data_7UME # _entry.id 7UME # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7UME pdb_00007ume 10.2210/pdb7ume/pdb WWPDB D_1000264433 ? ? BMRB 30853 ? 10.13018/BMR30853 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2022-07-06 2 'Structure model' 1 1 2022-08-03 3 'Structure model' 1 2 2022-08-24 4 'Structure model' 1 3 2023-01-04 5 'Structure model' 1 4 2023-06-14 6 'Structure model' 1 5 2024-05-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' 3 4 'Structure model' Other 4 4 'Structure model' 'Structure summary' 5 5 'Structure model' Other 6 6 'Structure model' 'Data collection' 7 6 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' citation 4 4 'Structure model' pdbx_SG_project 5 4 'Structure model' pdbx_database_status 6 4 'Structure model' struct_keywords 7 5 'Structure model' pdbx_database_status 8 6 'Structure model' chem_comp_atom 9 6 'Structure model' chem_comp_bond 10 6 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_ASTM' 4 2 'Structure model' '_citation.journal_id_CSD' 5 2 'Structure model' '_citation.journal_id_ISSN' 6 2 'Structure model' '_citation.pdbx_database_id_DOI' 7 2 'Structure model' '_citation.pdbx_database_id_PubMed' 8 2 'Structure model' '_citation.title' 9 2 'Structure model' '_citation.year' 10 2 'Structure model' '_citation_author.identifier_ORCID' 11 3 'Structure model' '_citation.journal_volume' 12 3 'Structure model' '_citation.page_first' 13 3 'Structure model' '_citation.page_last' 14 3 'Structure model' '_citation.title' 15 4 'Structure model' '_pdbx_database_status.SG_entry' 16 4 'Structure model' '_struct_keywords.text' 17 5 'Structure model' '_pdbx_database_status.status_code_nmr_data' 18 6 'Structure model' '_database_2.pdbx_DOI' # _pdbx_database_PDB_obs_spr.id SPRSDE _pdbx_database_PDB_obs_spr.date 2022-07-06 _pdbx_database_PDB_obs_spr.pdb_id 7UME _pdbx_database_PDB_obs_spr.replace_pdb_id 7LM1 _pdbx_database_PDB_obs_spr.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.entry_id 7UME _pdbx_database_status.recvd_initial_deposition_date 2022-04-06 _pdbx_database_status.SG_entry Y _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs REL _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name BMRB _pdbx_database_related.details . _pdbx_database_related.db_id 30853 _pdbx_database_related.content_type unspecified # _pdbx_contact_author.id 2 _pdbx_contact_author.email varani@chem.washington.edu _pdbx_contact_author.name_first Gabriele _pdbx_contact_author.name_last Varani _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0001-6642-7144 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Sun, Y.T.' 1 ? 'Varani, G.' 2 ? 'Seattle Structural Genomics Center for Infectious Disease (SSGCID)' 3 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Rna _citation.journal_id_ASTM RNARFU _citation.journal_id_CSD 2122 _citation.journal_id_ISSN 1469-9001 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 28 _citation.language ? _citation.page_first 1210 _citation.page_last 1223 _citation.title 'Structure of the dengue virus RNA promoter.' _citation.year 2022 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1261/rna.079197.122 _citation.pdbx_database_id_PubMed 35750488 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Sun, Y.T.' 1 0000-0001-6196-1727 primary 'Varani, G.' 2 0000-0001-6642-7144 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (28-MER)' _entity.formula_weight 9016.454 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCCGACAAGAACAGUUUCGAAUCGGCC _entity_poly.pdbx_seq_one_letter_code_can GGCCGACAAGAACAGUUUCGAAUCGGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 C n 1 5 G n 1 6 A n 1 7 C n 1 8 A n 1 9 A n 1 10 G n 1 11 A n 1 12 A n 1 13 C n 1 14 A n 1 15 G n 1 16 U n 1 17 U n 1 18 U n 1 19 C n 1 20 G n 1 21 A n 1 22 A n 1 23 U n 1 24 C n 1 25 G n 1 26 G n 1 27 C n 1 28 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 28 _pdbx_entity_src_syn.organism_scientific 'Dengue virus 1' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 11053 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 C 4 4 4 C C A . n A 1 5 G 5 5 5 G G A . n A 1 6 A 6 6 6 A A A . n A 1 7 C 7 7 7 C C A . n A 1 8 A 8 8 8 A A A . n A 1 9 A 9 9 9 A A A . n A 1 10 G 10 10 10 G G A . n A 1 11 A 11 11 11 A A A . n A 1 12 A 12 12 12 A A A . n A 1 13 C 13 13 13 C C A . n A 1 14 A 14 14 14 A A A . n A 1 15 G 15 15 15 G G A . n A 1 16 U 16 16 16 U U A . n A 1 17 U 17 17 17 U U A . n A 1 18 U 18 18 18 U U A . n A 1 19 C 19 19 19 C C A . n A 1 20 G 20 20 20 G G A . n A 1 21 A 21 21 21 A A A . n A 1 22 A 22 22 22 A A A . n A 1 23 U 23 23 23 U U A . n A 1 24 C 24 24 24 C C A . n A 1 25 G 25 25 25 G G A . n A 1 26 G 26 26 26 G G A . n A 1 27 C 27 27 27 C C A . n A 1 28 C 28 28 28 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7UME _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 7UME _struct.title 'DENV1 SLA top stemloop RNA (DenvTSL)' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7UME _struct_keywords.text ;flavivirus, 5' UTR, SLA, viral replication, NS5 promoter, RNA, Structural Genomics, Seattle Structural Genomics Center for Infectious Disease, SSGCID ; _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7UME _struct_ref.pdbx_db_accession 7UME _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7UME _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 28 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7UME _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 28 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 28 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'NMR Distance Restraints' _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 28 N3 ? ? A G 1 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 28 O2 ? ? A G 1 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 28 N4 ? ? A G 1 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 27 N3 ? ? A G 2 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 27 O2 ? ? A G 2 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 27 N4 ? ? A G 2 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 26 N1 ? ? A C 3 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 26 O6 ? ? A C 3 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 26 N2 ? ? A C 3 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 25 N1 ? ? A C 4 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 25 O6 ? ? A C 4 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 25 N2 ? ? A C 4 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 5 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 5 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 5 A C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 6 N1 ? ? ? 1_555 A U 23 N3 ? ? A A 6 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A A 6 N6 ? ? ? 1_555 A U 23 O4 ? ? A A 6 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 7 N4 ? ? ? 1_555 A A 22 N1 ? ? A C 7 A A 22 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog19 hydrog ? ? A A 8 N6 ? ? ? 1_555 A A 21 N1 ? ? A A 8 A A 21 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog20 hydrog ? ? A A 9 N1 ? ? ? 1_555 A G 20 N1 ? ? A A 9 A G 20 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog21 hydrog ? ? A A 9 N6 ? ? ? 1_555 A G 20 O6 ? ? A A 9 A G 20 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog22 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 19 N4 ? ? A G 10 A C 19 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog23 hydrog ? ? A A 11 N1 ? ? ? 1_555 A U 18 N3 ? ? A A 11 A U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A A 11 N6 ? ? ? 1_555 A U 18 O4 ? ? A A 11 A U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A A 12 N1 ? ? ? 1_555 A U 17 N3 ? ? A A 12 A U 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A A 12 N6 ? ? ? 1_555 A U 17 O4 ? ? A A 12 A U 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_SG_project.full_name_of_center 'Seattle Structural Genomics Center for Infectious Disease' _pdbx_SG_project.id 1 _pdbx_SG_project.initial_of_center SSGCID _pdbx_SG_project.project_name 'NIAID, National Institute of Allergy and Infectious Diseases' # _pdbx_nmr_ensemble.entry_id 7UME _pdbx_nmr_ensemble.conformers_calculated_total_number 400 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 7UME _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 '1 mM RNA (28-MER), 10 mM potassium phosphate, 95% H2O/5% D2O' '95% H2O/5% D2O' 1H_h2o solution ? 2 '1 mM RNA (28-MER), 10 mM potassium phosphate, 100% D2O' '100% D2O' 1H_d2o solution ? 3 '1 mM [U-2H] RNA (28-MER), 10 mM potassium phosphate, 100% D2O' '100% D2O' 2D_d2o solution ? 4 '1 mM [U-100% 13C; U-100% 15N] RNA (28-MER), 10 mM potassium phosphate, 100% D2O' '100% D2O' NC_h2o solution ? # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 'RNA (28-MER)' 1 ? mM 'natural abundance' 1 'potassium phosphate' 10 ? mM 'natural abundance' 2 'RNA (28-MER)' 1 ? mM 'natural abundance' 2 'potassium phosphate' 10 ? mM 'natural abundance' 3 'RNA (28-MER)' 1 ? mM '[U-2H]' 3 'potassium phosphate' 10 ? mM 'natural abundance' 4 'RNA (28-MER)' 1 ? mM '[U-100% 13C; U-100% 15N]' 4 'potassium phosphate' 10 ? mM 'natural abundance' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 6.5 _pdbx_nmr_exptl_sample_conditions.ionic_strength 50 _pdbx_nmr_exptl_sample_conditions.details ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_err ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_units mM _pdbx_nmr_exptl_sample_conditions.label condition1 _pdbx_nmr_exptl_sample_conditions.pH_err ? _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.pressure_err ? _pdbx_nmr_exptl_sample_conditions.temperature_err ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 1H-1H TOCSY' 1 isotropic 2 1 2 '2D 1H-1H TOCSY' 1 isotropic 3 1 1 '2D 1H-1H NOESY' 1 isotropic 4 1 2 '2D 1H-1H NOESY' 1 isotropic 5 1 3 '2D 1H-1H NOESY' 1 isotropic 6 1 4 '2D 1H-13C HSQC' 1 isotropic 7 1 4 '2D 1H-15N HSQC' 1 isotropic # _pdbx_nmr_refine.entry_id 7UME _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 4 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 collection TopSpin ? 'Bruker Biospin' 2 processing TopSpin ? 'Bruker Biospin' 3 'peak picking' NMRFAM-SPARKY ? NMRFAM-SPARKY 4 refinement 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' 5 'structure calculation' 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' 6 'chemical shift assignment' NMRFAM-SPARKY ? NMRFAM-SPARKY # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7UME 'double helix' 7UME 'a-form double helix' 7UME 'hairpin loop' 7UME 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 28 1_555 -0.629 0.024 -0.029 -0.791 0.551 -2.830 1 A_G1:C28_A A 1 ? A 28 ? 19 1 1 A G 2 1_555 A C 27 1_555 -0.245 -0.053 -0.103 0.968 -9.084 3.386 2 A_G2:C27_A A 2 ? A 27 ? 19 1 1 A C 3 1_555 A G 26 1_555 0.361 -0.127 -0.172 2.307 -9.486 4.231 3 A_C3:G26_A A 3 ? A 26 ? 19 1 1 A C 4 1_555 A G 25 1_555 0.408 -0.152 -0.204 -0.325 -7.138 3.967 4 A_C4:G25_A A 4 ? A 25 ? 19 1 1 A G 5 1_555 A C 24 1_555 -0.162 -0.103 -0.109 -2.961 -8.396 3.390 5 A_G5:C24_A A 5 ? A 24 ? 19 1 1 A A 6 1_555 A U 23 1_555 -0.205 -0.223 -0.047 -1.236 -11.152 -2.449 6 A_A6:U23_A A 6 ? A 23 ? 20 1 1 A C 7 1_555 A A 22 1_555 -1.106 0.242 -0.001 -0.242 -10.886 -1.690 7 A_C7:A22_A A 7 ? A 22 ? ? 1 1 A A 8 1_555 A A 21 1_555 -1.343 1.129 -0.678 3.359 -4.490 -6.261 8 A_A8:A21_A A 8 ? A 21 ? ? 1 1 A A 9 1_555 A G 20 1_555 0.605 1.237 -0.818 -1.081 -5.248 -9.972 9 A_A9:G20_A A 9 ? A 20 ? 8 1 1 A G 10 1_555 A C 19 1_555 0.313 0.486 -0.253 -5.684 -4.804 -12.589 10 A_G10:C19_A A 10 ? A 19 ? ? 1 1 A A 11 1_555 A U 18 1_555 0.597 0.491 -0.215 -8.649 -4.352 -19.012 11 A_A11:U18_A A 11 ? A 18 ? 20 1 1 A A 12 1_555 A U 17 1_555 1.790 0.142 0.062 -2.689 7.141 -25.610 12 A_A12:U17_A A 12 ? A 17 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 28 1_555 A G 2 1_555 A C 27 1_555 0.213 -1.714 3.217 0.378 5.391 33.171 -3.798 -0.310 2.912 9.366 -0.658 33.596 1 AA_G1G2:C27C28_AA A 1 ? A 28 ? A 2 ? A 27 ? 1 A G 2 1_555 A C 27 1_555 A C 3 1_555 A G 26 1_555 0.050 -1.415 3.246 0.256 3.092 35.035 -2.790 -0.046 3.114 5.123 -0.425 35.168 2 AA_G2C3:G26C27_AA A 2 ? A 27 ? A 3 ? A 26 ? 1 A C 3 1_555 A G 26 1_555 A C 4 1_555 A G 25 1_555 -0.029 -1.620 3.311 1.168 6.590 31.526 -4.052 0.254 2.919 11.960 -2.119 32.210 3 AA_C3C4:G25G26_AA A 3 ? A 26 ? A 4 ? A 25 ? 1 A C 4 1_555 A G 25 1_555 A G 5 1_555 A C 24 1_555 -0.130 -1.730 3.232 -0.287 10.240 28.072 -5.273 0.199 2.464 20.275 0.569 29.847 4 AA_C4G5:C24G25_AA A 4 ? A 25 ? A 5 ? A 24 ? 1 A G 5 1_555 A C 24 1_555 A A 6 1_555 A U 23 1_555 -0.435 -1.516 3.252 -1.251 6.115 31.284 -3.821 0.574 2.925 11.200 2.292 31.885 5 AA_G5A6:U23C24_AA A 5 ? A 24 ? A 6 ? A 23 ? 1 A A 6 1_555 A U 23 1_555 A C 7 1_555 A A 22 1_555 -0.141 -1.528 3.307 -1.115 7.973 28.893 -4.518 0.055 2.798 15.601 2.181 29.970 6 AA_A6C7:A22U23_AA A 6 ? A 23 ? A 7 ? A 22 ? 1 A C 7 1_555 A A 22 1_555 A A 8 1_555 A A 21 1_555 -0.206 -1.457 3.240 1.878 8.913 29.141 -4.410 0.737 2.670 17.191 -3.623 30.502 7 AA_C7A8:A21A22_AA A 7 ? A 22 ? A 8 ? A 21 ? 1 A A 8 1_555 A A 21 1_555 A A 9 1_555 A G 20 1_555 -0.072 -1.404 3.601 0.007 7.484 35.751 -3.338 0.116 3.251 12.028 -0.011 36.501 8 AA_A8A9:G20A21_AA A 8 ? A 21 ? A 9 ? A 20 ? 1 A A 9 1_555 A G 20 1_555 A G 10 1_555 A C 19 1_555 -0.005 -1.785 3.466 -2.486 8.920 29.644 -5.024 -0.462 2.813 16.921 4.716 31.026 9 AA_A9G10:C19G20_AA A 9 ? A 20 ? A 10 ? A 19 ? 1 A G 10 1_555 A C 19 1_555 A A 11 1_555 A U 18 1_555 -0.159 -1.723 3.421 0.545 8.726 34.021 -4.142 0.344 2.901 14.616 -0.914 35.094 10 AA_G10A11:U18C19_AA A 10 ? A 19 ? A 11 ? A 18 ? 1 A A 11 1_555 A U 18 1_555 A A 12 1_555 A U 17 1_555 -0.135 -1.618 3.366 1.473 8.472 34.593 -3.842 0.428 2.894 13.982 -2.431 35.614 11 AA_A11A12:U17U18_AA A 11 ? A 18 ? A 12 ? A 17 ? # _pdbx_audit_support.funding_organization 'Other private' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.model 'AVANCE III' _pdbx_nmr_spectrometer.type ? _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.field_strength 600 _pdbx_nmr_spectrometer.details ? # _atom_sites.entry_id 7UME _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_ #