data_7U4A # _entry.id 7U4A # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.379 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7U4A pdb_00007u4a 10.2210/pdb7u4a/pdb WWPDB D_1000262366 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7U4A _pdbx_database_status.recvd_initial_deposition_date 2022-02-28 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Thompson, R.D.' 1 0000-0002-6588-0665 'Carbaugh, D.L.' 2 0000-0002-5721-7097 'Nielsen, J.R.' 3 0000-0002-9241-3085 'Witt, C.' 4 0000-0003-4591-3076 'Meganck, R.M.' 5 0000-0003-2799-3754 'Rangadurai, A.' 6 0000-0003-2019-313X 'Zhao, B.' 7 0000-0002-3580-0468 'Bonin, J.P.' 8 0000-0002-2138-4440 'Nathan, N.T.' 9 0000-0002-0025-2377 'Marzluff, W.F.' 10 0000-0003-3635-4073 'Frank, A.T.' 11 0000-0002-7782-2200 'Lazear, H.M.' 12 0000-0002-8649-4579 'Zhang, Q.' 13 0000-0003-1754-4058 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Dynamic Basis of Xrn1 Resistance in Mosquito-borne Flavivirus RNA' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Thompson, R.D.' 1 0000-0002-6588-0665 primary 'Carbaugh, D.L.' 2 0000-0002-5721-7097 primary 'Nielsen, J.R.' 3 0000-0002-9241-3085 primary 'Witt, C.' 4 0000-0003-4591-3076 primary 'Meganck, R.M.' 5 0000-0003-2799-3754 primary 'Rangadurai, A.' 6 0000-0003-2019-313X primary 'Zhao, B.' 7 0000-0002-3580-0468 primary 'Bonin, J.P.' 8 0000-0002-2138-4440 primary 'Nathan, N.T.' 9 0000-0002-0025-2377 primary 'Marzluff, W.F.' 10 0000-0003-3635-4073 primary 'Frank, A.T.' 11 0000-0002-7782-2200 primary 'Lazear, H.M.' 12 0000-0002-8649-4579 primary 'Zhang, Q.' 13 0000-0003-1754-4058 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 94.339 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 7U4A _cell.details ? _cell.formula_units_Z ? _cell.length_a 48.421 _cell.length_a_esd ? _cell.length_b 39.137 _cell.length_b_esd ? _cell.length_c 66.583 _cell.length_c_esd ? _cell.volume 125816.649 _cell.volume_esd ? _cell.Z_PDB 2 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7U4A _symmetry.cell_setting ? _symmetry.Int_Tables_number 4 _symmetry.space_group_name_Hall 'P 2yb' _symmetry.space_group_name_H-M 'P 1 21 1' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (70-MER)' 23325.904 1 ? ? ? ? 2 non-polymer syn 'MAGNESIUM ION' 24.305 1 ? ? ? ? 3 water nat water 18.015 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGUCAGGCCGGCGAAAGUCGCCACAGUUUGGGGAAAGCUGUGCAGCCUGUAACUCUCCCACGAAAGUGGGU _entity_poly.pdbx_seq_one_letter_code_can GGGUCAGGCCGGCGAAAGUCGCCACAGUUUGGGGAAAGCUGUGCAGCCUGUAACUCUCCCACGAAAGUGGGU _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 U n 1 5 C n 1 6 A n 1 7 G n 1 8 G n 1 9 C n 1 10 C n 1 11 G n 1 12 G n 1 13 C n 1 14 G n 1 15 A n 1 16 A n 1 17 A n 1 18 G n 1 19 U n 1 20 C n 1 21 G n 1 22 C n 1 23 C n 1 24 A n 1 25 C n 1 26 A n 1 27 G n 1 28 U n 1 29 U n 1 30 U n 1 31 G n 1 32 G n 1 33 G n 1 34 G n 1 35 A n 1 36 A n 1 37 A n 1 38 G n 1 39 C n 1 40 U n 1 41 G n 1 42 U n 1 43 G n 1 44 C n 1 45 A n 1 46 G n 1 47 C n 1 48 C n 1 49 U n 1 50 G n 1 51 U n 1 52 A n 1 53 A n 1 54 C n 1 55 U n 1 56 C n 1 57 U n 1 58 C n 1 59 C n 1 60 C n 1 61 A n 1 62 C n 1 63 G n 1 64 A n 1 65 A n 1 66 A n 1 67 G n 1 68 U n 1 69 G n 1 70 G n 1 71 G n 1 72 U n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 72 _pdbx_entity_src_syn.organism_scientific 'Zika virus' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 64320 _pdbx_entity_src_syn.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7U4A _struct_ref.pdbx_db_accession 7U4A _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7U4A _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 72 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7U4A _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 72 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 72 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7U4A _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.70 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 54.39 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;RNA was exchanged and concentrated into 10 mM HEPES-KOH, pH 7.5, 2.5 mM magnesium chloride. After concentration to 7.5 mg/mL (~330 uM), RNA was diluted to 4 mg/mL, 100 mM spermidine was added to a final concentration of 0.5 mM. 0.5 uL RNA was added to 2 uL crystallization solution (50 mM sodium cacodylate, pH 6.0, 150 mM sodium chloride, 4 mM calcium chloride, 0.6 mM spermine, 36% 1,6-hexanediol) and crystallized via hanging drop vapor diffusion over 1 mL crystallization solution. Crystals formed within 24 hours at 20 degrees C and were harvested after 36 hours. ; _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector CCD _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'MARMOSAIC 225 mm CCD' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2020-08-09 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 22-BM' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 22-BM _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate 58.32 _reflns.entry_id 7U4A _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.15 _reflns.d_resolution_low 33.2 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 4391 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 95.7 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 3.6 _reflns.pdbx_Rmerge_I_obs 0.114 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 9.9 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.136 _reflns.pdbx_Rpim_I_all 0.074 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.990 _reflns.pdbx_CC_star 0.998 _reflns.pdbx_R_split ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_all _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 7.46 33.2 ? ? ? ? ? ? 344 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 1 1 0.991 ? ? ? ? ? ? ? ? ? ? 5.92 7.46 ? ? ? ? ? ? 350 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 2 1 0.986 ? ? ? ? ? ? ? ? ? ? 5.17 5.92 ? ? ? ? ? ? 337 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 3 1 0.984 ? ? ? ? ? ? ? ? ? ? 4.7 5.17 ? ? ? ? ? ? 338 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 4 1 0.986 ? ? ? ? ? ? ? ? ? ? 4.36 4.7 ? ? ? ? ? ? 338 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 5 1 0.981 ? ? ? ? ? ? ? ? ? ? 4.11 4.36 ? ? ? ? ? ? 344 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 6 1 0.981 ? ? ? ? ? ? ? ? ? ? 3.9 4.11 ? ? ? ? ? ? 319 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 7 1 0.986 ? ? ? ? ? ? ? ? ? ? 3.73 3.9 ? ? ? ? ? ? 334 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 8 1 0.987 ? ? ? ? ? ? ? ? ? ? 3.59 3.73 ? ? ? ? ? ? 347 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 9 1 0.985 ? ? ? ? ? ? ? ? ? ? 3.46 3.59 ? ? ? ? ? ? 324 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 10 1 0.979 ? ? ? ? ? ? ? ? ? ? 3.36 3.46 ? ? ? ? ? ? 346 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 11 1 0.99 ? ? ? ? ? ? ? ? ? ? 3.26 3.36 ? ? ? ? ? ? 328 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 12 1 0.982 ? ? ? ? ? ? ? ? ? ? 3.17 3.26 ? ? ? ? ? ? 342 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 13 1 0.984 ? ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 59.85 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7U4A _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.15 _refine.ls_d_res_low 33.20 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 4276 _refine.ls_number_reflns_R_free 218 _refine.ls_number_reflns_R_work 4058 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 95.77 _refine.ls_percent_reflns_R_free 5.10 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2168 _refine.ls_R_factor_R_free 0.2704 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2140 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.41 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 'PDB entry 5TPY' _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 19.4835 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.3436 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 3.15 _refine_hist.d_res_low 33.20 _refine_hist.number_atoms_solvent 1 _refine_hist.number_atoms_total 1503 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1501 _refine_hist.pdbx_number_atoms_ligand 1 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0020 ? 1679 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.5256 ? 2617 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0259 ? 350 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0038 ? 70 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 12.9050 ? 837 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 3.15 3.97 . . 103 1952 93.20 . . . 0.3200 . 0.2405 . . . . . . . . . . . 'X-RAY DIFFRACTION' 3.97 33.20 . . 115 2106 98.27 . . . 0.2444 . 0.1994 . . . . . . . . . . . # _struct.entry_id 7U4A _struct.title 'Crystal Structure of Zika virus xrRNA1 mutant' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7U4A _struct_keywords.text 'xrRNA, Viral RNA, Flavivirus, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A C 5 OP2 ? ? ? 1_555 B MG . MG ? ? A C 5 A MG 101 1_555 ? ? ? ? ? ? ? 2.143 ? ? metalc2 metalc ? ? A A 6 OP2 ? ? ? 1_555 B MG . MG ? ? A A 6 A MG 101 1_555 ? ? ? ? ? ? ? 2.407 ? ? metalc3 metalc ? ? A C 23 OP2 ? ? ? 1_555 B MG . MG ? ? A C 23 A MG 101 1_555 ? ? ? ? ? ? ? 1.888 ? ? hydrog1 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 44 N3 ? ? A G 3 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 44 O2 ? ? A G 3 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 44 N4 ? ? A G 3 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 24 N7 ? ? A U 4 A A 24 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog5 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 24 N6 ? ? A U 4 A A 24 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog6 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 50 N1 ? ? A C 5 A G 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 50 O6 ? ? A C 5 A G 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 50 N2 ? ? A C 5 A G 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 6 N1 ? ? ? 1_555 A U 49 N3 ? ? A A 6 A U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 49 O4 ? ? A A 6 A U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 7 N1 ? ? ? 1_555 A C 48 O2 ? ? A G 7 A C 48 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog12 hydrog ? ? A G 7 N2 ? ? ? 1_555 A C 48 N3 ? ? A G 7 A C 48 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog13 hydrog ? ? A G 8 N1 ? ? ? 1_555 A C 47 N3 ? ? A G 8 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 47 O2 ? ? A G 8 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 8 O6 ? ? ? 1_555 A C 47 N4 ? ? A G 8 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 46 N1 ? ? A C 9 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 46 O6 ? ? A C 9 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 46 N2 ? ? A C 9 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 21 N1 ? ? A C 10 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 21 O6 ? ? A C 10 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 21 N2 ? ? A C 10 A G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 12 N1 ? ? ? 1_555 A U 19 O2 ? ? A G 12 A U 19 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog26 hydrog ? ? A G 12 O6 ? ? ? 1_555 A U 19 N3 ? ? A G 12 A U 19 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog27 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 18 N1 ? ? A C 13 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 18 O6 ? ? A C 13 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 18 N2 ? ? A C 13 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 23 N3 ? ? ? 1_555 A G 43 N1 ? ? A C 23 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 23 N4 ? ? ? 1_555 A G 43 O6 ? ? A C 23 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 23 O2 ? ? ? 1_555 A G 43 N2 ? ? A C 23 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A A 24 N1 ? ? ? 1_555 A U 42 N3 ? ? A A 24 A U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A A 24 N6 ? ? ? 1_555 A U 42 O4 ? ? A A 24 A U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 25 N3 ? ? ? 1_555 A G 41 N1 ? ? A C 25 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 25 N4 ? ? ? 1_555 A G 41 O6 ? ? A C 25 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 25 O2 ? ? ? 1_555 A G 41 N2 ? ? A C 25 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A A 26 N1 ? ? ? 1_555 A U 40 N3 ? ? A A 26 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A A 26 N6 ? ? ? 1_555 A U 40 O4 ? ? A A 26 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 39 N3 ? ? A G 27 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 39 O2 ? ? A G 27 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 39 N4 ? ? A G 27 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A U 28 N3 ? ? ? 1_555 A G 38 O6 ? ? A U 28 A G 38 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog44 hydrog ? ? A U 28 O2 ? ? ? 1_555 A G 38 N1 ? ? A U 28 A G 38 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog45 hydrog ? ? A U 29 N3 ? ? ? 1_555 A A 36 N7 ? ? A U 29 A A 36 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog46 hydrog ? ? A U 29 O2 ? ? ? 1_555 A A 36 N6 ? ? A U 29 A A 36 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog47 hydrog ? ? A G 31 N1 ? ? ? 1_555 A U 57 O2 ? ? A G 31 A U 57 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog48 hydrog ? ? A G 31 O6 ? ? ? 1_555 A U 57 N3 ? ? A G 31 A U 57 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog49 hydrog ? ? A G 32 N1 ? ? ? 1_555 A C 56 N3 ? ? A G 32 A C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 32 N2 ? ? ? 1_555 A C 56 O2 ? ? A G 32 A C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 32 O6 ? ? ? 1_555 A C 56 N4 ? ? A G 32 A C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 33 N1 ? ? ? 1_555 A U 55 O2 ? ? A G 33 A U 55 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog53 hydrog ? ? A G 33 O6 ? ? ? 1_555 A U 55 N3 ? ? A G 33 A U 55 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog54 hydrog ? ? A G 34 N1 ? ? ? 1_555 A C 54 N3 ? ? A G 34 A C 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 34 N2 ? ? ? 1_555 A C 54 O2 ? ? A G 34 A C 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 34 O6 ? ? ? 1_555 A C 54 N4 ? ? A G 34 A C 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A A 37 N1 ? ? ? 1_555 A U 51 N3 ? ? A A 37 A U 51 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog58 hydrog ? ? A A 37 N6 ? ? ? 1_555 A U 51 O2 ? ? A A 37 A U 51 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog59 hydrog ? ? A C 58 N3 ? ? ? 1_555 A G 71 N1 ? ? A C 58 A G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A C 58 N4 ? ? ? 1_555 A G 71 O6 ? ? A C 58 A G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A C 58 O2 ? ? ? 1_555 A G 71 N2 ? ? A C 58 A G 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A C 59 N3 ? ? ? 1_555 A G 70 N1 ? ? A C 59 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A C 59 N4 ? ? ? 1_555 A G 70 O6 ? ? A C 59 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A C 59 O2 ? ? ? 1_555 A G 70 N2 ? ? A C 59 A G 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A C 60 N3 ? ? ? 1_555 A G 69 N1 ? ? A C 60 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A C 60 N4 ? ? ? 1_555 A G 69 O6 ? ? A C 60 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A C 60 O2 ? ? ? 1_555 A G 69 N2 ? ? A C 60 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A A 61 N1 ? ? ? 1_555 A U 68 N3 ? ? A A 61 A U 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A A 61 N6 ? ? ? 1_555 A U 68 O4 ? ? A A 61 A U 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A C 62 N3 ? ? ? 1_555 A G 67 N1 ? ? A C 62 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A C 62 N4 ? ? ? 1_555 A G 67 O6 ? ? A C 62 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A C 62 O2 ? ? ? 1_555 A G 67 N2 ? ? A C 62 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A G 63 N2 ? ? ? 1_555 A A 66 N7 ? ? A G 63 A A 66 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # _atom_sites.entry_id 7U4A _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.020652 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.001567 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.025551 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.015062 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source C ? ? 3.54356 2.42580 ? ? 25.62398 1.50364 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? H ? ? 0.99627 ? ? ? 14.84254 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? MG ? ? ? ? ? ? ? ? ? ? ? ? ? MG2+ ? ? 9.95820 ? ? ? 3.10187 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 6.96715 ? ? ? 11.43723 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 7.96527 ? ? ? 9.05267 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O1- ? ? 5.12366 3.84317 ? ? 3.49406 27.47979 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 9.51135 5.44231 ? ? 1.42069 35.72801 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 ? ? ? A . n A 1 2 G 2 2 ? ? ? A . n A 1 3 G 3 3 3 G G A . n A 1 4 U 4 4 4 U U A . n A 1 5 C 5 5 5 C C A . n A 1 6 A 6 6 6 A A A . n A 1 7 G 7 7 7 G G A . n A 1 8 G 8 8 8 G G A . n A 1 9 C 9 9 9 C C A . n A 1 10 C 10 10 10 C C A . n A 1 11 G 11 11 11 G G A . n A 1 12 G 12 12 12 G G A . n A 1 13 C 13 13 13 C C A . n A 1 14 G 14 14 14 G G A . n A 1 15 A 15 15 15 A A A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 G 18 18 18 G G A . n A 1 19 U 19 19 19 U U A . n A 1 20 C 20 20 20 C C A . n A 1 21 G 21 21 21 G G A . n A 1 22 C 22 22 22 C C A . n A 1 23 C 23 23 23 C C A . n A 1 24 A 24 24 24 A A A . n A 1 25 C 25 25 25 C C A . n A 1 26 A 26 26 26 A A A . n A 1 27 G 27 27 27 G G A . n A 1 28 U 28 28 28 U U A . n A 1 29 U 29 29 29 U U A . n A 1 30 U 30 30 30 U U A . n A 1 31 G 31 31 31 G G A . n A 1 32 G 32 32 32 G G A . n A 1 33 G 33 33 33 G G A . n A 1 34 G 34 34 34 G G A . n A 1 35 A 35 35 35 A A A . n A 1 36 A 36 36 36 A A A . n A 1 37 A 37 37 37 A A A . n A 1 38 G 38 38 38 G G A . n A 1 39 C 39 39 39 C C A . n A 1 40 U 40 40 40 U U A . n A 1 41 G 41 41 41 G G A . n A 1 42 U 42 42 42 U U A . n A 1 43 G 43 43 43 G G A . n A 1 44 C 44 44 44 C C A . n A 1 45 A 45 45 45 A A A . n A 1 46 G 46 46 46 G G A . n A 1 47 C 47 47 47 C C A . n A 1 48 C 48 48 48 C C A . n A 1 49 U 49 49 49 U U A . n A 1 50 G 50 50 50 G G A . n A 1 51 U 51 51 51 U U A . n A 1 52 A 52 52 52 A A A . n A 1 53 A 53 53 53 A A A . n A 1 54 C 54 54 54 C C A . n A 1 55 U 55 55 55 U U A . n A 1 56 C 56 56 56 C C A . n A 1 57 U 57 57 57 U U A . n A 1 58 C 58 58 58 C C A . n A 1 59 C 59 59 59 C C A . n A 1 60 C 60 60 60 C C A . n A 1 61 A 61 61 61 A A A . n A 1 62 C 62 62 62 C C A . n A 1 63 G 63 63 63 G G A . n A 1 64 A 64 64 64 A A A . n A 1 65 A 65 65 65 A A A . n A 1 66 A 66 66 66 A A A . n A 1 67 G 67 67 67 G G A . n A 1 68 U 68 68 68 U U A . n A 1 69 G 69 69 69 G G A . n A 1 70 G 70 70 70 G G A . n A 1 71 G 71 71 71 G G A . n A 1 72 U 72 72 72 U U A . n # _pdbx_contact_author.id 2 _pdbx_contact_author.email zhangqi@unc.edu _pdbx_contact_author.name_first Qi _pdbx_contact_author.name_last Zhang _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0003-1754-4058 # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 MG 1 101 1 MG MG A . C 3 HOH 1 201 1 HOH HOH A . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 100 ? 1 MORE -9 ? 1 'SSA (A^2)' 11780 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 OP2 ? A C 5 ? A C 5 ? 1_555 MG ? B MG . ? A MG 101 ? 1_555 OP2 ? A A 6 ? A A 6 ? 1_555 81.8 ? 2 OP2 ? A C 5 ? A C 5 ? 1_555 MG ? B MG . ? A MG 101 ? 1_555 OP2 ? A C 23 ? A C 23 ? 1_555 84.1 ? 3 OP2 ? A A 6 ? A A 6 ? 1_555 MG ? B MG . ? A MG 101 ? 1_555 OP2 ? A C 23 ? A C 23 ? 1_555 155.3 ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2023-09-06 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 -x,y+1/2,-z # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.18.2_3874 1 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.18.2_3874 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 3 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? . 5 # _pdbx_entry_details.entry_id 7U4A _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 H21 A G 7 ? ? O2 A C 48 ? ? 1.34 2 1 H1 A G 7 ? ? N3 A C 48 ? ? 1.58 3 1 OP1 A G 21 ? ? "O2'" A C 23 ? ? 2.19 # loop_ _pdbx_unobs_or_zero_occ_residues.id _pdbx_unobs_or_zero_occ_residues.PDB_model_num _pdbx_unobs_or_zero_occ_residues.polymer_flag _pdbx_unobs_or_zero_occ_residues.occupancy_flag _pdbx_unobs_or_zero_occ_residues.auth_asym_id _pdbx_unobs_or_zero_occ_residues.auth_comp_id _pdbx_unobs_or_zero_occ_residues.auth_seq_id _pdbx_unobs_or_zero_occ_residues.PDB_ins_code _pdbx_unobs_or_zero_occ_residues.label_asym_id _pdbx_unobs_or_zero_occ_residues.label_comp_id _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 1 Y 1 A G 1 ? A G 1 2 1 Y 1 A G 2 ? A G 2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 MG MG MG N N 114 U OP3 O N N 115 U P P N N 116 U OP1 O N N 117 U OP2 O N N 118 U "O5'" O N N 119 U "C5'" C N N 120 U "C4'" C N R 121 U "O4'" O N N 122 U "C3'" C N S 123 U "O3'" O N N 124 U "C2'" C N R 125 U "O2'" O N N 126 U "C1'" C N R 127 U N1 N N N 128 U C2 C N N 129 U O2 O N N 130 U N3 N N N 131 U C4 C N N 132 U O4 O N N 133 U C5 C N N 134 U C6 C N N 135 U HOP3 H N N 136 U HOP2 H N N 137 U "H5'" H N N 138 U "H5''" H N N 139 U "H4'" H N N 140 U "H3'" H N N 141 U "HO3'" H N N 142 U "H2'" H N N 143 U "HO2'" H N N 144 U "H1'" H N N 145 U H3 H N N 146 U H5 H N N 147 U H6 H N N 148 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 U OP3 P sing N N 118 U OP3 HOP3 sing N N 119 U P OP1 doub N N 120 U P OP2 sing N N 121 U P "O5'" sing N N 122 U OP2 HOP2 sing N N 123 U "O5'" "C5'" sing N N 124 U "C5'" "C4'" sing N N 125 U "C5'" "H5'" sing N N 126 U "C5'" "H5''" sing N N 127 U "C4'" "O4'" sing N N 128 U "C4'" "C3'" sing N N 129 U "C4'" "H4'" sing N N 130 U "O4'" "C1'" sing N N 131 U "C3'" "O3'" sing N N 132 U "C3'" "C2'" sing N N 133 U "C3'" "H3'" sing N N 134 U "O3'" "HO3'" sing N N 135 U "C2'" "O2'" sing N N 136 U "C2'" "C1'" sing N N 137 U "C2'" "H2'" sing N N 138 U "O2'" "HO2'" sing N N 139 U "C1'" N1 sing N N 140 U "C1'" "H1'" sing N N 141 U N1 C2 sing N N 142 U N1 C6 sing N N 143 U C2 O2 doub N N 144 U C2 N3 sing N N 145 U N3 C4 sing N N 146 U N3 H3 sing N N 147 U C4 O4 doub N N 148 U C4 C5 sing N N 149 U C5 C6 doub N N 150 U C5 H5 sing N N 151 U C6 H6 sing N N 152 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7U4A 'double helix' 7U4A 'a-form double helix' 7U4A 'hairpin loop' 7U4A tetraloop 7U4A 'bulge loop' 7U4A 'mismatched base pair' 7U4A 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 3 1_555 A C 44 1_555 -0.180 -0.145 0.641 10.434 3.195 -0.519 1 A_G3:C44_A A 3 ? A 44 ? 19 1 1 A C 23 1_555 A G 43 1_555 0.187 -0.188 0.625 -2.024 -1.928 0.856 2 A_C23:G43_A A 23 ? A 43 ? 19 1 1 A A 24 1_555 A U 42 1_555 0.073 -0.078 0.327 2.517 3.850 -1.029 3 A_A24:U42_A A 24 ? A 42 ? 20 1 1 A C 25 1_555 A G 41 1_555 0.182 -0.134 0.082 4.485 -1.170 -0.433 4 A_C25:G41_A A 25 ? A 41 ? 19 1 1 A A 26 1_555 A U 40 1_555 0.122 -0.122 0.510 5.882 5.068 -0.101 5 A_A26:U40_A A 26 ? A 40 ? 20 1 1 A G 27 1_555 A C 39 1_555 -0.154 -0.118 0.404 6.889 -0.537 0.532 6 A_G27:C39_A A 27 ? A 39 ? 19 1 1 A U 28 1_555 A G 38 1_555 1.945 -0.437 0.118 -3.600 -6.491 -4.329 7 A_U28:G38_A A 28 ? A 38 ? 28 1 1 A U 29 1_555 A A 36 1_555 4.134 -2.575 -1.271 -6.525 -2.429 -89.026 8 A_U29:A36_A A 29 ? A 36 ? 24 4 1 A C 54 1_555 A G 34 1_555 0.190 -0.143 -0.455 -1.132 0.222 0.984 9 A_C54:G34_A A 54 ? A 34 ? 19 1 1 A U 55 1_555 A G 33 1_555 1.606 -0.432 -0.434 4.431 -3.733 1.246 10 A_U55:G33_A A 55 ? A 33 ? 28 1 1 A C 56 1_555 A G 32 1_555 0.188 -0.137 -0.216 2.089 -2.484 0.102 11 A_C56:G32_A A 56 ? A 32 ? 19 1 1 A U 57 1_555 A G 31 1_555 2.045 -0.522 -0.163 4.729 -3.697 -5.050 12 A_U57:G31_A A 57 ? A 31 ? 28 1 1 A C 58 1_555 A G 71 1_555 0.166 -0.085 0.003 2.771 -3.685 1.668 13 A_C58:G71_A A 58 ? A 71 ? 19 1 1 A C 59 1_555 A G 70 1_555 0.162 -0.137 0.228 -0.585 -6.302 2.106 14 A_C59:G70_A A 59 ? A 70 ? 19 1 1 A C 60 1_555 A G 69 1_555 0.191 -0.097 0.024 -1.752 -5.366 3.526 15 A_C60:G69_A A 60 ? A 69 ? 19 1 1 A A 61 1_555 A U 68 1_555 -0.021 -0.110 -0.256 -6.122 -5.880 1.862 16 A_A61:U68_A A 61 ? A 68 ? 20 1 1 A C 62 1_555 A G 67 1_555 0.177 -0.132 0.055 -0.813 1.844 0.814 17 A_C62:G67_A A 62 ? A 67 ? 19 1 1 A G 63 1_555 A A 66 1_555 7.225 -5.220 0.421 19.783 5.267 -19.517 18 A_G63:A66_A A 63 ? A 66 ? ? 10 1 A G 18 1_555 A C 13 1_555 -0.166 -0.142 0.210 1.098 6.660 1.161 19 A_G18:C13_A A 18 ? A 13 ? 19 1 1 A U 19 1_555 A G 12 1_555 1.845 -0.356 -0.136 4.736 -1.952 2.968 20 A_U19:G12_A A 19 ? A 12 ? 28 1 1 A C 20 1_555 A G 11 1_555 0.152 -0.166 0.437 -1.690 -9.937 -0.471 21 A_C20:G11_A A 20 ? A 11 ? 19 1 1 A G 21 1_555 A C 10 1_555 -0.125 -0.126 -0.394 11.234 6.491 -1.577 22 A_G21:C10_A A 21 ? A 10 ? 19 1 1 A G 46 1_555 A C 9 1_555 -0.146 -0.193 -0.210 2.534 -1.981 0.267 23 A_G46:C9_A A 46 ? A 9 ? 19 1 1 A C 47 1_555 A G 8 1_555 0.177 -0.107 0.232 1.921 -5.184 -0.765 24 A_C47:G8_A A 47 ? A 8 ? 19 1 1 A C 48 1_555 A G 7 1_555 0.267 -0.610 0.192 1.320 -3.648 1.529 25 A_C48:G7_A A 48 ? A 7 ? 22 1 1 A U 49 1_555 A A 6 1_555 -0.066 -0.153 0.299 1.116 -8.438 -0.503 26 A_U49:A6_A A 49 ? A 6 ? 20 1 1 A G 50 1_555 A C 5 1_555 -0.151 -0.049 -0.038 3.112 3.816 -4.881 27 A_G50:C5_A A 50 ? A 5 ? 19 1 1 A U 51 1_555 A A 37 1_555 -0.092 -1.263 0.228 6.213 -7.245 -164.193 28 A_U51:A37_A A 51 ? A 37 ? 21 2 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 3 1_555 A C 44 1_555 A C 23 1_555 A G 43 1_555 -1.728 -1.809 3.537 -4.137 2.269 50.098 -2.305 1.710 3.580 2.673 4.873 50.305 1 AA_G3C23:G43C44_AA A 3 ? A 44 ? A 23 ? A 43 ? 1 A C 23 1_555 A G 43 1_555 A A 24 1_555 A U 42 1_555 -0.743 -1.815 2.858 2.731 7.226 31.655 -4.251 1.709 2.327 13.007 -4.916 32.560 2 AA_C23A24:U42G43_AA A 23 ? A 43 ? A 24 ? A 42 ? 1 A A 24 1_555 A U 42 1_555 A C 25 1_555 A G 41 1_555 0.490 -1.772 3.228 2.600 4.697 28.913 -4.450 -0.435 2.942 9.306 -5.151 29.397 3 AA_A24C25:G41U42_AA A 24 ? A 42 ? A 25 ? A 41 ? 1 A C 25 1_555 A G 41 1_555 A A 26 1_555 A U 40 1_555 -0.202 -1.594 3.069 -1.184 11.445 33.733 -4.047 0.182 2.423 19.047 1.971 35.588 4 AA_C25A26:U40G41_AA A 25 ? A 41 ? A 26 ? A 40 ? 1 A A 26 1_555 A U 40 1_555 A G 27 1_555 A C 39 1_555 0.568 -2.096 3.040 2.042 3.591 30.210 -4.629 -0.714 2.810 6.850 -3.894 30.485 5 AA_A26G27:C39U40_AA A 26 ? A 40 ? A 27 ? A 39 ? 1 A G 27 1_555 A C 39 1_555 A U 28 1_555 A G 38 1_555 0.475 -1.821 3.420 4.996 1.022 44.691 -2.477 -0.149 3.411 1.339 -6.545 44.966 6 AA_G27U28:G38C39_AA A 27 ? A 39 ? A 28 ? A 38 ? 1 A U 28 1_555 A G 38 1_555 A U 29 1_555 A A 36 1_555 -3.557 -2.522 3.311 21.778 4.638 59.119 -2.591 4.214 1.844 4.529 -21.271 62.817 7 AA_U28U29:A36G38_AA A 28 ? A 38 ? A 29 ? A 36 ? 1 A U 29 1_555 A A 36 1_555 A C 54 1_555 A G 34 1_555 0.993 -1.340 6.511 -25.259 23.354 86.804 -1.811 -1.642 5.725 16.465 17.808 92.096 8 AA_U29C54:G34A36_AA A 29 ? A 36 ? A 54 ? A 34 ? 1 A C 54 1_555 A G 34 1_555 A U 55 1_555 A G 33 1_555 0.231 -1.581 3.163 1.434 4.117 36.781 -3.011 -0.182 2.981 6.497 -2.263 37.030 9 AA_C54U55:G33G34_AA A 54 ? A 34 ? A 55 ? A 33 ? 1 A U 55 1_555 A G 33 1_555 A C 56 1_555 A G 32 1_555 -1.538 -2.300 3.151 -1.595 17.026 23.708 -7.389 2.791 1.331 36.043 3.377 29.160 10 AA_U55C56:G32G33_AA A 55 ? A 33 ? A 56 ? A 32 ? 1 A C 56 1_555 A G 32 1_555 A U 57 1_555 A G 31 1_555 0.554 -1.303 3.220 3.034 2.902 41.214 -2.145 -0.467 3.156 4.109 -4.296 41.418 11 AA_C56U57:G31G32_AA A 56 ? A 32 ? A 57 ? A 31 ? 1 A U 57 1_555 A G 31 1_555 A C 58 1_555 A G 71 1_555 -4.954 -2.880 3.211 -4.339 4.325 -15.494 7.331 -19.724 2.450 -15.288 -15.335 -16.654 12 AA_U57C58:G71G31_AA A 57 ? A 31 ? A 58 ? A 71 ? 1 A C 58 1_555 A G 71 1_555 A C 59 1_555 A G 70 1_555 -0.521 -2.091 3.188 -4.699 8.841 32.431 -4.871 0.211 2.593 15.378 8.174 33.902 13 AA_C58C59:G70G71_AA A 58 ? A 71 ? A 59 ? A 70 ? 1 A C 59 1_555 A G 70 1_555 A C 60 1_555 A G 69 1_555 0.088 -2.022 3.138 1.855 3.748 30.277 -4.522 0.173 2.873 7.133 -3.530 30.557 14 AA_C59C60:G69G70_AA A 59 ? A 70 ? A 60 ? A 69 ? 1 A C 60 1_555 A G 69 1_555 A A 61 1_555 A U 68 1_555 -0.699 -1.874 3.157 0.326 12.135 30.631 -5.093 1.282 2.264 21.920 -0.588 32.895 15 AA_C60A61:U68G69_AA A 60 ? A 69 ? A 61 ? A 68 ? 1 A A 61 1_555 A U 68 1_555 A C 62 1_555 A G 67 1_555 -0.002 -1.531 3.177 -3.460 2.947 32.639 -3.177 -0.556 3.016 5.213 6.120 32.945 16 AA_A61C62:G67U68_AA A 61 ? A 68 ? A 62 ? A 67 ? 1 A C 62 1_555 A G 67 1_555 A G 63 1_555 A A 66 1_555 -2.511 -0.943 2.741 -4.283 0.435 49.460 -1.151 2.718 2.928 0.519 5.108 49.636 17 AA_C62G63:A66G67_AA A 62 ? A 67 ? A 63 ? A 66 ? 1 A G 18 1_555 A C 13 1_555 A U 19 1_555 A G 12 1_555 0.321 -1.541 3.127 3.675 3.075 39.887 -2.574 -0.073 3.022 4.488 -5.364 40.162 18 AA_G18U19:G12C13_AA A 18 ? A 13 ? A 19 ? A 12 ? 1 A U 19 1_555 A G 12 1_555 A C 20 1_555 A G 11 1_555 0.010 -1.929 3.236 3.451 6.615 31.737 -4.512 0.542 2.774 11.891 -6.203 32.580 19 AA_U19C20:G11G12_AA A 19 ? A 12 ? A 20 ? A 11 ? 1 A C 20 1_555 A G 11 1_555 A G 21 1_555 A C 10 1_555 0.008 -1.577 2.823 7.781 19.111 18.730 -6.378 1.244 0.840 44.647 -18.179 27.799 20 AA_C20G21:C10G11_AA A 20 ? A 11 ? A 21 ? A 10 ? 1 A G 21 1_555 A C 10 1_555 A G 46 1_555 A C 9 1_555 -1.735 -0.248 3.417 -10.858 4.508 43.300 -0.779 1.185 3.685 5.979 14.401 44.794 21 AA_G21G46:C9C10_AA A 21 ? A 10 ? A 46 ? A 9 ? 1 A G 46 1_555 A C 9 1_555 A C 47 1_555 A G 8 1_555 0.387 -1.084 3.247 -4.702 1.615 32.857 -2.159 -1.445 3.108 2.835 8.253 33.220 22 AA_G46C47:G8C9_AA A 46 ? A 9 ? A 47 ? A 8 ? 1 A C 47 1_555 A G 8 1_555 A C 48 1_555 A G 7 1_555 -0.034 -1.853 3.067 -0.086 2.645 35.676 -3.366 0.044 2.926 4.310 0.139 35.771 23 AA_C47C48:G7G8_AA A 47 ? A 8 ? A 48 ? A 7 ? 1 A C 48 1_555 A G 7 1_555 A U 49 1_555 A A 6 1_555 0.254 -1.492 3.263 2.887 2.745 31.551 -3.217 0.054 3.135 5.023 -5.284 31.796 24 AA_C48U49:A6G7_AA A 48 ? A 7 ? A 49 ? A 6 ? 1 A U 49 1_555 A A 6 1_555 A G 50 1_555 A C 5 1_555 -0.362 -1.411 2.991 2.367 11.378 34.250 -3.637 0.867 2.387 18.665 -3.883 36.112 25 AA_U49G50:C5A6_AA A 49 ? A 6 ? A 50 ? A 5 ? 1 A G 50 1_555 A C 5 1_555 A U 51 1_555 A A 37 1_555 -1.166 -0.518 3.394 2.995 1.031 101.347 -0.351 0.800 3.365 0.666 -1.936 101.383 26 AA_G50U51:A37C5_AA A 50 ? A 5 ? A 51 ? A 37 ? # _pdbx_audit_support.funding_organization 'University of North Carolina at Chapel Hill' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id MG _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id MG _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'MAGNESIUM ION' MG 3 water HOH # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _space_group.name_H-M_alt 'P 1 21 1' _space_group.name_Hall 'P 2yb' _space_group.IT_number 4 _space_group.crystal_system monoclinic _space_group.id 1 #