 2 1_555 A DC 8 1_555 C DG 1 1_555 -0.832 -0.852 3.375 1.584 -6.873 49.127 -0.486 1.114 3.431 -8.218 -1.894 49.599 6 AA_DC7DC8:DG8DG9_CC A 7 ? C 9 ? A 8 ? C 8 ? 1 A DC 8 1_555 C DG 1 1_555 A DT 9 1_555 B DA 7 1_555 -2.562 -0.186 3.532 -1.944 -14.854 19.315 4.849 5.370 3.118 -37.766 4.943 24.400 7 AA_DC8DT9:DA7DG8_BC A 8 ? C 8 ? A 9 ? B 7 ? 1 A DT 9 1_555 B DA 7 1_555 A DG 10 1_555 B DC 6 1_555 0.580 -0.904 3.942 0.928 -1.204 29.974 -1.446 -0.888 3.990 -2.325 -1.792 30.012 8 AA_DT9DG10:DC6DA7_BB A 9 ? B 7 ? A 10 ? B 6 ? 1 A DG 10 1_555 B DC 6 1_555 A DT 11 1_555 B DA 5 1_555 -0.590 0.281 2.865 5.024 10.821 34.915 -0.847 1.534 2.723 17.418 -8.087 36.837 9 AA_DG10DT11:DA5DC6_BB A 10 ? B 6 ? A 11 ? B 5 ? 1 A DT 11 1_555 B DA 5 1_555 A DT 13 1_555 B DA 3 1_555 -0.477 -1.730 7.189 -3.165 19.977 65.568 -3.154 0.170 6.506 18.007 2.852 68.283 10 AA_DT11DT13:DA3DA5_BB A 11 ? B 5 ? A 13 ? B 3 ? 1 A DT 13 1_555 B DA 3 1_555 A DG 14 1_555 B DC 2 1_555 -1.477 3.286 3.188 -5.570 -10.620 51.777 4.295 1.330 2.649 -11.979 6.282 53.054 11 AA_DT13DG14:DC2DA3_BB A 13 ? B 3 ? A 14 ? B 2 ? 1 A DG 14 1_555 B DC 2 1_555 A DG 15 1_555 B DC 1 1_555 0.957 1.009 2.623 -12.873 1.984 42.018 1.204 -2.219 2.292 2.691 17.456 43.903 12 AA_DG14DG15:DC1DC2_BB A 14 ? B 2 ? A 15 ? B 1 ? 1 A DG 15 1_555 B DC 1 1_555 A DA 16 1_555 D DT 7 1_555 -1.610 -0.621 2.981 -21.326 -12.102 25.656 1.003 -0.917 3.344 -21.906 38.603 35.346 13 AA_DG15DA16:DT7DC1_DB A 15 ? B 1 ? A 16 ? D 7 ? 1 A DA 16 1_555 D DT 7 1_555 A DC 17 1_555 D DG 6 1_555 0.645 -1.580 4.070 13.013 0.954 30.793 -2.953 1.642 3.963 1.705 -23.241 33.382 14 AA_DA16DC17:DG6DT7_DD A 16 ? D 7 ? A 17 ? D 6 ? 1 A DC 17 1_555 D DG 6 1_555 A DA 18 1_555 D DT 5 1_555 0.298 0.186 3.235 0.552 -6.419 37.838 1.074 -0.386 3.166 -9.812 -0.843 38.363 15 AA_DC17DA18:DT5DG6_DD A 17 ? D 6 ? A 18 ? D 5 ? 1 A DA 18 1_555 D DT 5 1_555 A DT 19 1_555 D DA 4 1_555 0.279 -1.005 2.997 3.312 2.897 33.975 -2.120 0.000 2.917 4.932 -5.638 34.251 16 AA_DA18DT19:DA4DT5_DD A 18 ? D 5 ? A 19 ? D 4 ? 1 A DT 19 1_555 D DA 4 1_555 A DC 20 1_555 D DG 3 1_555 0.333 0.797 2.915 7.457 -4.825 42.268 1.505 0.197 2.828 -6.604 -10.206 43.149 17 AA_DT19DC20:DG3DA4_DD A 19 ? D 4 ? A 20 ? D 3 ? 1 A DC 20 1_555 D DG 3 1_555 A DA 21 1_555 D DT 2 1_555 -0.611 -0.576 3.399 -8.935 11.696 31.354 -2.847 -0.405 3.056 20.300 15.507 34.558 18 AA_DC20DA21:DT2DG3_DD A 20 ? D 3 ? A 21 ? D 2 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'Office of Naval Research (ONR)' 'United States' N000141912596 1 'Department of Energy (DOE, United States)' 'United States' DE-SC0007991 2 'National Science Foundation (NSF, United States)' 'United States' 2106790 3 'Human Frontier Science Program (HFSP)' 'United States' RPG0010/2017 4 'National Science Foundation (NSF, United States)' 'United States' DMR-1420073 5 'National Aeronautic Space Administration (NASA, United States)' 'United States' '2020 NASA Center Innovation Fund' 6 # _space_group.name_H-M_alt 'R 3 :H' _space_group.name_Hall 'R 3' _space_group.IT_number 146 _space_group.crystal_system trigonal _space_group.id 1 # _atom_sites.entry_id 7TG9 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.009449 _atom_sites.fract_transf_matrix[1][2] 0.005455 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.010911 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.011185 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source C ? ? 5.96793 ? ? ? 14.89577 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? HG ? ? 79.56749 ? ? ? 4.10057 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 6.96715 ? ? ? 11.43723 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 7.96527 ? ? ? 9.05267 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 14.90797 ? ? ? 11.91318 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_ # loop_ #