data_7WIE # _entry.id 7WIE # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7WIE pdb_00007wie 10.2210/pdb7wie/pdb WWPDB D_1300026766 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-01-18 2 'Structure model' 1 1 2023-02-08 3 'Structure model' 1 2 2024-05-29 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' chem_comp_atom 4 3 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 2 'Structure model' '_citation_author.identifier_ORCID' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7WIE _pdbx_database_status.recvd_initial_deposition_date 2022-01-03 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email fangxy@mail.tsinghua.edu.cn _pdbx_contact_author.name_first Xianyang _pdbx_contact_author.name_last Fang _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0001-9432-9736 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Xu, L.' 1 0000-0003-1584-2772 'Fang, X.' 2 0000-0001-9432-9736 'Xiao, Y.' 3 0000-0003-2518-9594 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 51 _citation.language ? _citation.page_first 952 _citation.page_last 965 _citation.title 'Structural insights into translation regulation by the THF-II riboswitch.' _citation.year 2023 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkac1257 _citation.pdbx_database_id_PubMed 36620887 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Xu, L.' 1 ? primary 'Xiao, Y.' 2 ? primary 'Zhang, J.' 3 ? primary 'Fang, X.' 4 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (50-MER)' 16287.591 1 ? ? ? ? 2 non-polymer syn 7-DEAZAGUANINE 150.138 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GTP)GCGUGGUCCGUUCAACUCGUUCCUCGAAAGAGGAACUACGGGAGACGCC' _entity_poly.pdbx_seq_one_letter_code_can GGCGUGGUCCGUUCAACUCGUUCCUCGAAAGAGGAACUACGGGAGACGCC _entity_poly.pdbx_strand_id V _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name 7-DEAZAGUANINE _pdbx_entity_nonpoly.comp_id 7DG # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 C n 1 4 G n 1 5 U n 1 6 G n 1 7 G n 1 8 U n 1 9 C n 1 10 C n 1 11 G n 1 12 U n 1 13 U n 1 14 C n 1 15 A n 1 16 A n 1 17 C n 1 18 U n 1 19 C n 1 20 G n 1 21 U n 1 22 U n 1 23 C n 1 24 C n 1 25 U n 1 26 C n 1 27 G n 1 28 A n 1 29 A n 1 30 A n 1 31 G n 1 32 A n 1 33 G n 1 34 G n 1 35 A n 1 36 A n 1 37 C n 1 38 U n 1 39 A n 1 40 C n 1 41 G n 1 42 G n 1 43 G n 1 44 A n 1 45 G n 1 46 A n 1 47 C n 1 48 G n 1 49 C n 1 50 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 50 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Mesorhizobium loti' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 381 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 7DG non-polymer . 7-DEAZAGUANINE ? 'C6 H6 N4 O' 150.138 A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 6 6 GTP GTP V . n A 1 2 G 2 7 7 G G V . n A 1 3 C 3 8 8 C C V . n A 1 4 G 4 9 9 G G V . n A 1 5 U 5 10 10 U U V . n A 1 6 G 6 11 11 G G V . n A 1 7 G 7 12 12 G G V . n A 1 8 U 8 13 13 U U V . n A 1 9 C 9 14 14 C C V . n A 1 10 C 10 15 15 C C V . n A 1 11 G 11 16 16 G G V . n A 1 12 U 12 17 17 U U V . n A 1 13 U 13 18 18 U U V . n A 1 14 C 14 19 19 C C V . n A 1 15 A 15 20 20 A A V . n A 1 16 A 16 21 21 A A V . n A 1 17 C 17 22 22 C C V . n A 1 18 U 18 23 23 U U V . n A 1 19 C 19 24 24 C C V . n A 1 20 G 20 25 25 G G V . n A 1 21 U 21 26 26 U U V . n A 1 22 U 22 27 27 U U V . n A 1 23 C 23 28 28 C C V . n A 1 24 C 24 29 29 C C V . n A 1 25 U 25 30 30 U U V . n A 1 26 C 26 31 31 C C V . n A 1 27 G 27 32 32 G G V . n A 1 28 A 28 33 33 A A V . n A 1 29 A 29 34 34 A A V . n A 1 30 A 30 35 35 A A V . n A 1 31 G 31 37 37 G G V . n A 1 32 A 32 38 38 A A V . n A 1 33 G 33 39 39 G G V . n A 1 34 G 34 40 40 G G V . n A 1 35 A 35 41 41 A A V . n A 1 36 A 36 42 42 A A V . n A 1 37 C 37 43 43 C C V . n A 1 38 U 38 44 44 U U V . n A 1 39 A 39 45 45 A A V . n A 1 40 C 40 46 46 C C V . n A 1 41 G 41 47 47 G G V . n A 1 42 G 42 48 48 G G V . n A 1 43 G 43 49 49 G G V . n A 1 44 A 44 50 50 A A V . n A 1 45 G 45 51 51 G G V . n A 1 46 A 46 52 52 A A V . n A 1 47 C 47 53 53 C C V . n A 1 48 G 48 54 54 G G V . n A 1 49 C 49 55 55 C C V . n A 1 50 C 50 56 56 C C V . n # _pdbx_nonpoly_scheme.asym_id B _pdbx_nonpoly_scheme.entity_id 2 _pdbx_nonpoly_scheme.mon_id 7DG _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 101 _pdbx_nonpoly_scheme.auth_seq_num 101 _pdbx_nonpoly_scheme.pdb_mon_id 7DG _pdbx_nonpoly_scheme.auth_mon_id 7DG _pdbx_nonpoly_scheme.pdb_strand_id V _pdbx_nonpoly_scheme.pdb_ins_code . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.20_4459 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? 3.27 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? AutoSol ? ? ? . 5 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 7WIE _cell.details ? _cell.formula_units_Z ? _cell.length_a 66.944 _cell.length_a_esd ? _cell.length_b 66.944 _cell.length_b_esd ? _cell.length_c 94.572 _cell.length_c_esd ? _cell.volume 367042.642 _cell.volume_esd ? _cell.Z_PDB 6 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 7WIE _symmetry.cell_setting ? _symmetry.Int_Tables_number 152 _symmetry.space_group_name_Hall ;P 31 2" ; _symmetry.space_group_name_H-M 'P 31 2 1' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7WIE _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 3.77 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 67.41 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '100mM sodium citrate pH6.5, 1.5-2.5M Ammonium Sulfate' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 291 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2021-10-06 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.979 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL19U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.979 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL19U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate 93.87 _reflns.entry_id 7WIE _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.90 _reflns.d_resolution_low 50.00 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 5770 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.7 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 9.4 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 11.7 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 0.033 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.094 _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all 98354 _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.944 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.091 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.percent_possible_all _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 2.90 2.95 ? ? ? ? ? ? 519 ? ? ? ? ? ? ? ? ? ? ? 8.3 1.249 ? ? ? ? ? 1 1 ? ? ? 96.8 ? 1.132 ? ? ? ? ? ? ? ? ? 2.95 3.00 ? ? ? ? ? ? 519 ? ? ? ? ? ? ? ? ? ? ? 8.6 1.308 ? ? ? ? ? 2 1 ? ? ? 99.2 ? 0.731 ? ? ? ? ? ? ? ? ? 3.00 3.06 ? ? ? ? ? ? 501 ? ? ? ? ? ? ? ? ? ? ? 8.8 1.497 ? ? ? ? ? 3 1 ? ? ? 99.8 ? 0.403 ? ? ? ? ? ? ? ? ? 3.06 3.12 ? ? ? ? ? ? 562 ? ? ? ? ? ? ? ? ? ? ? 9.1 1.524 ? ? ? ? ? 4 1 ? ? ? 100.0 ? 0.342 ? ? ? ? ? ? ? ? ? 3.12 3.19 ? ? ? ? ? ? 515 ? ? ? ? ? ? ? ? ? ? ? 9.2 1.609 ? ? ? ? ? 5 1 ? ? ? 100.0 ? 0.290 ? ? ? ? ? ? ? ? ? 3.19 3.27 ? ? ? ? ? ? 491 ? ? ? ? ? ? ? ? ? ? ? 8.8 1.336 ? ? ? ? ? 6 1 ? ? ? 99.8 ? 0.264 ? ? ? ? ? ? ? ? ? 3.27 3.35 ? ? ? ? ? ? 576 ? ? ? ? ? ? ? ? ? ? ? 9.7 1.305 ? ? ? ? ? 7 1 ? ? ? 100.0 ? 0.186 ? ? ? ? ? ? ? ? ? 3.35 3.44 ? ? ? ? ? ? 488 ? ? ? ? ? ? ? ? ? ? ? 10.5 1.315 ? ? ? ? ? 8 1 ? ? ? 100.0 ? 0.197 ? ? ? ? ? ? ? ? ? 3.44 3.54 ? ? ? ? ? ? 553 ? ? ? ? ? ? ? ? ? ? ? 10.4 1.335 ? ? ? ? ? 9 1 ? ? ? 100.0 ? 0.209 ? ? ? ? ? ? ? ? ? 3.54 3.65 ? ? ? ? ? ? 532 ? ? ? ? ? ? ? ? ? ? ? 10.4 1.370 ? ? ? ? ? 10 1 ? ? ? 100.0 ? 0.166 ? ? ? ? ? ? ? ? ? 3.65 3.78 ? ? ? ? ? ? 510 ? ? ? ? ? ? ? ? ? ? ? 10.1 1.270 ? ? ? ? ? 11 1 ? ? ? 100.0 ? 0.133 ? ? ? ? ? ? ? ? ? 3.78 3.94 ? ? ? ? ? ? 564 ? ? ? ? ? ? ? ? ? ? ? 10.0 1.361 ? ? ? ? ? 12 1 ? ? ? 100.0 ? 0.124 ? ? ? ? ? ? ? ? ? 3.94 4.11 ? ? ? ? ? ? 497 ? ? ? ? ? ? ? ? ? ? ? 9.7 1.419 ? ? ? ? ? 13 1 ? ? ? 100.0 ? 0.120 ? ? ? ? ? ? ? ? ? 4.11 4.33 ? ? ? ? ? ? 505 ? ? ? ? ? ? ? ? ? ? ? 8.4 1.404 ? ? ? ? ? 14 1 ? ? ? 100.0 ? 0.104 ? ? ? ? ? ? ? ? ? 4.33 4.60 ? ? ? ? ? ? 522 ? ? ? ? ? ? ? ? ? ? ? 9.9 1.033 ? ? ? ? ? 15 1 ? ? ? 100.0 ? 0.099 ? ? ? ? ? ? ? ? ? 4.60 4.96 ? ? ? ? ? ? 524 ? ? ? ? ? ? ? ? ? ? ? 9.7 1.064 ? ? ? ? ? 16 1 ? ? ? 100.0 ? 0.097 ? ? ? ? ? ? ? ? ? 4.96 5.46 ? ? ? ? ? ? 532 ? ? ? ? ? ? ? ? ? ? ? 9.4 1.201 ? ? ? ? ? 17 1 ? ? ? 99.8 ? 0.089 ? ? ? ? ? ? ? ? ? 5.46 6.24 ? ? ? ? ? ? 541 ? ? ? ? ? ? ? ? ? ? ? 8.6 1.224 ? ? ? ? ? 18 1 ? ? ? 100.0 ? 0.083 ? ? ? ? ? ? ? ? ? 6.24 7.86 ? ? ? ? ? ? 533 ? ? ? ? ? ? ? ? ? ? ? 9.0 1.335 ? ? ? ? ? 19 1 ? ? ? 100.0 ? 0.078 ? ? ? ? ? ? ? ? ? 7.86 50.00 ? ? ? ? ? ? 531 ? ? ? ? ? ? ? ? ? ? ? 8.2 1.427 ? ? ? ? ? 20 1 ? ? ? 99.3 ? 0.070 ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 108.24 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7WIE _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.90 _refine.ls_d_res_low 28.99 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 5708 _refine.ls_number_reflns_R_free 288 _refine.ls_number_reflns_R_work 5420 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.18 _refine.ls_percent_reflns_R_free 5.05 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.1749 _refine.ls_R_factor_R_free 0.2047 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1734 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 7WI9 _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1000 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 23.2049 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.1112 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.90 _refine_hist.d_res_low 28.99 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 1090 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1079 _refine_hist.pdbx_number_atoms_ligand 11 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0023 ? 1217 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.6437 ? 1897 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0314 ? 252 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0029 ? 51 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 11.2422 ? 621 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.90 3.65 . . 136 2644 98.55 . . . . 0.2500 . . . . . . . . . . . 0.2860 'X-RAY DIFFRACTION' 3.65 28.99 . . 152 2776 99.80 . . . . 0.1556 . . . . . . . . . . . 0.1854 # _struct.entry_id 7WIE _struct.title 'The THF-II riboswitch bound to 7DG' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7WIE _struct_keywords.text 'Holo form, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7WIE _struct_ref.pdbx_db_accession 7WIE _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7WIE _struct_ref_seq.pdbx_strand_id V _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 50 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7WIE _struct_ref_seq.db_align_beg 6 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 56 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 6 _struct_ref_seq.pdbx_auth_seq_align_end 56 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? V GTP 6 V G 7 1_555 ? ? ? ? ? ? ? 1.602 ? ? hydrog1 hydrog ? ? A GTP 1 N1 ? ? ? 1_555 A C 50 N3 ? ? V GTP 6 V C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A GTP 1 N2 ? ? ? 1_555 A C 50 O2 ? ? V GTP 6 V C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A GTP 1 O6 ? ? ? 1_555 A C 50 N4 ? ? V GTP 6 V C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 49 N3 ? ? V G 7 V C 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 49 O2 ? ? V G 7 V C 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 49 N4 ? ? V G 7 V C 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 48 N1 ? ? V C 8 V G 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 48 O6 ? ? V C 8 V G 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 48 N2 ? ? V C 8 V G 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 47 N3 ? ? V G 9 V C 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 47 O2 ? ? V G 9 V C 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 47 N4 ? ? V G 9 V C 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 46 N1 ? ? V U 10 V A 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 46 N6 ? ? V U 10 V A 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 6 N7 ? ? ? 1_555 A G 45 N2 ? ? V G 11 V G 51 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog16 hydrog ? ? A G 6 O6 ? ? ? 1_555 A G 45 N1 ? ? V G 11 V G 51 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog17 hydrog ? ? A G 7 N1 ? ? ? 1_555 A A 44 N1 ? ? V G 12 V A 50 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog18 hydrog ? ? A G 7 O6 ? ? ? 1_555 A A 44 N6 ? ? V G 12 V A 50 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog19 hydrog ? ? A U 8 N3 ? ? ? 1_555 A G 43 O6 ? ? V U 13 V G 49 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog20 hydrog ? ? A U 8 O2 ? ? ? 1_555 A G 43 N1 ? ? V U 13 V G 49 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog21 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 42 N1 ? ? V C 14 V G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 42 O6 ? ? V C 14 V G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 42 N2 ? ? V C 14 V G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 41 N1 ? ? V C 15 V G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 41 O6 ? ? V C 15 V G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 41 N2 ? ? V C 15 V G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 40 N3 ? ? V G 16 V C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 40 O2 ? ? V G 16 V C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 40 N4 ? ? V G 16 V C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 12 O2 ? ? ? 1_555 A A 15 N6 ? ? V U 17 V A 20 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog31 hydrog ? ? A U 12 N3 ? ? ? 1_555 A A 39 N1 ? ? V U 17 V A 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A U 12 O4 ? ? ? 1_555 A A 39 N6 ? ? V U 17 V A 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A A 15 N6 ? ? ? 1_555 A C 40 O2 ? ? V A 20 V C 46 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog34 hydrog ? ? A A 16 N6 ? ? ? 1_555 A A 39 N3 ? ? V A 21 V A 45 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog35 hydrog ? ? A G 20 N1 ? ? ? 1_555 A C 37 N3 ? ? V G 25 V C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 20 N2 ? ? ? 1_555 A C 37 O2 ? ? V G 25 V C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 20 O6 ? ? ? 1_555 A C 37 N4 ? ? V G 25 V C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A U 21 N3 ? ? ? 1_555 A A 36 N1 ? ? V U 26 V A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 21 O4 ? ? ? 1_555 A A 36 N6 ? ? V U 26 V A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 35 N1 ? ? V U 27 V A 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 35 N6 ? ? V U 27 V A 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 23 N3 ? ? ? 1_555 A G 34 N1 ? ? V C 28 V G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 23 N4 ? ? ? 1_555 A G 34 O6 ? ? V C 28 V G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 23 O2 ? ? ? 1_555 A G 34 N2 ? ? V C 28 V G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 24 N3 ? ? ? 1_555 A G 33 N1 ? ? V C 29 V G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 24 N4 ? ? ? 1_555 A G 33 O6 ? ? V C 29 V G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 33 N2 ? ? V C 29 V G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A U 25 N3 ? ? ? 1_555 A A 32 N1 ? ? V U 30 V A 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A U 25 O4 ? ? ? 1_555 A A 32 N6 ? ? V U 30 V A 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 26 N3 ? ? ? 1_555 A G 31 N1 ? ? V C 31 V G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A C 26 N4 ? ? ? 1_555 A G 31 O6 ? ? V C 31 V G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 26 O2 ? ? ? 1_555 A G 31 N2 ? ? V C 31 V G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 27 N2 ? ? ? 1_555 A A 30 N7 ? ? V G 32 V A 35 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _pdbx_entry_details.entry_id 7WIE _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 7DG N9 N N N 1 7DG C8 C N N 2 7DG C7 C N N 3 7DG C5 C N N 4 7DG C6 C N N 5 7DG O6 O N N 6 7DG N1 N N N 7 7DG C2 C N N 8 7DG N2 N N N 9 7DG N3 N N N 10 7DG C4 C N N 11 7DG H8 H N N 12 7DG H71 H N N 13 7DG H72 H N N 14 7DG HN1 H N N 15 7DG HN21 H N N 16 7DG HN22 H N N 17 A OP3 O N N 18 A P P N N 19 A OP1 O N N 20 A OP2 O N N 21 A "O5'" O N N 22 A "C5'" C N N 23 A "C4'" C N R 24 A "O4'" O N N 25 A "C3'" C N S 26 A "O3'" O N N 27 A "C2'" C N R 28 A "O2'" O N N 29 A "C1'" C N R 30 A N9 N Y N 31 A C8 C Y N 32 A N7 N Y N 33 A C5 C Y N 34 A C6 C Y N 35 A N6 N N N 36 A N1 N Y N 37 A C2 C Y N 38 A N3 N Y N 39 A C4 C Y N 40 A HOP3 H N N 41 A HOP2 H N N 42 A "H5'" H N N 43 A "H5''" H N N 44 A "H4'" H N N 45 A "H3'" H N N 46 A "HO3'" H N N 47 A "H2'" H N N 48 A "HO2'" H N N 49 A "H1'" H N N 50 A H8 H N N 51 A H61 H N N 52 A H62 H N N 53 A H2 H N N 54 C OP3 O N N 55 C P P N N 56 C OP1 O N N 57 C OP2 O N N 58 C "O5'" O N N 59 C "C5'" C N N 60 C "C4'" C N R 61 C "O4'" O N N 62 C "C3'" C N S 63 C "O3'" O N N 64 C "C2'" C N R 65 C "O2'" O N N 66 C "C1'" C N R 67 C N1 N N N 68 C C2 C N N 69 C O2 O N N 70 C N3 N N N 71 C C4 C N N 72 C N4 N N N 73 C C5 C N N 74 C C6 C N N 75 C HOP3 H N N 76 C HOP2 H N N 77 C "H5'" H N N 78 C "H5''" H N N 79 C "H4'" H N N 80 C "H3'" H N N 81 C "HO3'" H N N 82 C "H2'" H N N 83 C "HO2'" H N N 84 C "H1'" H N N 85 C H41 H N N 86 C H42 H N N 87 C H5 H N N 88 C H6 H N N 89 G OP3 O N N 90 G P P N N 91 G OP1 O N N 92 G OP2 O N N 93 G "O5'" O N N 94 G "C5'" C N N 95 G "C4'" C N R 96 G "O4'" O N N 97 G "C3'" C N S 98 G "O3'" O N N 99 G "C2'" C N R 100 G "O2'" O N N 101 G "C1'" C N R 102 G N9 N Y N 103 G C8 C Y N 104 G N7 N Y N 105 G C5 C Y N 106 G C6 C N N 107 G O6 O N N 108 G N1 N N N 109 G C2 C N N 110 G N2 N N N 111 G N3 N N N 112 G C4 C Y N 113 G HOP3 H N N 114 G HOP2 H N N 115 G "H5'" H N N 116 G "H5''" H N N 117 G "H4'" H N N 118 G "H3'" H N N 119 G "HO3'" H N N 120 G "H2'" H N N 121 G "HO2'" H N N 122 G "H1'" H N N 123 G H8 H N N 124 G H1 H N N 125 G H21 H N N 126 G H22 H N N 127 GTP PG P N N 128 GTP O1G O N N 129 GTP O2G O N N 130 GTP O3G O N N 131 GTP O3B O N N 132 GTP PB P N N 133 GTP O1B O N N 134 GTP O2B O N N 135 GTP O3A O N N 136 GTP PA P N N 137 GTP O1A O N N 138 GTP O2A O N N 139 GTP "O5'" O N N 140 GTP "C5'" C N N 141 GTP "C4'" C N R 142 GTP "O4'" O N N 143 GTP "C3'" C N S 144 GTP "O3'" O N N 145 GTP "C2'" C N R 146 GTP "O2'" O N N 147 GTP "C1'" C N R 148 GTP N9 N Y N 149 GTP C8 C Y N 150 GTP N7 N Y N 151 GTP C5 C Y N 152 GTP C6 C N N 153 GTP O6 O N N 154 GTP N1 N N N 155 GTP C2 C N N 156 GTP N2 N N N 157 GTP N3 N N N 158 GTP C4 C Y N 159 GTP HOG2 H N N 160 GTP HOG3 H N N 161 GTP HOB2 H N N 162 GTP HOA2 H N N 163 GTP "H5'" H N N 164 GTP "H5''" H N N 165 GTP "H4'" H N N 166 GTP "H3'" H N N 167 GTP "HO3'" H N N 168 GTP "H2'" H N N 169 GTP "HO2'" H N N 170 GTP "H1'" H N N 171 GTP H8 H N N 172 GTP HN1 H N N 173 GTP HN21 H N N 174 GTP HN22 H N N 175 U OP3 O N N 176 U P P N N 177 U OP1 O N N 178 U OP2 O N N 179 U "O5'" O N N 180 U "C5'" C N N 181 U "C4'" C N R 182 U "O4'" O N N 183 U "C3'" C N S 184 U "O3'" O N N 185 U "C2'" C N R 186 U "O2'" O N N 187 U "C1'" C N R 188 U N1 N N N 189 U C2 C N N 190 U O2 O N N 191 U N3 N N N 192 U C4 C N N 193 U O4 O N N 194 U C5 C N N 195 U C6 C N N 196 U HOP3 H N N 197 U HOP2 H N N 198 U "H5'" H N N 199 U "H5''" H N N 200 U "H4'" H N N 201 U "H3'" H N N 202 U "HO3'" H N N 203 U "H2'" H N N 204 U "HO2'" H N N 205 U "H1'" H N N 206 U H3 H N N 207 U H5 H N N 208 U H6 H N N 209 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 7DG N9 C8 doub N N 1 7DG N9 C4 sing N N 2 7DG C8 C7 sing N N 3 7DG C8 H8 sing N N 4 7DG C7 C5 sing N N 5 7DG C7 H71 sing N N 6 7DG C7 H72 sing N N 7 7DG C5 C6 sing N N 8 7DG C5 C4 doub N N 9 7DG C6 O6 doub N N 10 7DG C6 N1 sing N N 11 7DG N1 C2 sing N N 12 7DG N1 HN1 sing N N 13 7DG C2 N2 sing N N 14 7DG C2 N3 doub N N 15 7DG N2 HN21 sing N N 16 7DG N2 HN22 sing N N 17 7DG N3 C4 sing N N 18 A OP3 P sing N N 19 A OP3 HOP3 sing N N 20 A P OP1 doub N N 21 A P OP2 sing N N 22 A P "O5'" sing N N 23 A OP2 HOP2 sing N N 24 A "O5'" "C5'" sing N N 25 A "C5'" "C4'" sing N N 26 A "C5'" "H5'" sing N N 27 A "C5'" "H5''" sing N N 28 A "C4'" "O4'" sing N N 29 A "C4'" "C3'" sing N N 30 A "C4'" "H4'" sing N N 31 A "O4'" "C1'" sing N N 32 A "C3'" "O3'" sing N N 33 A "C3'" "C2'" sing N N 34 A "C3'" "H3'" sing N N 35 A "O3'" "HO3'" sing N N 36 A "C2'" "O2'" sing N N 37 A "C2'" "C1'" sing N N 38 A "C2'" "H2'" sing N N 39 A "O2'" "HO2'" sing N N 40 A "C1'" N9 sing N N 41 A "C1'" "H1'" sing N N 42 A N9 C8 sing Y N 43 A N9 C4 sing Y N 44 A C8 N7 doub Y N 45 A C8 H8 sing N N 46 A N7 C5 sing Y N 47 A C5 C6 sing Y N 48 A C5 C4 doub Y N 49 A C6 N6 sing N N 50 A C6 N1 doub Y N 51 A N6 H61 sing N N 52 A N6 H62 sing N N 53 A N1 C2 sing Y N 54 A C2 N3 doub Y N 55 A C2 H2 sing N N 56 A N3 C4 sing Y N 57 C OP3 P sing N N 58 C OP3 HOP3 sing N N 59 C P OP1 doub N N 60 C P OP2 sing N N 61 C P "O5'" sing N N 62 C OP2 HOP2 sing N N 63 C "O5'" "C5'" sing N N 64 C "C5'" "C4'" sing N N 65 C "C5'" "H5'" sing N N 66 C "C5'" "H5''" sing N N 67 C "C4'" "O4'" sing N N 68 C "C4'" "C3'" sing N N 69 C "C4'" "H4'" sing N N 70 C "O4'" "C1'" sing N N 71 C "C3'" "O3'" sing N N 72 C "C3'" "C2'" sing N N 73 C "C3'" "H3'" sing N N 74 C "O3'" "HO3'" sing N N 75 C "C2'" "O2'" sing N N 76 C "C2'" "C1'" sing N N 77 C "C2'" "H2'" sing N N 78 C "O2'" "HO2'" sing N N 79 C "C1'" N1 sing N N 80 C "C1'" "H1'" sing N N 81 C N1 C2 sing N N 82 C N1 C6 sing N N 83 C C2 O2 doub N N 84 C C2 N3 sing N N 85 C N3 C4 doub N N 86 C C4 N4 sing N N 87 C C4 C5 sing N N 88 C N4 H41 sing N N 89 C N4 H42 sing N N 90 C C5 C6 doub N N 91 C C5 H5 sing N N 92 C C6 H6 sing N N 93 G OP3 P sing N N 94 G OP3 HOP3 sing N N 95 G P OP1 doub N N 96 G P OP2 sing N N 97 G P "O5'" sing N N 98 G OP2 HOP2 sing N N 99 G "O5'" "C5'" sing N N 100 G "C5'" "C4'" sing N N 101 G "C5'" "H5'" sing N N 102 G "C5'" "H5''" sing N N 103 G "C4'" "O4'" sing N N 104 G "C4'" "C3'" sing N N 105 G "C4'" "H4'" sing N N 106 G "O4'" "C1'" sing N N 107 G "C3'" "O3'" sing N N 108 G "C3'" "C2'" sing N N 109 G "C3'" "H3'" sing N N 110 G "O3'" "HO3'" sing N N 111 G "C2'" "O2'" sing N N 112 G "C2'" "C1'" sing N N 113 G "C2'" "H2'" sing N N 114 G "O2'" "HO2'" sing N N 115 G "C1'" N9 sing N N 116 G "C1'" "H1'" sing N N 117 G N9 C8 sing Y N 118 G N9 C4 sing Y N 119 G C8 N7 doub Y N 120 G C8 H8 sing N N 121 G N7 C5 sing Y N 122 G C5 C6 sing N N 123 G C5 C4 doub Y N 124 G C6 O6 doub N N 125 G C6 N1 sing N N 126 G N1 C2 sing N N 127 G N1 H1 sing N N 128 G C2 N2 sing N N 129 G C2 N3 doub N N 130 G N2 H21 sing N N 131 G N2 H22 sing N N 132 G N3 C4 sing N N 133 GTP PG O1G doub N N 134 GTP PG O2G sing N N 135 GTP PG O3G sing N N 136 GTP PG O3B sing N N 137 GTP O2G HOG2 sing N N 138 GTP O3G HOG3 sing N N 139 GTP O3B PB sing N N 140 GTP PB O1B doub N N 141 GTP PB O2B sing N N 142 GTP PB O3A sing N N 143 GTP O2B HOB2 sing N N 144 GTP O3A PA sing N N 145 GTP PA O1A doub N N 146 GTP PA O2A sing N N 147 GTP PA "O5'" sing N N 148 GTP O2A HOA2 sing N N 149 GTP "O5'" "C5'" sing N N 150 GTP "C5'" "C4'" sing N N 151 GTP "C5'" "H5'" sing N N 152 GTP "C5'" "H5''" sing N N 153 GTP "C4'" "O4'" sing N N 154 GTP "C4'" "C3'" sing N N 155 GTP "C4'" "H4'" sing N N 156 GTP "O4'" "C1'" sing N N 157 GTP "C3'" "O3'" sing N N 158 GTP "C3'" "C2'" sing N N 159 GTP "C3'" "H3'" sing N N 160 GTP "O3'" "HO3'" sing N N 161 GTP "C2'" "O2'" sing N N 162 GTP "C2'" "C1'" sing N N 163 GTP "C2'" "H2'" sing N N 164 GTP "O2'" "HO2'" sing N N 165 GTP "C1'" N9 sing N N 166 GTP "C1'" "H1'" sing N N 167 GTP N9 C8 sing Y N 168 GTP N9 C4 sing Y N 169 GTP C8 N7 doub Y N 170 GTP C8 H8 sing N N 171 GTP N7 C5 sing Y N 172 GTP C5 C6 sing N N 173 GTP C5 C4 doub Y N 174 GTP C6 O6 doub N N 175 GTP C6 N1 sing N N 176 GTP N1 C2 sing N N 177 GTP N1 HN1 sing N N 178 GTP C2 N2 sing N N 179 GTP C2 N3 doub N N 180 GTP N2 HN21 sing N N 181 GTP N2 HN22 sing N N 182 GTP N3 C4 sing N N 183 U OP3 P sing N N 184 U OP3 HOP3 sing N N 185 U P OP1 doub N N 186 U P OP2 sing N N 187 U P "O5'" sing N N 188 U OP2 HOP2 sing N N 189 U "O5'" "C5'" sing N N 190 U "C5'" "C4'" sing N N 191 U "C5'" "H5'" sing N N 192 U "C5'" "H5''" sing N N 193 U "C4'" "O4'" sing N N 194 U "C4'" "C3'" sing N N 195 U "C4'" "H4'" sing N N 196 U "O4'" "C1'" sing N N 197 U "C3'" "O3'" sing N N 198 U "C3'" "C2'" sing N N 199 U "C3'" "H3'" sing N N 200 U "O3'" "HO3'" sing N N 201 U "C2'" "O2'" sing N N 202 U "C2'" "C1'" sing N N 203 U "C2'" "H2'" sing N N 204 U "O2'" "HO2'" sing N N 205 U "C1'" N1 sing N N 206 U "C1'" "H1'" sing N N 207 U N1 C2 sing N N 208 U N1 C6 sing N N 209 U C2 O2 doub N N 210 U C2 N3 sing N N 211 U N3 C4 sing N N 212 U N3 H3 sing N N 213 U C4 O4 doub N N 214 U C4 C5 sing N N 215 U C5 C6 doub N N 216 U C5 H5 sing N N 217 U C6 H6 sing N N 218 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7WIE 'double helix' 7WIE 'a-form double helix' 7WIE 'hairpin loop' 7WIE tetraloop 7WIE 'mismatched base pair' 7WIE 'internal loop' 7WIE 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A GTP 1 1_555 A C 50 1_555 -1.548 -0.151 -0.054 -5.839 -9.324 5.329 1 V_GTP6:C56_V V 6 ? V 56 ? 19 1 1 A G 2 1_555 A C 49 1_555 -0.589 -0.158 0.037 -3.791 -10.183 0.401 2 V_G7:C55_V V 7 ? V 55 ? 19 1 1 A C 3 1_555 A G 48 1_555 0.875 -0.218 0.286 -0.369 -11.428 4.479 3 V_C8:G54_V V 8 ? V 54 ? 19 1 1 A G 4 1_555 A C 47 1_555 -0.140 -0.025 0.316 -1.706 -11.828 4.453 4 V_G9:C53_V V 9 ? V 53 ? 19 1 1 A U 5 1_555 A A 46 1_555 0.324 -0.029 0.265 -7.514 -15.337 11.996 5 V_U10:A52_V V 10 ? V 52 ? 20 1 1 A G 6 1_555 A G 45 1_555 -1.922 -3.398 -0.434 14.061 3.012 83.960 6 V_G11:G51_V V 11 ? V 51 ? 6 3 1 A G 7 1_555 A A 44 1_555 0.321 1.703 -0.141 5.589 -11.203 -1.291 7 V_G12:A50_V V 12 ? V 50 ? 8 1 1 A U 8 1_555 A G 43 1_555 2.386 -0.501 0.030 7.231 -13.781 1.965 8 V_U13:G49_V V 13 ? V 49 ? 28 1 1 A C 9 1_555 A G 42 1_555 0.586 -0.158 -0.165 11.837 -12.066 3.121 9 V_C14:G48_V V 14 ? V 48 ? 19 1 1 A C 10 1_555 A G 41 1_555 0.230 -0.279 0.164 -0.323 -6.268 -0.010 10 V_C15:G47_V V 15 ? V 47 ? 19 1 1 A G 11 1_555 A C 40 1_555 -0.440 -0.368 0.136 -3.094 -13.723 2.509 11 V_G16:C46_V V 16 ? V 46 ? 19 1 1 A U 12 1_555 A A 39 1_555 -0.310 0.104 -0.438 16.145 -1.520 -2.057 12 V_U17:A45_V V 17 ? V 45 ? 20 1 1 A G 20 1_555 A C 37 1_555 -0.633 -0.211 0.579 -0.287 -9.353 -2.232 13 V_G25:C43_V V 25 ? V 43 ? 19 1 1 A U 21 1_555 A A 36 1_555 -0.082 -0.369 0.354 -7.307 -13.443 -4.989 14 V_U26:A42_V V 26 ? V 42 ? 20 1 1 A U 22 1_555 A A 35 1_555 -0.013 -0.298 0.067 0.469 -7.533 0.584 15 V_U27:A41_V V 27 ? V 41 ? 20 1 1 A C 23 1_555 A G 34 1_555 -0.122 -0.062 -0.116 6.424 -5.440 4.826 16 V_C28:G40_V V 28 ? V 40 ? 19 1 1 A C 24 1_555 A G 33 1_555 0.200 -0.145 -0.088 5.752 -7.640 7.614 17 V_C29:G39_V V 29 ? V 39 ? 19 1 1 A U 25 1_555 A A 32 1_555 0.031 -0.217 0.202 -1.516 -5.561 2.420 18 V_U30:A38_V V 30 ? V 38 ? 20 1 1 A C 26 1_555 A G 31 1_555 0.529 -0.144 0.145 1.749 5.135 4.569 19 V_C31:G37_V V 31 ? V 37 ? 19 1 1 A G 27 1_555 A A 30 1_555 7.027 -5.327 1.138 14.913 8.239 -9.413 20 V_G32:A35_V V 32 ? V 35 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A GTP 1 1_555 A C 50 1_555 A G 2 1_555 A C 49 1_555 -0.308 -1.958 3.239 -2.922 2.360 33.655 -3.732 0.071 3.113 4.060 5.028 33.857 1 VV_GTP6G7:C55C56_VV V 6 ? V 56 ? V 7 ? V 55 ? 1 A G 2 1_555 A C 49 1_555 A C 3 1_555 A G 48 1_555 -0.202 -1.846 3.115 -2.517 1.057 36.319 -3.093 -0.007 3.068 1.693 4.030 36.418 2 VV_G7C8:G54C55_VV V 7 ? V 55 ? V 8 ? V 54 ? 1 A C 3 1_555 A G 48 1_555 A G 4 1_555 A C 47 1_555 0.099 -1.877 2.921 -0.657 8.388 28.638 -5.068 -0.304 2.289 16.512 1.294 29.824 3 VV_C8G9:C53G54_VV V 8 ? V 54 ? V 9 ? V 53 ? 1 A G 4 1_555 A C 47 1_555 A U 5 1_555 A A 46 1_555 0.219 -1.256 3.310 1.289 10.673 35.038 -3.409 -0.178 2.826 17.233 -2.081 36.601 4 VV_G9U10:A52C53_VV V 9 ? V 53 ? V 10 ? V 52 ? 1 A U 5 1_555 A A 46 1_555 A G 6 1_555 A G 45 1_555 -0.109 -3.051 -1.069 -169.807 34.428 172.560 -1.519 0.089 -1.099 17.215 84.911 179.563 5 VV_U10G11:G51A52_VV V 10 ? V 52 ? V 11 ? V 51 ? 1 A G 6 1_555 A G 45 1_555 A G 7 1_555 A A 44 1_555 -0.461 -3.269 -2.217 133.050 -104.035 116.093 -1.921 -0.133 -1.013 -52.533 -67.184 174.129 6 VV_G11G12:A50G51_VV V 11 ? V 51 ? V 12 ? V 50 ? 1 A G 7 1_555 A A 44 1_555 A U 8 1_555 A G 43 1_555 -0.188 -1.503 3.106 -2.374 6.448 40.741 -2.767 0.032 2.852 9.183 3.380 41.292 7 VV_G12U13:G49A50_VV V 12 ? V 50 ? V 13 ? V 49 ? 1 A U 8 1_555 A G 43 1_555 A C 9 1_555 A G 42 1_555 0.351 -1.735 2.859 3.580 8.815 29.824 -4.566 -0.105 2.291 16.603 -6.743 31.272 8 VV_U13C14:G48G49_VV V 13 ? V 49 ? V 14 ? V 48 ? 1 A C 9 1_555 A G 42 1_555 A C 10 1_555 A G 41 1_555 -0.999 -2.386 3.475 -5.696 8.144 25.850 -6.940 0.725 2.763 17.407 12.174 27.664 9 VV_C14C15:G47G48_VV V 14 ? V 48 ? V 15 ? V 47 ? 1 A C 10 1_555 A G 41 1_555 A G 11 1_555 A C 40 1_555 0.284 -2.327 3.199 1.488 8.188 27.033 -6.436 -0.278 2.415 17.011 -3.092 28.262 10 VV_C15G16:C46G47_VV V 15 ? V 47 ? V 16 ? V 46 ? 1 A G 11 1_555 A C 40 1_555 A U 12 1_555 A A 39 1_555 -0.236 -1.358 2.921 5.428 4.036 28.625 -3.419 1.466 2.621 8.023 -10.789 29.397 11 VV_G16U17:A45C46_VV V 16 ? V 46 ? V 17 ? V 45 ? 1 A G 20 1_555 A C 37 1_555 A U 21 1_555 A A 36 1_555 -0.481 -1.582 3.380 1.111 3.722 36.465 -3.028 0.919 3.193 5.927 -1.769 36.665 12 VV_G25U26:A42C43_VV V 25 ? V 43 ? V 26 ? V 42 ? 1 A U 21 1_555 A A 36 1_555 A U 22 1_555 A A 35 1_555 0.162 -1.466 2.953 1.634 4.815 32.133 -3.352 -0.040 2.715 8.631 -2.929 32.523 13 VV_U26U27:A41A42_VV V 26 ? V 42 ? V 27 ? V 41 ? 1 A U 22 1_555 A A 35 1_555 A C 23 1_555 A G 34 1_555 0.688 -1.905 3.178 -0.832 0.810 27.050 -4.265 -1.671 3.099 1.730 1.778 27.074 14 VV_U27C28:G40A41_VV V 27 ? V 41 ? V 28 ? V 40 ? 1 A C 23 1_555 A G 34 1_555 A C 24 1_555 A G 33 1_555 -0.204 -1.978 3.227 -1.301 4.063 31.684 -4.292 0.146 2.962 7.399 2.369 31.962 15 VV_C28C29:G39G40_VV V 28 ? V 40 ? V 29 ? V 39 ? 1 A C 24 1_555 A G 33 1_555 A U 25 1_555 A A 32 1_555 -0.504 -1.948 3.375 -4.729 5.901 28.812 -5.009 0.006 2.970 11.609 9.302 29.767 16 VV_C29U30:A38G39_VV V 29 ? V 39 ? V 30 ? V 38 ? 1 A U 25 1_555 A A 32 1_555 A C 26 1_555 A G 31 1_555 -0.102 -1.812 3.172 -0.630 4.740 34.374 -3.717 0.080 2.905 7.973 1.059 34.695 17 VV_U30C31:G37A38_VV V 30 ? V 38 ? V 31 ? V 37 ? 1 A C 26 1_555 A G 31 1_555 A G 27 1_555 A A 30 1_555 -1.959 -1.155 2.808 -1.111 11.912 53.453 -1.852 2.078 2.553 13.059 1.218 54.679 18 VV_C31G32:A35G37_VV V 31 ? V 37 ? V 32 ? V 35 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id 7DG _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id 7DG _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 7WI9 _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 7WIE _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.014938 _atom_sites.fract_transf_matrix[1][2] 0.008624 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.017249 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.010574 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_