data_7DD4 # _entry.id 7DD4 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.391 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7DD4 pdb_00007dd4 10.2210/pdb7dd4/pdb WWPDB D_1300019003 ? ? BMRB 36393 ? 10.13018/BMR36393 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2021-06-09 2 'Structure model' 1 1 2023-06-14 3 'Structure model' 1 2 2024-05-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 2 'Structure model' Other 3 3 'Structure model' 'Data collection' 4 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' database_2 2 2 'Structure model' pdbx_database_status 3 3 'Structure model' chem_comp_atom 4 3 'Structure model' chem_comp_bond 5 3 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_database_2.pdbx_DOI' 2 2 'Structure model' '_database_2.pdbx_database_accession' 3 2 'Structure model' '_pdbx_database_status.status_code_nmr_data' 4 3 'Structure model' '_database_2.pdbx_DOI' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.entry_id 7DD4 _pdbx_database_status.recvd_initial_deposition_date 2020-10-27 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs REL _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name BMRB _pdbx_database_related.details 'Solution structure of an RNA derived from the joint region of the TAR and PolyA stems of HIV-1 genomic RNA' _pdbx_database_related.db_id 36393 _pdbx_database_related.content_type unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Obayashi, C.M.' 1 ? 'Shinohara, Y.' 2 ? 'Masuda, T.' 3 0000-0002-8958-9602 'Kawai, G.' 4 0000-0003-1480-2840 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Sci Rep' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2045-2322 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 11 _citation.language ? _citation.page_first 10920 _citation.page_last 10920 _citation.title ;Influence of the 5'-terminal sequences on the 5'-UTR structure of HIV-1 genomic RNA. ; _citation.year 2021 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41598-021-90427-9 _citation.pdbx_database_id_PubMed 34035384 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Obayashi, C.M.' 1 ? primary 'Shinohara, Y.' 2 ? primary 'Masuda, T.' 3 ? primary 'Kawai, G.' 4 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (36-MER)' _entity.formula_weight 11558.872 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGUCUCUCUUCGGGGAACCCACUGCGAAAGUAGUGU _entity_poly.pdbx_seq_one_letter_code_can GGUCUCUCUUCGGGGAACCCACUGCGAAAGUAGUGU _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 U n 1 4 C n 1 5 U n 1 6 C n 1 7 U n 1 8 C n 1 9 U n 1 10 U n 1 11 C n 1 12 G n 1 13 G n 1 14 G n 1 15 G n 1 16 A n 1 17 A n 1 18 C n 1 19 C n 1 20 C n 1 21 A n 1 22 C n 1 23 U n 1 24 G n 1 25 C n 1 26 G n 1 27 A n 1 28 A n 1 29 A n 1 30 G n 1 31 U n 1 32 A n 1 33 G n 1 34 U n 1 35 G n 1 36 U n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 36 _pdbx_entity_src_syn.organism_scientific 'Human immunodeficiency virus 1' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 11676 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 2 2 G G A . n A 1 2 G 2 3 3 G G A . n A 1 3 U 3 4 4 U U A . n A 1 4 C 4 5 5 C C A . n A 1 5 U 5 6 6 U U A . n A 1 6 C 6 7 7 C C A . n A 1 7 U 7 8 8 U U A . n A 1 8 C 8 9 9 C C A . n A 1 9 U 9 10 10 U U A . n A 1 10 U 10 11 11 U U A . n A 1 11 C 11 12 12 C C A . n A 1 12 G 12 13 13 G G A . n A 1 13 G 13 14 14 G G A . n A 1 14 G 14 15 15 G G A . n A 1 15 G 15 16 16 G G A . n A 1 16 A 16 17 17 A A A . n A 1 17 A 17 18 18 A A A . n A 1 18 C 18 19 19 C C A . n A 1 19 C 19 20 20 C C A . n A 1 20 C 20 21 21 C C A . n A 1 21 A 21 22 22 A A A . n A 1 22 C 22 23 23 C C A . n A 1 23 U 23 24 24 U U A . n A 1 24 G 24 25 25 G G A . n A 1 25 C 25 26 26 C C A . n A 1 26 G 26 27 27 G G A . n A 1 27 A 27 28 28 A A A . n A 1 28 A 28 29 29 A A A . n A 1 29 A 29 30 30 A A A . n A 1 30 G 30 31 31 G G A . n A 1 31 U 31 32 32 U U A . n A 1 32 A 32 33 33 A A A . n A 1 33 G 33 34 34 G G A . n A 1 34 U 34 35 35 U U A . n A 1 35 G 35 36 36 G G A . n A 1 36 U 36 37 37 U U A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7DD4 _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 7DD4 _struct.title 'Solution structure of an RNA derived from the joint region of the TAR and PolyA stems of HIV-1 genomic RNA' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7DD4 _struct_keywords.text 'HIV-1, TAR-PolyA region, RNA' _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7DD4 _struct_ref.pdbx_db_accession 7DD4 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7DD4 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 36 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7DD4 _struct_ref_seq.db_align_beg 2 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 37 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 2 _struct_ref_seq.pdbx_auth_seq_align_end 37 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 19 N3 ? ? A G 2 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 19 O2 ? ? A G 2 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 19 N4 ? ? A G 2 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 18 N3 ? ? A G 3 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 18 O2 ? ? A G 3 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 18 N4 ? ? A G 3 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 17 N1 ? ? A U 4 A A 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 3 O4 ? ? ? 1_555 A A 17 N6 ? ? A U 4 A A 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 16 N1 ? ? A U 6 A A 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 16 N6 ? ? A U 6 A A 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 15 N1 ? ? A C 7 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 15 O6 ? ? A C 7 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 15 N2 ? ? A C 7 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 7 N3 ? ? ? 1_555 A G 14 O6 ? ? A U 8 A G 15 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog15 hydrog ? ? A U 7 O2 ? ? ? 1_555 A G 14 N1 ? ? A U 8 A G 15 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog16 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 13 N1 ? ? A C 9 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 13 O6 ? ? A C 9 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 13 N2 ? ? A C 9 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 9 O2 ? ? ? 1_555 A G 12 N1 ? ? A U 10 A G 13 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog20 hydrog ? ? A C 20 N3 ? ? ? 1_555 A G 35 N1 ? ? A C 21 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 20 N4 ? ? ? 1_555 A G 35 O6 ? ? A C 21 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 20 O2 ? ? ? 1_555 A G 35 N2 ? ? A C 21 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A A 21 N1 ? ? ? 1_555 A U 34 N3 ? ? A A 22 A U 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A A 21 N6 ? ? ? 1_555 A U 34 O4 ? ? A A 22 A U 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 22 N3 ? ? ? 1_555 A G 33 N1 ? ? A C 23 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 22 N4 ? ? ? 1_555 A G 33 O6 ? ? A C 23 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 22 O2 ? ? ? 1_555 A G 33 N2 ? ? A C 23 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 23 N3 ? ? ? 1_555 A A 32 N1 ? ? A U 24 A A 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 23 O4 ? ? ? 1_555 A A 32 N6 ? ? A U 24 A A 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 24 N1 ? ? ? 1_555 A U 31 O2 ? ? A G 25 A U 32 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog31 hydrog ? ? A G 24 O6 ? ? ? 1_555 A U 31 N3 ? ? A G 25 A U 32 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog32 hydrog ? ? A C 25 N3 ? ? ? 1_555 A G 30 N1 ? ? A C 26 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 25 N4 ? ? ? 1_555 A G 30 O6 ? ? A C 26 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 25 O2 ? ? ? 1_555 A G 30 N2 ? ? A C 26 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 26 N2 ? ? ? 1_555 A A 29 N7 ? ? A G 27 A A 30 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog36 hydrog ? ? A G 26 N3 ? ? ? 1_555 A A 29 N6 ? ? A G 27 A A 30 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "H3'" A U 10 ? ? H42 A C 12 ? ? 1.29 2 1 "H3'" A U 11 ? ? "H5'" A C 12 ? ? 1.33 3 5 "H3'" A U 11 ? ? "H5'" A C 12 ? ? 1.26 4 5 "HO2'" A G 25 ? ? "H5'" A C 26 ? ? 1.31 5 5 "HO2'" A G 14 ? ? H8 A G 15 ? ? 1.33 6 6 "HO2'" A C 19 ? ? "H5'" A C 20 ? ? 1.30 7 6 O2 A U 8 ? ? H1 A G 15 ? ? 1.59 8 7 H3 A U 10 ? ? H21 A G 13 ? ? 1.13 9 7 "H3'" A U 10 ? ? H42 A C 12 ? ? 1.30 10 7 "HO2'" A C 21 ? ? "H5'" A A 22 ? ? 1.32 11 7 "H3'" A U 11 ? ? "H5'" A C 12 ? ? 1.35 12 8 "H3'" A U 10 ? ? H42 A C 12 ? ? 1.27 13 8 "H3'" A U 11 ? ? "H5'" A C 12 ? ? 1.34 14 11 H3 A U 10 ? ? H21 A G 13 ? ? 1.13 15 11 "H3'" A U 10 ? ? H42 A C 12 ? ? 1.30 16 11 "H3'" A U 11 ? ? "H5'" A C 12 ? ? 1.35 # _pdbx_validate_planes.id 1 _pdbx_validate_planes.PDB_model_num 8 _pdbx_validate_planes.auth_comp_id G _pdbx_validate_planes.auth_asym_id A _pdbx_validate_planes.auth_seq_id 14 _pdbx_validate_planes.PDB_ins_code ? _pdbx_validate_planes.label_alt_id ? _pdbx_validate_planes.rmsd 0.053 _pdbx_validate_planes.type 'SIDE CHAIN' # _pdbx_nmr_ensemble.entry_id 7DD4 _pdbx_nmr_ensemble.conformers_calculated_total_number 200 _pdbx_nmr_ensemble.conformers_submitted_total_number 11 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 7DD4 _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'minimized average structure' # _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.contents '100 uM A60-10%13C,15N RNA (36-MER), 95% H2O/5% D2O' _pdbx_nmr_sample_details.solvent_system '95% H2O/5% D2O' _pdbx_nmr_sample_details.label A60 _pdbx_nmr_sample_details.type solution _pdbx_nmr_sample_details.details ? # _pdbx_nmr_exptl_sample.solution_id 1 _pdbx_nmr_exptl_sample.component 'RNA (36-MER)' _pdbx_nmr_exptl_sample.concentration 100 _pdbx_nmr_exptl_sample.concentration_range ? _pdbx_nmr_exptl_sample.concentration_units uM _pdbx_nmr_exptl_sample.isotopic_labeling A60-10%13C,15N # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 283 _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 6.5 _pdbx_nmr_exptl_sample_conditions.ionic_strength 50 _pdbx_nmr_exptl_sample_conditions.details '20 mM Phosphate buffer (pH 6.5), 50 mM NaCl' _pdbx_nmr_exptl_sample_conditions.ionic_strength_err ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_units mM _pdbx_nmr_exptl_sample_conditions.label condition_1 _pdbx_nmr_exptl_sample_conditions.pH_err ? _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.pressure_err ? _pdbx_nmr_exptl_sample_conditions.temperature_err ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D NOESY' 1 isotropic 2 1 1 '2D HOHAHA' 1 isotropic 5 1 1 '2D 1H-13C HSQC' 1 isotropic 3 1 1 '2D NOESY' 2 isotropic 4 1 1 '2D HOHAHA' 2 isotropic # _pdbx_nmr_refine.entry_id 7DD4 _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 2 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 2 'structure calculation' CNS 1.3 'Brunger, Adams, Clore, Gros, Nilges and Read' 3 'chemical shift assignment' Sparky ? Goddard 4 'peak picking' Sparky ? Goddard # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7DD4 'double helix' 7DD4 'a-form double helix' 7DD4 tetraloop 7DD4 'bulge loop' 7DD4 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 12 1_555 A U 9 1_555 0.668 3.605 1.485 19.756 6.380 131.182 1 A_G13:U10_A A 13 ? A 10 ? ? 6 1 A G 13 1_555 A C 8 1_555 -0.657 -0.279 -0.075 1.710 12.404 -5.203 2 A_G14:C9_A A 14 ? A 9 ? 19 1 1 A G 14 1_555 A U 7 1_555 -3.315 -0.420 0.044 5.753 -2.850 15.564 3 A_G15:U8_A A 15 ? A 8 ? 28 1 1 A G 15 1_555 A C 6 1_555 -0.458 -0.190 -0.136 -2.832 4.512 -5.334 4 A_G16:C7_A A 16 ? A 7 ? 19 1 1 A A 16 1_555 A U 5 1_555 1.299 -0.202 -0.274 -11.637 -4.662 -5.280 5 A_A17:U6_A A 17 ? A 6 ? 20 1 1 A A 17 1_555 A U 3 1_555 -0.366 -0.027 -0.024 -0.097 -1.636 -1.384 6 A_A18:U4_A A 18 ? A 4 ? 20 1 1 A C 18 1_555 A G 2 1_555 0.510 -0.233 0.091 1.852 -4.207 -1.090 7 A_C19:G3_A A 19 ? A 3 ? 19 1 1 A C 19 1_555 A G 1 1_555 0.385 -0.183 -0.150 -4.343 1.464 -5.340 8 A_C20:G2_A A 20 ? A 2 ? 19 1 1 A C 20 1_555 A G 35 1_555 -0.482 -0.364 -0.853 9.825 -1.248 -3.767 9 A_C21:G36_A A 21 ? A 36 ? 19 1 1 A A 21 1_555 A U 34 1_555 -0.837 -0.259 -0.224 -5.923 -4.812 -0.191 10 A_A22:U35_A A 22 ? A 35 ? 20 1 1 A C 22 1_555 A G 33 1_555 0.127 -0.158 0.065 -5.788 -6.334 -2.646 11 A_C23:G34_A A 23 ? A 34 ? 19 1 1 A U 23 1_555 A A 32 1_555 -1.144 -0.147 0.018 3.870 -4.713 -8.873 12 A_U24:A33_A A 24 ? A 33 ? 20 1 1 A G 24 1_555 A U 31 1_555 -1.824 -0.533 -0.023 -6.598 0.720 -5.637 13 A_G25:U32_A A 25 ? A 32 ? 28 1 1 A C 25 1_555 A G 30 1_555 0.608 -0.267 -0.035 2.525 -0.833 -3.392 14 A_C26:G31_A A 26 ? A 31 ? 19 1 1 A G 26 1_555 A A 29 1_555 6.964 -4.612 -0.062 7.310 1.636 -8.628 15 A_G27:A30_A A 27 ? A 30 ? 11 10 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 12 1_555 A U 9 1_555 A G 13 1_555 A C 8 1_555 -1.191 -3.947 -0.004 125.061 -112.527 49.650 -1.642 0.976 1.589 -58.542 -65.062 169.325 1 AA_G13G14:C9U10_AA A 13 ? A 10 ? A 14 ? A 9 ? 1 A G 13 1_555 A C 8 1_555 A G 14 1_555 A U 7 1_555 1.561 -1.558 3.510 -1.222 -8.930 25.911 -0.766 -3.640 3.752 -19.191 2.627 27.408 2 AA_G14G15:U8C9_AA A 14 ? A 9 ? A 15 ? A 8 ? 1 A G 14 1_555 A U 7 1_555 A G 15 1_555 A C 6 1_555 -1.476 -0.863 3.754 -3.894 26.510 39.564 -3.444 1.485 2.810 34.764 5.106 47.480 3 AA_G15G16:C7U8_AA A 15 ? A 8 ? A 16 ? A 7 ? 1 A G 15 1_555 A C 6 1_555 A A 16 1_555 A U 5 1_555 -0.074 -1.547 3.421 1.906 15.108 35.610 -4.121 0.337 2.574 23.427 -2.955 38.632 4 AA_G16A17:U6C7_AA A 16 ? A 7 ? A 17 ? A 6 ? 1 A A 16 1_555 A U 5 1_555 A A 17 1_555 A U 3 1_555 2.754 -2.031 5.317 -28.530 -21.264 42.750 -0.218 -5.632 3.579 -24.718 33.164 55.082 5 AA_A17A18:U4U6_AA A 17 ? A 6 ? A 18 ? A 4 ? 1 A A 17 1_555 A U 3 1_555 A C 18 1_555 A G 2 1_555 -0.655 -2.252 3.208 -3.084 -5.666 39.718 -2.609 0.590 3.522 -8.273 4.503 40.218 6 AA_A18C19:G3U4_AA A 18 ? A 4 ? A 19 ? A 3 ? 1 A C 18 1_555 A G 2 1_555 A C 19 1_555 A G 1 1_555 -0.129 -2.293 3.119 3.690 4.093 30.750 -4.964 0.874 2.764 7.641 -6.888 31.228 7 AA_C19C20:G2G3_AA A 19 ? A 3 ? A 20 ? A 2 ? 1 A C 19 1_555 A G 1 1_555 A C 20 1_555 A G 35 1_555 0.166 -2.802 3.137 9.400 0.270 16.906 -8.476 4.048 2.788 0.840 -29.218 19.329 8 AA_C20C21:G36G2_AA A 20 ? A 2 ? A 21 ? A 36 ? 1 A C 20 1_555 A G 35 1_555 A A 21 1_555 A U 34 1_555 0.620 -0.669 4.637 -5.128 3.597 34.909 -1.834 -2.068 4.416 5.937 8.463 35.449 9 AA_C21A22:U35G36_AA A 21 ? A 36 ? A 22 ? A 35 ? 1 A A 21 1_555 A U 34 1_555 A C 22 1_555 A G 33 1_555 -1.280 -1.782 3.220 -3.582 23.022 24.130 -6.165 1.749 1.267 44.075 6.858 33.422 10 AA_A22C23:G34U35_AA A 22 ? A 35 ? A 23 ? A 34 ? 1 A C 22 1_555 A G 33 1_555 A U 23 1_555 A A 32 1_555 -0.717 -1.594 2.979 0.152 4.527 31.719 -3.604 1.323 2.728 8.230 -0.277 32.033 11 AA_C23U24:A33G34_AA A 23 ? A 34 ? A 24 ? A 33 ? 1 A U 23 1_555 A A 32 1_555 A G 24 1_555 A U 31 1_555 0.477 -1.837 3.526 -5.056 14.235 29.574 -5.492 -1.643 2.313 25.870 9.188 33.132 12 AA_U24G25:U32A33_AA A 24 ? A 33 ? A 25 ? A 32 ? 1 A G 24 1_555 A U 31 1_555 A C 25 1_555 A G 30 1_555 0.242 -1.306 3.224 0.586 -6.495 44.502 -1.113 -0.263 3.375 -8.521 -0.769 44.953 13 AA_G25C26:G31U32_AA A 25 ? A 32 ? A 26 ? A 31 ? 1 A C 25 1_555 A G 30 1_555 A G 26 1_555 A A 29 1_555 -1.733 -1.105 4.314 -3.920 -12.706 39.255 0.341 1.865 4.587 -18.287 5.641 41.362 14 AA_C26G27:A30G31_AA A 26 ? A 31 ? A 27 ? A 30 ? # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 AVANCE ? Bruker 600 ? 2 AVANCE ? Bruker 800 ? # _atom_sites.entry_id 7DD4 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_