data_7UJZ # _entry.id 7UJZ # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.377 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7UJZ pdb_00007ujz 10.2210/pdb7ujz/pdb WWPDB D_1000264305 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7UJZ _pdbx_database_status.recvd_initial_deposition_date 2022-03-31 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Lu, B.' 1 0000-0001-6424-2197 'Vecchioni, S.' 2 0000-0001-8243-650X 'Seeman, N.C.' 3 0000-0002-9680-4649 'Sha, R.' 4 0000-0002-0807-734X 'Ohayon, Y.P.' 5 0000-0001-7500-4282 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev J.Am.Chem.Soc. _citation.journal_id_ASTM JACSAT _citation.journal_id_CSD ? _citation.journal_id_ISSN 1520-5126 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 145 _citation.language ? _citation.page_first 17945 _citation.page_last 17953 _citation.title 'Heterobimetallic Base Pair Programming in Designer 3D DNA Crystals.' _citation.year 2023 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1021/jacs.3c05478 _citation.pdbx_database_id_PubMed 37530628 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Lu, B.' 1 ? primary 'Ohayon, Y.P.' 2 ? primary 'Woloszyn, K.' 3 ? primary 'Yang, C.F.' 4 ? primary 'Yoder, J.B.' 5 ? primary 'Rothschild, L.J.' 6 ? primary 'Wind, S.J.' 7 ? primary 'Hendrickson, W.A.' 8 ? primary 'Mao, C.' 9 ? primary 'Seeman, N.C.' 10 ? primary 'Canary, J.W.' 11 ? primary 'Sha, R.' 12 ? primary 'Vecchioni, S.' 13 ? # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 7UJZ _cell.details ? _cell.formula_units_Z ? _cell.length_a 106.081 _cell.length_a_esd ? _cell.length_b 106.081 _cell.length_b_esd ? _cell.length_c 91.646 _cell.length_c_esd ? _cell.volume 893139.622 _cell.volume_esd ? _cell.Z_PDB 9 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7UJZ _symmetry.cell_setting ? _symmetry.Int_Tables_number 146 _symmetry.space_group_name_Hall 'R 3' _symmetry.space_group_name_H-M 'H 3' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*GP*AP*GP*CP*AP*GP*CP*CP*TP*GP*TP*TP*TP*GP*GP*AP*CP*AP*TP*CP*A)-3') ; 6463.185 1 ? ? ? ? 2 polymer syn ;DNA (5'-D(P*CP*CP*AP*TP*AP*CP*A)-3') ; 2066.401 1 ? ? ? ? 3 polymer syn ;DNA (5'-D(P*GP*GP*CP*TP*GP*CP*T)-3') ; 2129.409 1 ? ? ? ? 4 polymer syn ;DNA (5'-D(P*CP*TP*GP*AP*TP*GP*T)-3') ; 2128.421 1 ? ? ? ? 5 non-polymer syn 'MERCURY (II) ION' 200.590 1 ? ? ? ? 6 non-polymer syn 'CADMIUM ION' 112.411 1 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no no ;(DG)(DA)(DG)(DC)(DA)(DG)(DC)(DC)(DT)(DG)(DT)(DT)(DT)(DG)(DG)(DA)(DC)(DA)(DT)(DC) (DA) ; GAGCAGCCTGTTTGGACATCA A ? 2 polydeoxyribonucleotide no no '(DC)(DC)(DA)(DT)(DA)(DC)(DA)' CCATACA B ? 3 polydeoxyribonucleotide no no '(DG)(DG)(DC)(DT)(DG)(DC)(DT)' GGCTGCT C ? 4 polydeoxyribonucleotide no no '(DC)(DT)(DG)(DA)(DT)(DG)(DT)' CTGATGT D ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DA n 1 3 DG n 1 4 DC n 1 5 DA n 1 6 DG n 1 7 DC n 1 8 DC n 1 9 DT n 1 10 DG n 1 11 DT n 1 12 DT n 1 13 DT n 1 14 DG n 1 15 DG n 1 16 DA n 1 17 DC n 1 18 DA n 1 19 DT n 1 20 DC n 1 21 DA n 2 1 DC n 2 2 DC n 2 3 DA n 2 4 DT n 2 5 DA n 2 6 DC n 2 7 DA n 3 1 DG n 3 2 DG n 3 3 DC n 3 4 DT n 3 5 DG n 3 6 DC n 3 7 DT n 4 1 DC n 4 2 DT n 4 3 DG n 4 4 DA n 4 5 DT n 4 6 DG n 4 7 DT n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 21 'synthetic construct' ? 32630 ? 2 1 sample 1 7 'synthetic construct' ? 32630 ? 3 1 sample 1 7 'synthetic construct' ? 32630 ? 4 1 sample 1 7 'synthetic construct' ? 32630 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 7UJZ 7UJZ ? 1 ? 1 2 PDB 7UJZ 7UJZ ? 2 ? 1 3 PDB 7UJZ 7UJZ ? 3 ? 1 4 PDB 7UJZ 7UJZ ? 4 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 7UJZ A 1 ? 21 ? 7UJZ 1 ? 21 ? 1 21 2 2 7UJZ B 1 ? 7 ? 7UJZ 1 ? 7 ? 1 7 3 3 7UJZ C 1 ? 7 ? 7UJZ 8 ? 14 ? 8 14 4 4 7UJZ D 1 ? 7 ? 7UJZ 1 ? 7 ? 1 7 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight CD non-polymer . 'CADMIUM ION' ? 'Cd 2' 112.411 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 HG non-polymer . 'MERCURY (II) ION' ? 'Hg 2' 200.590 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7UJZ _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 7.76 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 84.15 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 11 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details '338-293 at 0.4/hr' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '400 mM Tris, 1.25 M magnesium sulfate, 72 uM mercury(II) chloride, 36 uM cadmium(II) chloride' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER2 X 9M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2021-12-11 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.00743 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 17-ID' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.00743 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 17-ID _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate 270.26 _reflns.entry_id 7UJZ _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.94 _reflns.d_resolution_low 64.88 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 4724 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 87.9 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 10.7 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 11.1 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.998 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 3.94 _reflns_shell.d_res_low 4.29 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 396 _reflns_shell.percent_possible_all ? _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.183 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 303.20 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7UJZ _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.94 _refine.ls_d_res_low 41.07 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 4599 _refine.ls_number_reflns_R_free 257 _refine.ls_number_reflns_R_work 4342 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 67.91 _refine.ls_percent_reflns_R_free 5.59 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2178 _refine.ls_R_factor_R_free 0.2368 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2166 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.96 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct SAD _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 39.8430 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.0000 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 3.94 _refine_hist.d_res_low 41.07 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 860 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 858 _refine_hist.pdbx_number_atoms_ligand 2 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0084 ? 958 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.0694 ? 1471 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0521 ? 167 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0045 ? 42 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 38.9758 ? 407 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free 'X-RAY DIFFRACTION' 3.94 4.95 . . 94 1246 39.95 . . . 0.4295 . 0.3968 . . . . . . . . . . . 'X-RAY DIFFRACTION' 4.97 41.07 . . 163 3096 95.68 . . . 0.2173 . 0.2043 . . . . . . . . . . . # _struct.entry_id 7UJZ _struct.title '[T:Cd2+/Hg2+:T--pH 11] Metal-mediated DNA base pair in tensegrity triangle' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7UJZ _struct_keywords.text 'Tensegrity triangle, self-assembling crystal, metal-mediated mismatch, DNA' _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 5 ? F N N 6 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A DT 12 O4 ? ? ? 1_555 E HG . HG ? ? A DT 12 B HG 101 1_555 ? ? ? ? ? ? ? 3.017 ? ? metalc2 metalc ? ? B DT 4 N3 ? ? ? 1_555 E HG . HG ? ? B DT 4 B HG 101 1_555 ? ? ? ? ? ? ? 2.178 ? ? metalc3 metalc ? ? B DT 4 O4 ? ? ? 1_555 E HG . HG ? ? B DT 4 B HG 101 1_555 ? ? ? ? ? ? ? 2.529 ? ? metalc4 metalc ? ? B DT 4 O4 ? ? ? 1_555 F CD . CD ? ? B DT 4 B CD 102 1_555 ? ? ? ? ? ? ? 2.555 ? ? hydrog1 hydrog ? ? A DA 2 N1 ? ? ? 1_555 C DT 7 N3 ? ? A DA 2 C DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DA 2 N6 ? ? ? 1_555 C DT 7 O4 ? ? A DA 2 C DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DG 3 N1 ? ? ? 1_555 C DC 6 N3 ? ? A DG 3 C DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DG 3 N2 ? ? ? 1_555 C DC 6 O2 ? ? A DG 3 C DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DG 3 O6 ? ? ? 1_555 C DC 6 N4 ? ? A DG 3 C DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DC 4 N4 ? ? ? 1_555 C DG 5 O6 ? ? A DC 4 C DG 12 1_555 ? ? ? ? ? ? 'DC-DG PAIR' ? ? ? hydrog7 hydrog ? ? A DA 5 N1 ? ? ? 1_555 C DT 4 N3 ? ? A DA 5 C DT 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DA 5 N6 ? ? ? 1_555 C DT 4 O4 ? ? A DA 5 C DT 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DG 6 N1 ? ? ? 1_555 C DC 3 N3 ? ? A DG 6 C DC 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DG 6 N2 ? ? ? 1_555 C DC 3 O2 ? ? A DG 6 C DC 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DG 6 O6 ? ? ? 1_555 C DC 3 N4 ? ? A DG 6 C DC 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DC 7 N3 ? ? ? 1_555 C DG 2 N1 ? ? A DC 7 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DC 7 N4 ? ? ? 1_555 C DG 2 O6 ? ? A DC 7 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DC 7 O2 ? ? ? 1_555 C DG 2 N2 ? ? A DC 7 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DC 8 N3 ? ? ? 1_555 C DG 1 N1 ? ? A DC 8 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 8 N4 ? ? ? 1_555 C DG 1 O6 ? ? A DC 8 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DC 8 O2 ? ? ? 1_555 C DG 1 N2 ? ? A DC 8 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DT 9 N3 ? ? ? 1_555 B DA 7 N1 ? ? A DT 9 B DA 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DT 9 O4 ? ? ? 1_555 B DA 7 N6 ? ? A DT 9 B DA 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DG 10 N1 ? ? ? 1_555 B DC 6 N3 ? ? A DG 10 B DC 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DG 10 N2 ? ? ? 1_555 B DC 6 O2 ? ? A DG 10 B DC 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DG 10 O6 ? ? ? 1_555 B DC 6 N4 ? ? A DG 10 B DC 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DT 11 N3 ? ? ? 1_555 B DA 5 N1 ? ? A DT 11 B DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DT 11 O4 ? ? ? 1_555 B DA 5 N6 ? ? A DT 11 B DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DT 13 N3 ? ? ? 1_555 B DA 3 N1 ? ? A DT 13 B DA 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DT 13 O4 ? ? ? 1_555 B DA 3 N6 ? ? A DT 13 B DA 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DG 14 N1 ? ? ? 1_555 B DC 2 N3 ? ? A DG 14 B DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DG 14 N2 ? ? ? 1_555 B DC 2 O2 ? ? A DG 14 B DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DG 14 O6 ? ? ? 1_555 B DC 2 N4 ? ? A DG 14 B DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A DG 15 N1 ? ? ? 1_555 B DC 1 N3 ? ? A DG 15 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A DG 15 N2 ? ? ? 1_555 B DC 1 O2 ? ? A DG 15 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A DG 15 O6 ? ? ? 1_555 B DC 1 N4 ? ? A DG 15 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DA 16 N1 ? ? ? 1_555 D DT 7 N3 ? ? A DA 16 D DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DA 16 N6 ? ? ? 1_555 D DT 7 O4 ? ? A DA 16 D DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DC 17 N3 ? ? ? 1_555 D DG 6 N1 ? ? A DC 17 D DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DC 17 N4 ? ? ? 1_555 D DG 6 O6 ? ? A DC 17 D DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DC 17 O2 ? ? ? 1_555 D DG 6 N2 ? ? A DC 17 D DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DA 18 N1 ? ? ? 1_555 D DT 5 N3 ? ? A DA 18 D DT 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DA 18 N6 ? ? ? 1_555 D DT 5 O4 ? ? A DA 18 D DT 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DT 19 N3 ? ? ? 1_555 D DA 4 N1 ? ? A DT 19 D DA 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DT 19 O4 ? ? ? 1_555 D DA 4 N6 ? ? A DT 19 D DA 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DC 20 N3 ? ? ? 1_555 D DG 3 N1 ? ? A DC 20 D DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DC 20 N4 ? ? ? 1_555 D DG 3 O6 ? ? A DC 20 D DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DC 20 O2 ? ? ? 1_555 D DG 3 N2 ? ? A DC 20 D DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A DA 21 N1 ? ? ? 1_555 D DT 2 N3 ? ? A DA 21 D DT 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A DA 21 N6 ? ? ? 1_555 D DT 2 O4 ? ? A DA 21 D DT 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # _atom_sites.entry_id 7UJZ _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.009427 _atom_sites.fract_transf_matrix[1][2] 0.005443 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.010885 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.010912 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source C ? ? 5.96793 ? ? ? 14.89577 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? CD ? ? 47.69958 ? ? ? 5.62611 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? HG ? ? 79.56749 ? ? ? 4.10057 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 6.96715 ? ? ? 11.43723 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 7.96527 ? ? ? 9.05267 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 14.90797 ? ? ? 11.91318 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DA 2 2 2 DA DA A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DC 4 4 4 DC DC A . n A 1 5 DA 5 5 5 DA DA A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DC 7 7 7 DC DC A . n A 1 8 DC 8 8 8 DC DC A . n A 1 9 DT 9 9 9 DT DT A . n A 1 10 DG 10 10 10 DG DG A . n A 1 11 DT 11 11 11 DT DT A . n A 1 12 DT 12 12 12 DT DT A . n A 1 13 DT 13 13 13 DT DT A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DA 16 16 16 DA DA A . n A 1 17 DC 17 17 17 DC DC A . n A 1 18 DA 18 18 18 DA DA A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DC 20 20 20 DC DC A . n A 1 21 DA 21 21 21 DA DA A . n B 2 1 DC 1 1 1 DC DC B . n B 2 2 DC 2 2 2 DC DC B . n B 2 3 DA 3 3 3 DA DA B . n B 2 4 DT 4 4 4 DT DT B . n B 2 5 DA 5 5 5 DA DA B . n B 2 6 DC 6 6 6 DC DC B . n B 2 7 DA 7 7 7 DA DA B . n C 3 1 DG 1 8 8 DG DG C . n C 3 2 DG 2 9 9 DG DG C . n C 3 3 DC 3 10 10 DC DC C . n C 3 4 DT 4 11 11 DT DT C . n C 3 5 DG 5 12 12 DG DG C . n C 3 6 DC 6 13 13 DC DC C . n C 3 7 DT 7 14 14 DT DT C . n D 4 1 DC 1 1 1 DC DC D . n D 4 2 DT 2 2 2 DT DT D . n D 4 3 DG 3 3 3 DG DG D . n D 4 4 DA 4 4 4 DA DA D . n D 4 5 DT 5 5 5 DT DT D . n D 4 6 DG 6 6 6 DG DG D . n D 4 7 DT 7 7 7 DT DT D . n # _pdbx_contact_author.id 3 _pdbx_contact_author.email ncs01@nyu.edu _pdbx_contact_author.name_first Nadrian _pdbx_contact_author.name_last Seeman _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-9680-4649 # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code E 5 HG 1 101 1 HG HG B . F 6 CD 1 102 4 CD CD B . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dodecameric _pdbx_struct_assembly.oligomeric_count 12 # loop_ _pdbx_struct_assembly_gen.assembly_id _pdbx_struct_assembly_gen.oper_expression _pdbx_struct_assembly_gen.asym_id_list 1 1 A,B,C,D,E,F 1 2 A,B,C,D,E,F 1 3 A,B,C,D,E,F # loop_ _pdbx_struct_oper_list.id _pdbx_struct_oper_list.type _pdbx_struct_oper_list.name _pdbx_struct_oper_list.symmetry_operation _pdbx_struct_oper_list.matrix[1][1] _pdbx_struct_oper_list.matrix[1][2] _pdbx_struct_oper_list.matrix[1][3] _pdbx_struct_oper_list.vector[1] _pdbx_struct_oper_list.matrix[2][1] _pdbx_struct_oper_list.matrix[2][2] _pdbx_struct_oper_list.matrix[2][3] _pdbx_struct_oper_list.vector[2] _pdbx_struct_oper_list.matrix[3][1] _pdbx_struct_oper_list.matrix[3][2] _pdbx_struct_oper_list.matrix[3][3] _pdbx_struct_oper_list.vector[3] 1 'identity operation' 1_555 x,y,z 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 2 'crystal symmetry operation' 2_555 -y,x-y,z -0.5000000000 -0.8660254038 0.0000000000 0.0000000000 0.8660254038 -0.5000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 3 'crystal symmetry operation' 3_555 -x+y,-x,z -0.5000000000 0.8660254038 0.0000000000 0.0000000000 -0.8660254038 -0.5000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 O4 ? A DT 12 ? A DT 12 ? 1_555 HG ? E HG . ? B HG 101 ? 1_555 N3 ? B DT 4 ? B DT 4 ? 1_555 135.3 ? 2 O4 ? A DT 12 ? A DT 12 ? 1_555 HG ? E HG . ? B HG 101 ? 1_555 O4 ? B DT 4 ? B DT 4 ? 1_555 80.9 ? 3 N3 ? B DT 4 ? B DT 4 ? 1_555 HG ? E HG . ? B HG 101 ? 1_555 O4 ? B DT 4 ? B DT 4 ? 1_555 56.8 ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-04-05 2 'Structure model' 1 1 2023-08-09 3 'Structure model' 1 2 2023-08-16 4 'Structure model' 1 3 2023-08-30 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Author supporting evidence' 3 3 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' chem_comp_atom 4 3 'Structure model' chem_comp_bond 5 3 'Structure model' pdbx_audit_support 6 4 'Structure model' citation 7 4 'Structure model' citation_author # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_ASTM' 4 2 'Structure model' '_citation.journal_id_CSD' 5 2 'Structure model' '_citation.journal_id_ISSN' 6 2 'Structure model' '_citation.pdbx_database_id_DOI' 7 2 'Structure model' '_citation.pdbx_database_id_PubMed' 8 2 'Structure model' '_citation.title' 9 2 'Structure model' '_citation.year' 10 3 'Structure model' '_pdbx_audit_support.country' 11 4 'Structure model' '_citation.journal_volume' 12 4 'Structure model' '_citation.page_first' 13 4 'Structure model' '_citation.page_last' 14 4 'Structure model' '_citation_author.identifier_ORCID' # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 -y,x-y,z 3 -x+y,-x,z 4 x+1/3,y+2/3,z+2/3 5 -y+1/3,x-y+2/3,z+2/3 6 -x+y+1/3,-x+2/3,z+2/3 7 x+2/3,y+1/3,z+1/3 8 -y+2/3,x-y+1/3,z+1/3 9 -x+y+2/3,-x+1/3,z+1/3 # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.19.2_4158 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? autoPROC ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? STARANISO ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? AutoSol ? ? ? . 4 # _pdbx_entry_details.entry_id 7UJZ _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 "O3'" A DT 13 ? ? "C3'" A DT 13 ? ? 1.375 1.419 -0.044 0.006 N 2 1 P D DC 1 ? ? OP3 D DC 1 ? ? 1.481 1.607 -0.126 0.012 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A DA 2 ? ? "C1'" A DA 2 ? ? N9 A DA 2 ? ? 112.55 108.30 4.25 0.30 N 2 1 "O4'" A DC 7 ? ? "C1'" A DC 7 ? ? N1 A DC 7 ? ? 110.94 108.30 2.64 0.30 N 3 1 "O4'" A DT 11 ? ? "C1'" A DT 11 ? ? N1 A DT 11 ? ? 114.23 108.30 5.93 0.30 N 4 1 "O4'" A DT 12 ? ? "C1'" A DT 12 ? ? N1 A DT 12 ? ? 111.09 108.30 2.79 0.30 N 5 1 "O4'" B DT 4 ? ? "C1'" B DT 4 ? ? N1 B DT 4 ? ? 110.69 108.30 2.39 0.30 N 6 1 "O4'" B DA 7 ? ? "C1'" B DA 7 ? ? N9 B DA 7 ? ? 110.83 108.30 2.53 0.30 N 7 1 "O4'" D DC 1 ? ? "C1'" D DC 1 ? ? N1 D DC 1 ? ? 111.20 108.30 2.90 0.30 N 8 1 "O4'" D DG 3 ? ? "C1'" D DG 3 ? ? N9 D DG 3 ? ? 110.65 108.30 2.35 0.30 N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal CD CD CD N N 1 DA OP3 O N N 2 DA P P N N 3 DA OP1 O N N 4 DA OP2 O N N 5 DA "O5'" O N N 6 DA "C5'" C N N 7 DA "C4'" C N R 8 DA "O4'" O N N 9 DA "C3'" C N S 10 DA "O3'" O N N 11 DA "C2'" C N N 12 DA "C1'" C N R 13 DA N9 N Y N 14 DA C8 C Y N 15 DA N7 N Y N 16 DA C5 C Y N 17 DA C6 C Y N 18 DA N6 N N N 19 DA N1 N Y N 20 DA C2 C Y N 21 DA N3 N Y N 22 DA C4 C Y N 23 DA HOP3 H N N 24 DA HOP2 H N N 25 DA "H5'" H N N 26 DA "H5''" H N N 27 DA "H4'" H N N 28 DA "H3'" H N N 29 DA "HO3'" H N N 30 DA "H2'" H N N 31 DA "H2''" H N N 32 DA "H1'" H N N 33 DA H8 H N N 34 DA H61 H N N 35 DA H62 H N N 36 DA H2 H N N 37 DC OP3 O N N 38 DC P P N N 39 DC OP1 O N N 40 DC OP2 O N N 41 DC "O5'" O N N 42 DC "C5'" C N N 43 DC "C4'" C N R 44 DC "O4'" O N N 45 DC "C3'" C N S 46 DC "O3'" O N N 47 DC "C2'" C N N 48 DC "C1'" C N R 49 DC N1 N N N 50 DC C2 C N N 51 DC O2 O N N 52 DC N3 N N N 53 DC C4 C N N 54 DC N4 N N N 55 DC C5 C N N 56 DC C6 C N N 57 DC HOP3 H N N 58 DC HOP2 H N N 59 DC "H5'" H N N 60 DC "H5''" H N N 61 DC "H4'" H N N 62 DC "H3'" H N N 63 DC "HO3'" H N N 64 DC "H2'" H N N 65 DC "H2''" H N N 66 DC "H1'" H N N 67 DC H41 H N N 68 DC H42 H N N 69 DC H5 H N N 70 DC H6 H N N 71 DG OP3 O N N 72 DG P P N N 73 DG OP1 O N N 74 DG OP2 O N N 75 DG "O5'" O N N 76 DG "C5'" C N N 77 DG "C4'" C N R 78 DG "O4'" O N N 79 DG "C3'" C N S 80 DG "O3'" O N N 81 DG "C2'" C N N 82 DG "C1'" C N R 83 DG N9 N Y N 84 DG C8 C Y N 85 DG N7 N Y N 86 DG C5 C Y N 87 DG C6 C N N 88 DG O6 O N N 89 DG N1 N N N 90 DG C2 C N N 91 DG N2 N N N 92 DG N3 N N N 93 DG C4 C Y N 94 DG HOP3 H N N 95 DG HOP2 H N N 96 DG "H5'" H N N 97 DG "H5''" H N N 98 DG "H4'" H N N 99 DG "H3'" H N N 100 DG "HO3'" H N N 101 DG "H2'" H N N 102 DG "H2''" H N N 103 DG "H1'" H N N 104 DG H8 H N N 105 DG H1 H N N 106 DG H21 H N N 107 DG H22 H N N 108 DT OP3 O N N 109 DT P P N N 110 DT OP1 O N N 111 DT OP2 O N N 112 DT "O5'" O N N 113 DT "C5'" C N N 114 DT "C4'" C N R 115 DT "O4'" O N N 116 DT "C3'" C N S 117 DT "O3'" O N N 118 DT "C2'" C N N 119 DT "C1'" C N R 120 DT N1 N N N 121 DT C2 C N N 122 DT O2 O N N 123 DT N3 N N N 124 DT C4 C N N 125 DT O4 O N N 126 DT C5 C N N 127 DT C7 C N N 128 DT C6 C N N 129 DT HOP3 H N N 130 DT HOP2 H N N 131 DT "H5'" H N N 132 DT "H5''" H N N 133 DT "H4'" H N N 134 DT "H3'" H N N 135 DT "HO3'" H N N 136 DT "H2'" H N N 137 DT "H2''" H N N 138 DT "H1'" H N N 139 DT H3 H N N 140 DT H71 H N N 141 DT H72 H N N 142 DT H73 H N N 143 DT H6 H N N 144 HG HG HG N N 145 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal DA OP3 P sing N N 1 DA OP3 HOP3 sing N N 2 DA P OP1 doub N N 3 DA P OP2 sing N N 4 DA P "O5'" sing N N 5 DA OP2 HOP2 sing N N 6 DA "O5'" "C5'" sing N N 7 DA "C5'" "C4'" sing N N 8 DA "C5'" "H5'" sing N N 9 DA "C5'" "H5''" sing N N 10 DA "C4'" "O4'" sing N N 11 DA "C4'" "C3'" sing N N 12 DA "C4'" "H4'" sing N N 13 DA "O4'" "C1'" sing N N 14 DA "C3'" "O3'" sing N N 15 DA "C3'" "C2'" sing N N 16 DA "C3'" "H3'" sing N N 17 DA "O3'" "HO3'" sing N N 18 DA "C2'" "C1'" sing N N 19 DA "C2'" "H2'" sing N N 20 DA "C2'" "H2''" sing N N 21 DA "C1'" N9 sing N N 22 DA "C1'" "H1'" sing N N 23 DA N9 C8 sing Y N 24 DA N9 C4 sing Y N 25 DA C8 N7 doub Y N 26 DA C8 H8 sing N N 27 DA N7 C5 sing Y N 28 DA C5 C6 sing Y N 29 DA C5 C4 doub Y N 30 DA C6 N6 sing N N 31 DA C6 N1 doub Y N 32 DA N6 H61 sing N N 33 DA N6 H62 sing N N 34 DA N1 C2 sing Y N 35 DA C2 N3 doub Y N 36 DA C2 H2 sing N N 37 DA N3 C4 sing Y N 38 DC OP3 P sing N N 39 DC OP3 HOP3 sing N N 40 DC P OP1 doub N N 41 DC P OP2 sing N N 42 DC P "O5'" sing N N 43 DC OP2 HOP2 sing N N 44 DC "O5'" "C5'" sing N N 45 DC "C5'" "C4'" sing N N 46 DC "C5'" "H5'" sing N N 47 DC "C5'" "H5''" sing N N 48 DC "C4'" "O4'" sing N N 49 DC "C4'" "C3'" sing N N 50 DC "C4'" "H4'" sing N N 51 DC "O4'" "C1'" sing N N 52 DC "C3'" "O3'" sing N N 53 DC "C3'" "C2'" sing N N 54 DC "C3'" "H3'" sing N N 55 DC "O3'" "HO3'" sing N N 56 DC "C2'" "C1'" sing N N 57 DC "C2'" "H2'" sing N N 58 DC "C2'" "H2''" sing N N 59 DC "C1'" N1 sing N N 60 DC "C1'" "H1'" sing N N 61 DC N1 C2 sing N N 62 DC N1 C6 sing N N 63 DC C2 O2 doub N N 64 DC C2 N3 sing N N 65 DC N3 C4 doub N N 66 DC C4 N4 sing N N 67 DC C4 C5 sing N N 68 DC N4 H41 sing N N 69 DC N4 H42 sing N N 70 DC C5 C6 doub N N 71 DC C5 H5 sing N N 72 DC C6 H6 sing N N 73 DG OP3 P sing N N 74 DG OP3 HOP3 sing N N 75 DG P OP1 doub N N 76 DG P OP2 sing N N 77 DG P "O5'" sing N N 78 DG OP2 HOP2 sing N N 79 DG "O5'" "C5'" sing N N 80 DG "C5'" "C4'" sing N N 81 DG "C5'" "H5'" sing N N 82 DG "C5'" "H5''" sing N N 83 DG "C4'" "O4'" sing N N 84 DG "C4'" "C3'" sing N N 85 DG "C4'" "H4'" sing N N 86 DG "O4'" "C1'" sing N N 87 DG "C3'" "O3'" sing N N 88 DG "C3'" "C2'" sing N N 89 DG "C3'" "H3'" sing N N 90 DG "O3'" "HO3'" sing N N 91 DG "C2'" "C1'" sing N N 92 DG "C2'" "H2'" sing N N 93 DG "C2'" "H2''" sing N N 94 DG "C1'" N9 sing N N 95 DG "C1'" "H1'" sing N N 96 DG N9 C8 sing Y N 97 DG N9 C4 sing Y N 98 DG C8 N7 doub Y N 99 DG C8 H8 sing N N 100 DG N7 C5 sing Y N 101 DG C5 C6 sing N N 102 DG C5 C4 doub Y N 103 DG C6 O6 doub N N 104 DG C6 N1 sing N N 105 DG N1 C2 sing N N 106 DG N1 H1 sing N N 107 DG C2 N2 sing N N 108 DG C2 N3 doub N N 109 DG N2 H21 sing N N 110 DG N2 H22 sing N N 111 DG N3 C4 sing N N 112 DT OP3 P sing N N 113 DT OP3 HOP3 sing N N 114 DT P OP1 doub N N 115 DT P OP2 sing N N 116 DT P "O5'" sing N N 117 DT OP2 HOP2 sing N N 118 DT "O5'" "C5'" sing N N 119 DT "C5'" "C4'" sing N N 120 DT "C5'" "H5'" sing N N 121 DT "C5'" "H5''" sing N N 122 DT "C4'" "O4'" sing N N 123 DT "C4'" "C3'" sing N N 124 DT "C4'" "H4'" sing N N 125 DT "O4'" "C1'" sing N N 126 DT "C3'" "O3'" sing N N 127 DT "C3'" "C2'" sing N N 128 DT "C3'" "H3'" sing N N 129 DT "O3'" "HO3'" sing N N 130 DT "C2'" "C1'" sing N N 131 DT "C2'" "H2'" sing N N 132 DT "C2'" "H2''" sing N N 133 DT "C1'" N1 sing N N 134 DT "C1'" "H1'" sing N N 135 DT N1 C2 sing N N 136 DT N1 C6 sing N N 137 DT C2 O2 doub N N 138 DT C2 N3 sing N N 139 DT N3 C4 sing N N 140 DT N3 H3 sing N N 141 DT C4 O4 doub N N 142 DT C4 C5 sing N N 143 DT C5 C7 sing N N 144 DT C5 C6 doub N N 145 DT C7 H71 sing N N 146 DT C7 H72 sing N N 147 DT C7 H73 sing N N 148 DT C6 H6 sing N N 149 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7UJZ 'double helix' 7UJZ 'a-form double helix' 7UJZ 'b-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DA 2 1_555 C DT 7 1_555 0.376 0.365 -0.881 -0.873 -7.042 -16.183 1 A_DA2:DT14_C A 2 ? C 14 ? 20 1 1 A DG 3 1_555 C DC 6 1_555 -0.215 -0.052 -0.119 -7.785 -9.259 1.121 2 A_DG3:DC13_C A 3 ? C 13 ? 19 1 1 A DC 4 1_555 C DG 5 1_555 0.057 0.284 0.410 -5.260 -8.260 -13.577 3 A_DC4:DG12_C A 4 ? C 12 ? ? 1 1 A DA 5 1_555 C DT 4 1_555 2.160 0.180 0.370 5.731 -12.895 -12.728 4 A_DA5:DT11_C A 5 ? C 11 ? 20 1 1 A DG 6 1_555 C DC 3 1_555 -0.039 -0.324 1.128 13.931 -2.553 -1.249 5 A_DG6:DC10_C A 6 ? C 10 ? 19 1 1 A DC 7 1_555 C DG 2 1_555 0.210 -0.353 0.995 11.075 -4.087 2.666 6 A_DC7:DG9_C A 7 ? C 9 ? 19 1 1 A DC 8 1_555 C DG 1 1_555 0.080 -0.179 0.512 -1.764 -15.397 -3.219 7 A_DC8:DG8_C A 8 ? C 8 ? 19 1 1 A DT 9 1_555 B DA 7 1_555 -0.294 -0.323 1.124 -1.005 -4.333 -3.157 8 A_DT9:DA7_B A 9 ? B 7 ? 20 1 1 A DG 10 1_555 B DC 6 1_555 -0.336 -0.046 0.178 -4.736 -18.414 8.817 9 A_DG10:DC6_B A 10 ? B 6 ? 19 1 1 A DT 11 1_555 B DA 5 1_555 -2.733 0.010 -0.174 0.690 -4.168 -3.014 10 A_DT11:DA5_B A 11 ? B 5 ? 20 1 1 A DT 13 1_555 B DA 3 1_555 -0.137 -0.154 0.081 1.589 2.296 5.102 11 A_DT13:DA3_B A 13 ? B 3 ? 20 1 1 A DG 14 1_555 B DC 2 1_555 -0.203 -0.158 0.492 2.733 -8.213 -5.942 12 A_DG14:DC2_B A 14 ? B 2 ? 19 1 1 A DG 15 1_555 B DC 1 1_555 -0.189 -0.145 0.185 -5.374 -8.048 -2.815 13 A_DG15:DC1_B A 15 ? B 1 ? 19 1 1 A DA 16 1_555 D DT 7 1_555 0.315 -0.481 1.455 7.518 -10.742 -6.892 14 A_DA16:DT7_D A 16 ? D 7 ? 20 1 1 A DC 17 1_555 D DG 6 1_555 0.127 -0.131 0.438 -5.085 -4.066 -0.932 15 A_DC17:DG6_D A 17 ? D 6 ? 19 1 1 A DA 18 1_555 D DT 5 1_555 0.134 -0.173 -0.210 -4.995 -5.309 -0.818 16 A_DA18:DT5_D A 18 ? D 5 ? 20 1 1 A DT 19 1_555 D DA 4 1_555 -0.128 -0.127 0.321 -0.778 -5.546 -3.092 17 A_DT19:DA4_D A 19 ? D 4 ? 20 1 1 A DC 20 1_555 D DG 3 1_555 0.114 -0.185 -0.489 -3.559 -2.985 0.159 18 A_DC20:DG3_D A 20 ? D 3 ? 19 1 1 A DA 21 1_555 D DT 2 1_555 0.163 0.066 -0.691 -13.638 -8.920 -6.276 19 A_DA21:DT2_D A 21 ? D 2 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DA 2 1_555 C DT 7 1_555 A DG 3 1_555 C DC 6 1_555 0.583 -0.574 3.443 -10.845 13.961 37.993 -2.281 -1.964 2.814 20.166 15.665 41.766 1 AA_DA2DG3:DC13DT14_CC A 2 ? C 14 ? A 3 ? C 13 ? 1 A DG 3 1_555 C DC 6 1_555 A DC 4 1_555 C DG 5 1_555 -0.655 -1.633 3.168 -5.495 -2.898 27.021 -2.698 0.019 3.385 -6.100 11.567 27.713 2 AA_DG3DC4:DG12DC13_CC A 3 ? C 13 ? A 4 ? C 12 ? 1 A DC 4 1_555 C DG 5 1_555 A DA 5 1_555 C DT 4 1_555 -0.674 0.076 3.021 0.119 7.743 46.469 -0.494 0.853 2.994 9.733 -0.150 47.075 3 AA_DC4DA5:DT11DG12_CC A 4 ? C 12 ? A 5 ? C 11 ? 1 A DA 5 1_555 C DT 4 1_555 A DG 6 1_555 C DC 3 1_555 0.197 -1.761 2.793 -14.254 6.851 22.671 -4.979 -3.089 1.771 15.269 31.767 27.583 4 AA_DA5DG6:DC10DT11_CC A 5 ? C 11 ? A 6 ? C 10 ? 1 A DG 6 1_555 C DC 3 1_555 A DC 7 1_555 C DG 2 1_555 0.583 -1.959 3.280 -3.292 2.214 27.673 -4.566 -1.965 3.028 4.599 6.838 27.950 5 AA_DG6DC7:DG9DC10_CC A 6 ? C 10 ? A 7 ? C 9 ? 1 A DC 7 1_555 C DG 2 1_555 A DC 8 1_555 C DG 1 1_555 -0.496 -0.821 3.557 -0.725 -12.951 44.582 0.194 0.561 3.654 -16.658 0.933 46.338 6 AA_DC7DC8:DG8DG9_CC A 7 ? C 9 ? A 8 ? C 8 ? 1 A DC 8 1_555 C DG 1 1_555 A DT 9 1_555 B DA 7 1_555 -2.059 -0.770 3.678 -4.635 -8.294 21.152 1.638 3.141 4.042 -21.265 11.885 23.166 7 AA_DC8DT9:DA7DG8_BC A 8 ? C 8 ? A 9 ? B 7 ? 1 A DT 9 1_555 B DA 7 1_555 A DG 10 1_555 B DC 6 1_555 -0.022 -0.635 3.409 3.980 11.109 29.612 -3.208 0.774 2.958 20.728 -7.427 31.828 8 AA_DT9DG10:DC6DA7_BB A 9 ? B 7 ? A 10 ? B 6 ? 1 A DG 10 1_555 B DC 6 1_555 A DT 11 1_555 B DA 5 1_555 -0.889 -0.241 3.361 2.159 -1.821 22.532 0.057 3.051 3.272 -4.638 -5.498 22.706 9 AA_DG10DT11:DA5DC6_BB A 10 ? B 6 ? A 11 ? B 5 ? 1 A DT 11 1_555 B DA 5 1_555 A DT 13 1_555 B DA 3 1_555 0.294 -0.675 6.557 -1.446 6.368 79.566 -0.865 -0.306 6.492 4.968 1.128 79.789 10 AA_DT11DT13:DA3DA5_BB A 11 ? B 5 ? A 13 ? B 3 ? 1 A DT 13 1_555 B DA 3 1_555 A DG 14 1_555 B DC 2 1_555 -0.971 2.455 3.526 -6.660 -3.907 47.555 3.337 0.632 3.424 -4.808 8.196 48.142 11 AA_DT13DG14:DC2DA3_BB A 13 ? B 3 ? A 14 ? B 2 ? 1 A DG 14 1_555 B DC 2 1_555 A DG 15 1_555 B DC 1 1_555 0.078 0.542 3.881 -7.326 2.477 44.537 0.443 -0.881 3.846 3.240 9.580 45.170 12 AA_DG14DG15:DC1DC2_BB A 14 ? B 2 ? A 15 ? B 1 ? 1 A DG 15 1_555 B DC 1 1_555 A DA 16 1_555 D DT 7 1_555 -1.685 -0.656 2.954 -19.019 -11.084 22.700 1.136 -0.918 3.371 -22.489 38.587 31.520 13 AA_DG15DA16:DT7DC1_DB A 15 ? B 1 ? A 16 ? D 7 ? 1 A DA 16 1_555 D DT 7 1_555 A DC 17 1_555 D DG 6 1_555 0.134 -1.668 3.548 7.696 -4.079 27.991 -2.306 1.611 3.657 -8.186 -15.444 29.289 14 AA_DA16DC17:DG6DT7_DD A 16 ? D 7 ? A 17 ? D 6 ? 1 A DC 17 1_555 D DG 6 1_555 A DA 18 1_555 D DT 5 1_555 -0.095 0.236 3.294 3.149 -4.157 38.698 0.855 0.522 3.236 -6.239 -4.726 39.034 15 AA_DC17DA18:DT5DG6_DD A 17 ? D 6 ? A 18 ? D 5 ? 1 A DA 18 1_555 D DT 5 1_555 A DT 19 1_555 D DA 4 1_555 0.350 -0.889 3.061 -3.284 0.820 34.812 -1.594 -1.041 2.995 1.366 5.473 34.971 16 AA_DA18DT19:DA4DT5_DD A 18 ? D 5 ? A 19 ? D 4 ? 1 A DT 19 1_555 D DA 4 1_555 A DC 20 1_555 D DG 3 1_555 0.424 0.227 3.205 6.956 -11.595 42.910 1.331 0.065 3.077 -15.400 -9.238 44.894 17 AA_DT19DC20:DG3DA4_DD A 19 ? D 4 ? A 20 ? D 3 ? 1 A DC 20 1_555 D DG 3 1_555 A DA 21 1_555 D DT 2 1_555 -0.451 -0.610 3.657 2.375 14.590 29.028 -3.836 1.254 2.975 27.010 -4.397 32.503 18 AA_DC20DA21:DT2DG3_DD A 20 ? D 3 ? A 21 ? D 2 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'Office of Naval Research (ONR)' 'United States' N000141912596 1 'Department of Energy (DOE, United States)' 'United States' DE-SC0007991 2 'National Science Foundation (NSF, United States)' 'United States' 2106790 3 'Human Frontier Science Program (HFSP)' France RPG0010/2017 4 'National Science Foundation (NSF, United States)' 'United States' DMR-1420073 5 'National Aeronautic Space Administration (NASA, United States)' 'United States' '2020 NASA Center Innovation Fund' 6 # loop_ _pdbx_entity_instance_feature.ordinal _pdbx_entity_instance_feature.comp_id _pdbx_entity_instance_feature.asym_id _pdbx_entity_instance_feature.seq_num _pdbx_entity_instance_feature.auth_comp_id _pdbx_entity_instance_feature.auth_asym_id _pdbx_entity_instance_feature.auth_seq_num _pdbx_entity_instance_feature.feature_type _pdbx_entity_instance_feature.details 1 CD ? ? CD ? ? 'SUBJECT OF INVESTIGATION' ? 2 HG ? ? HG ? ? 'SUBJECT OF INVESTIGATION' ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 5 'MERCURY (II) ION' HG 6 'CADMIUM ION' CD # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details ? # _space_group.name_H-M_alt 'R 3 :H' _space_group.name_Hall 'R 3' _space_group.IT_number 146 _space_group.crystal_system trigonal _space_group.id 1 #