data_7UMD # _entry.id 7UMD # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7UMD pdb_00007umd 10.2210/pdb7umd/pdb WWPDB D_1000264411 ? ? BMRB 31009 ? 10.13018/BMR31009 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2022-07-06 2 'Structure model' 1 1 2022-08-24 3 'Structure model' 1 2 2023-01-04 4 'Structure model' 1 3 2023-06-14 5 'Structure model' 1 4 2024-05-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' Other 3 3 'Structure model' 'Structure summary' 4 4 'Structure model' Other 5 5 'Structure model' 'Data collection' 6 5 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 3 'Structure model' pdbx_SG_project 3 3 'Structure model' pdbx_database_status 4 3 'Structure model' struct_keywords 5 4 'Structure model' pdbx_database_status 6 5 'Structure model' chem_comp_atom 7 5 'Structure model' chem_comp_bond 8 5 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 2 'Structure model' '_citation.title' 5 3 'Structure model' '_pdbx_database_status.SG_entry' 6 3 'Structure model' '_struct_keywords.text' 7 4 'Structure model' '_pdbx_database_status.status_code_nmr_data' 8 5 'Structure model' '_database_2.pdbx_DOI' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.entry_id 7UMD _pdbx_database_status.recvd_initial_deposition_date 2022-04-06 _pdbx_database_status.SG_entry Y _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs REL _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name BMRB _pdbx_database_related.details 'DENV1 SLA three-way junction RNA (DenvSLAsh)' _pdbx_database_related.db_id 31009 _pdbx_database_related.content_type unspecified # _pdbx_contact_author.id 2 _pdbx_contact_author.email varani@chem.washington.edu _pdbx_contact_author.name_first Gabriele _pdbx_contact_author.name_last Varani _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0001-6642-7144 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Sun, Y.T.' 1 0000-0001-6196-1727 'Varani, G.' 2 0000-0001-6642-7144 'Seattle Structural Genomics Center for Infectious Disease (SSGCID)' 3 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Rna _citation.journal_id_ASTM RNARFU _citation.journal_id_CSD 2122 _citation.journal_id_ISSN 1469-9001 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 28 _citation.language ? _citation.page_first 1210 _citation.page_last 1223 _citation.title 'Structure of the dengue virus RNA promoter.' _citation.year 2022 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1261/rna.079197.122 _citation.pdbx_database_id_PubMed 35750488 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Sun, Y.T.' 1 0000-0001-6196-1727 primary 'Varani, G.' 2 0000-0001-6642-7144 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (40-MER)' _entity.formula_weight 12929.753 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGACGUGGACCGACUUCGGUCGGAAGGAAACUUAACGUCC _entity_poly.pdbx_seq_one_letter_code_can GGACGUGGACCGACUUCGGUCGGAAGGAAACUUAACGUCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 C n 1 5 G n 1 6 U n 1 7 G n 1 8 G n 1 9 A n 1 10 C n 1 11 C n 1 12 G n 1 13 A n 1 14 C n 1 15 U n 1 16 U n 1 17 C n 1 18 G n 1 19 G n 1 20 U n 1 21 C n 1 22 G n 1 23 G n 1 24 A n 1 25 A n 1 26 G n 1 27 G n 1 28 A n 1 29 A n 1 30 A n 1 31 C n 1 32 U n 1 33 U n 1 34 A n 1 35 A n 1 36 C n 1 37 G n 1 38 U n 1 39 C n 1 40 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 40 _pdbx_entity_src_syn.organism_scientific 'Dengue virus 1' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 11053 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 C 4 4 4 C C A . n A 1 5 G 5 5 5 G G A . n A 1 6 U 6 6 6 U U A . n A 1 7 G 7 7 7 G G A . n A 1 8 G 8 8 8 G G A . n A 1 9 A 9 9 9 A A A . n A 1 10 C 10 10 10 C C A . n A 1 11 C 11 11 11 C C A . n A 1 12 G 12 12 12 G G A . n A 1 13 A 13 13 13 A A A . n A 1 14 C 14 14 14 C C A . n A 1 15 U 15 15 15 U U A . n A 1 16 U 16 16 16 U U A . n A 1 17 C 17 17 17 C C A . n A 1 18 G 18 18 18 G G A . n A 1 19 G 19 19 19 G G A . n A 1 20 U 20 20 20 U U A . n A 1 21 C 21 21 21 C C A . n A 1 22 G 22 22 22 G G A . n A 1 23 G 23 23 23 G G A . n A 1 24 A 24 24 24 A A A . n A 1 25 A 25 25 25 A A A . n A 1 26 G 26 26 26 G G A . n A 1 27 G 27 27 27 G G A . n A 1 28 A 28 28 28 A A A . n A 1 29 A 29 29 29 A A A . n A 1 30 A 30 30 30 A A A . n A 1 31 C 31 31 31 C C A . n A 1 32 U 32 32 32 U U A . n A 1 33 U 33 33 33 U U A . n A 1 34 A 34 34 34 A A A . n A 1 35 A 35 35 35 A A A . n A 1 36 C 36 36 36 C C A . n A 1 37 G 37 37 37 G G A . n A 1 38 U 38 38 38 U U A . n A 1 39 C 39 39 39 C C A . n A 1 40 C 40 40 40 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7UMD _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 7UMD _struct.title 'DENV1 SLA three-way junction RNA (DenvSLAsh)' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7UMD _struct_keywords.text ;flavivirus, 5' UTR, SLA, viral replication, NS5 promoter, RNA, Structural Genomics, Seattle Structural Genomics Center for Infectious Disease, SSGCID ; _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7UMD _struct_ref.pdbx_db_accession 7UMD _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7UMD _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 40 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7UMD _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 40 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 40 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # loop_ _pdbx_struct_assembly_auth_evidence.id _pdbx_struct_assembly_auth_evidence.assembly_id _pdbx_struct_assembly_auth_evidence.experimental_support _pdbx_struct_assembly_auth_evidence.details 1 1 'NMR Distance Restraints' ? 2 1 SAXS ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 40 N3 ? ? A G 1 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 40 O2 ? ? A G 1 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 40 N4 ? ? A G 1 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 39 N3 ? ? A G 2 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 39 O2 ? ? A G 2 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 39 N4 ? ? A G 2 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 38 N3 ? ? A A 3 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 38 O4 ? ? A A 3 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 37 N1 ? ? A C 4 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 37 O6 ? ? A C 4 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 37 N2 ? ? A C 4 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 36 N3 ? ? A G 5 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 36 O2 ? ? A G 5 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 36 N4 ? ? A G 5 A C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 6 N3 ? ? ? 1_555 A A 35 N1 ? ? A U 6 A A 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 6 O4 ? ? ? 1_555 A A 35 N6 ? ? A U 6 A A 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 23 N1 ? ? A C 10 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 23 O6 ? ? A C 10 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 23 N2 ? ? A C 10 A G 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 22 N1 ? ? A C 11 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 22 O6 ? ? A C 11 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 22 N2 ? ? A C 11 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 12 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 12 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 12 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A A 13 N1 ? ? ? 1_555 A U 20 N3 ? ? A A 13 A U 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 13 N6 ? ? ? 1_555 A U 20 O4 ? ? A A 13 A U 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 14 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 14 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 14 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A A 24 N1 ? ? ? 1_555 A U 33 N3 ? ? A A 24 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A A 24 N6 ? ? ? 1_555 A U 33 O4 ? ? A A 24 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A A 25 N1 ? ? ? 1_555 A U 32 N3 ? ? A A 25 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A A 25 N6 ? ? ? 1_555 A U 32 O4 ? ? A A 25 A U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 26 N1 ? ? ? 1_555 A A 30 N1 ? ? A G 26 A A 30 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog36 hydrog ? ? A G 26 O6 ? ? ? 1_555 A A 30 N6 ? ? A G 26 A A 30 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog37 hydrog ? ? A G 26 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 26 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 26 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 26 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 26 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 26 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C1'" A G 18 ? ? "O4'" A G 18 ? ? "C4'" A G 18 ? ? 104.24 109.70 -5.46 0.70 N 2 2 "C1'" A U 15 ? ? "O4'" A U 15 ? ? "C4'" A U 15 ? ? 104.51 109.70 -5.19 0.70 N 3 2 "C1'" A G 18 ? ? "O4'" A G 18 ? ? "C4'" A G 18 ? ? 105.20 109.70 -4.50 0.70 N 4 8 "C1'" A G 18 ? ? "O4'" A G 18 ? ? "C4'" A G 18 ? ? 104.10 109.70 -5.60 0.70 N # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 1 C A 31 ? ? 0.071 'SIDE CHAIN' 2 2 C A 31 ? ? 0.074 'SIDE CHAIN' 3 3 C A 31 ? ? 0.077 'SIDE CHAIN' 4 4 C A 31 ? ? 0.059 'SIDE CHAIN' 5 5 C A 31 ? ? 0.070 'SIDE CHAIN' 6 6 C A 31 ? ? 0.064 'SIDE CHAIN' 7 7 C A 31 ? ? 0.074 'SIDE CHAIN' 8 8 C A 31 ? ? 0.063 'SIDE CHAIN' 9 9 C A 31 ? ? 0.073 'SIDE CHAIN' 10 10 C A 31 ? ? 0.069 'SIDE CHAIN' # _pdbx_SG_project.full_name_of_center 'Seattle Structural Genomics Center for Infectious Disease' _pdbx_SG_project.id 1 _pdbx_SG_project.initial_of_center SSGCID _pdbx_SG_project.project_name 'NIAID, National Institute of Allergy and Infectious Diseases' # _pdbx_nmr_ensemble.entry_id 7UMD _pdbx_nmr_ensemble.conformers_calculated_total_number 400 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 7UMD _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 '1 mM RNA (40-MER), 10 mM potassium phosphate, 95% H2O/5% D2O' '95% H2O/5% D2O' 1H_h2o solution ? 2 '1 mM RNA (40-MER), 10 mM potassium phosphate, 100% D2O' '100% D2O' 1H_d2o solution ? 3 '1 mM [U-2H] RNA (40-MER), 10 mM potassium phosphate, 100% D2O' '100% D2O' 2D_d2o solution ? # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 'RNA (40-MER)' 1 ? mM 'natural abundance' 1 'potassium phosphate' 10 ? mM 'natural abundance' 2 'RNA (40-MER)' 1 ? mM 'natural abundance' 2 'potassium phosphate' 10 ? mM 'natural abundance' 3 'RNA (40-MER)' 1 ? mM '[U-2H]' 3 'potassium phosphate' 10 ? mM 'natural abundance' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 6.5 _pdbx_nmr_exptl_sample_conditions.ionic_strength 50 _pdbx_nmr_exptl_sample_conditions.details ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_err ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_units mM _pdbx_nmr_exptl_sample_conditions.label condition1 _pdbx_nmr_exptl_sample_conditions.pH_err ? _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.pressure_err ? _pdbx_nmr_exptl_sample_conditions.temperature_err ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 2 '2D 1H-1H NOESY' 1 isotropic 2 1 2 '2D 1H-1H TOCSY' 1 isotropic 3 1 1 '2D 1H-1H NOESY' 3 isotropic 4 1 3 '2D 1H-1H NOESY' 1 isotropic 5 1 2 '2D 1H-1H TOCSY' 2 isotropic 6 1 2 '2D 1H-1H NOESY' 2 isotropic # _pdbx_nmr_refine.entry_id 7UMD _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 4 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 collection TopSpin ? 'Bruker Biospin' 2 processing TopSpin ? 'Bruker Biospin' 3 'peak picking' NMRFAM-SPARKY ? 'Lee W, Tonelli M, Markley JL' 4 refinement 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' 5 'structure calculation' 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7UMD 'double helix' 7UMD 'a-form double helix' 7UMD 'hairpin loop' 7UMD 'mismatched base pair' 7UMD 'internal loop' 7UMD 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 40 1_555 -0.464 0.074 -0.018 -1.348 0.772 -2.328 1 A_G1:C40_A A 1 ? A 40 ? 19 1 1 A G 2 1_555 A C 39 1_555 -0.142 -0.048 -0.059 0.465 -9.205 3.809 2 A_G2:C39_A A 2 ? A 39 ? 19 1 1 A A 3 1_555 A U 38 1_555 -0.123 -0.217 -0.075 -0.883 -13.273 0.410 3 A_A3:U38_A A 3 ? A 38 ? 20 1 1 A C 4 1_555 A G 37 1_555 0.650 -0.228 -0.047 -0.334 -11.670 4.502 4 A_C4:G37_A A 4 ? A 37 ? 19 1 1 A G 5 1_555 A C 36 1_555 -0.578 -0.159 0.009 -5.163 -9.529 3.354 5 A_G5:C36_A A 5 ? A 36 ? 19 1 1 A U 6 1_555 A A 35 1_555 0.204 0.060 0.116 -1.313 -4.585 -2.017 6 A_U6:A35_A A 6 ? A 35 ? 20 1 1 A G 19 1_555 A C 14 1_555 -1.109 -0.524 0.269 -8.206 7.619 3.864 7 A_G19:C14_A A 19 ? A 14 ? 19 1 1 A U 20 1_555 A A 13 1_555 -0.172 -0.209 -0.211 4.137 -5.514 -5.561 8 A_U20:A13_A A 20 ? A 13 ? 20 1 1 A C 21 1_555 A G 12 1_555 -0.033 -0.109 -0.148 5.647 -10.055 2.867 9 A_C21:G12_A A 21 ? A 12 ? 19 1 1 A G 22 1_555 A C 11 1_555 -0.580 -0.241 -0.087 -3.935 -14.585 3.351 10 A_G22:C11_A A 22 ? A 11 ? 19 1 1 A G 23 1_555 A C 10 1_555 -0.467 0.135 -0.181 -13.339 -10.651 -4.712 11 A_G23:C10_A A 23 ? A 10 ? 19 1 1 A A 24 1_555 A U 33 1_555 0.296 0.374 -0.260 4.303 -12.691 -0.796 12 A_A24:U33_A A 24 ? A 33 ? 20 1 1 A A 25 1_555 A U 32 1_555 -0.693 -0.300 0.273 2.372 0.938 -0.057 13 A_A25:U32_A A 25 ? A 32 ? 20 1 1 A G 26 1_555 A C 31 1_555 -0.694 -0.414 0.610 5.910 13.903 5.152 14 A_G26:C31_A A 26 ? A 31 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 40 1_555 A G 2 1_555 A C 39 1_555 0.243 -1.740 3.191 0.433 5.910 32.417 -4.004 -0.361 2.841 10.477 -0.767 32.940 1 AA_G1G2:C39C40_AA A 1 ? A 40 ? A 2 ? A 39 ? 1 A G 2 1_555 A C 39 1_555 A A 3 1_555 A U 38 1_555 -0.123 -1.562 3.274 -0.112 3.763 32.599 -3.395 0.199 3.080 6.675 0.198 32.810 2 AA_G2A3:U38C39_AA A 2 ? A 39 ? A 3 ? A 38 ? 1 A A 3 1_555 A U 38 1_555 A C 4 1_555 A G 37 1_555 0.239 -1.447 3.259 0.803 3.945 35.468 -2.916 -0.276 3.090 6.450 -1.313 35.688 3 AA_A3C4:G37U38_AA A 3 ? A 38 ? A 4 ? A 37 ? 1 A C 4 1_555 A G 37 1_555 A G 5 1_555 A C 36 1_555 0.023 -1.742 3.258 -0.101 9.858 25.980 -5.773 -0.070 2.445 20.990 0.215 27.757 4 AA_C4G5:C36G37_AA A 4 ? A 37 ? A 5 ? A 36 ? 1 A G 5 1_555 A C 36 1_555 A U 6 1_555 A A 35 1_555 -0.358 -1.501 3.264 -0.758 7.878 33.748 -3.670 0.491 2.859 13.343 1.283 34.638 5 AA_G5U6:A35C36_AA A 5 ? A 36 ? A 6 ? A 35 ? 1 A G 19 1_555 A C 14 1_555 A U 20 1_555 A A 13 1_555 -0.442 -1.588 2.966 3.502 9.527 31.508 -4.130 1.269 2.339 17.001 -6.249 33.063 6 AA_G19U20:A13C14_AA A 19 ? A 14 ? A 20 ? A 13 ? 1 A U 20 1_555 A A 13 1_555 A C 21 1_555 A G 12 1_555 0.489 -1.576 3.333 -0.162 4.185 31.384 -3.653 -0.926 3.100 7.693 0.297 31.655 7 AA_U20C21:G12A13_AA A 20 ? A 13 ? A 21 ? A 12 ? 1 A C 21 1_555 A G 12 1_555 A G 22 1_555 A C 11 1_555 0.134 -1.680 3.283 -0.417 10.218 30.390 -4.746 -0.313 2.595 18.833 0.768 32.026 8 AA_C21G22:C11G12_AA A 21 ? A 12 ? A 22 ? A 11 ? 1 A G 22 1_555 A C 11 1_555 A G 23 1_555 A C 10 1_555 -0.093 -1.741 3.455 1.496 5.120 35.641 -3.556 0.367 3.177 8.307 -2.428 36.025 9 AA_G22G23:C10C11_AA A 22 ? A 11 ? A 23 ? A 10 ? 1 A G 23 1_555 A C 10 1_555 A A 24 1_555 A U 33 1_555 -0.821 -1.941 4.026 -18.293 20.450 25.622 -6.087 -1.454 2.137 35.590 31.836 37.372 10 AA_G23A24:U33C10_AA A 23 ? A 10 ? A 24 ? A 33 ? 1 A A 24 1_555 A U 33 1_555 A A 25 1_555 A U 32 1_555 -0.506 -1.763 3.061 -9.267 27.481 27.157 -5.047 -0.074 1.039 45.264 15.263 39.531 11 AA_A24A25:U32U33_AA A 24 ? A 33 ? A 25 ? A 32 ? 1 A A 25 1_555 A U 32 1_555 A G 26 1_555 A C 31 1_555 -0.606 -2.051 3.030 -8.431 21.626 22.545 -6.462 0.011 0.931 43.245 16.859 32.250 12 AA_A25G26:C31U32_AA A 25 ? A 32 ? A 26 ? A 31 ? # _pdbx_audit_support.funding_organization 'Other private' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 'AVANCE III' ? Bruker 600 ? 2 'AVANCE III' ? Bruker 700 ? 3 'AVANCE III' ? Bruker 800 ? # _atom_sites.entry_id 7UMD _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_