data_7E9I # _entry.id 7E9I # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7E9I pdb_00007e9i 10.2210/pdb7e9i/pdb WWPDB D_1300021023 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7E9I _pdbx_database_status.recvd_initial_deposition_date 2021-03-04 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Numata, T.' 1 ? 'Schneekloth, J.S.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nat Commun' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2041-1723 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 12 _citation.language ? _citation.page_first 5856 _citation.page_last 5856 _citation.title 'A chemical probe based on the PreQ 1 metabolite enables transcriptome-wide mapping of binding sites.' _citation.year 2021 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41467-021-25973-x _citation.pdbx_database_id_PubMed 34615874 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Balaratnam, S.' 1 ? primary 'Rhodes, C.' 2 ? primary 'Bume, D.D.' 3 ? primary 'Connelly, C.' 4 0000-0003-1671-3243 primary 'Lai, C.C.' 5 ? primary 'Kelley, J.A.' 6 ? primary 'Yazdani, K.' 7 ? primary 'Homan, P.J.' 8 ? primary 'Incarnato, D.' 9 0000-0003-3944-2327 primary 'Numata, T.' 10 ? primary 'Schneekloth Jr., J.S.' 11 0000-0001-7459-783X # _cell.entry_id 7E9I _cell.length_a 113.240 _cell.length_b 113.240 _cell.length_c 59.520 _cell.angle_alpha 90.00 _cell.angle_beta 90.00 _cell.angle_gamma 120.00 _cell.Z_PDB 12 _cell.pdbx_unique_axis ? # _symmetry.entry_id 7E9I _symmetry.space_group_name_H-M 'P 63 2 2' _symmetry.pdbx_full_space_group_name_H-M ? _symmetry.cell_setting ? _symmetry.Int_Tables_number 182 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn '33-mer RNA' 10599.417 1 ? ? ? ? 2 non-polymer syn '2-azanyl-5-[[2-(3-but-3-ynyl-1,2-diazirin-3-yl)ethylamino]methyl]-1,7-dihydropyrrolo[2,3-d]pyrimidin-4-one' 299.331 1 ? ? ? ? 3 non-polymer syn 'SULFATE ION' 96.063 1 ? ? ? ? 4 water nat water 18.015 2 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code CUGGGUCGCAGUAACCCCAGUUAACAAAACAAG _entity_poly.pdbx_seq_one_letter_code_can CUGGGUCGCAGUAACCCCAGUUAACAAAACAAG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 C n 1 2 U n 1 3 G n 1 4 G n 1 5 G n 1 6 U n 1 7 C n 1 8 G n 1 9 C n 1 10 A n 1 11 G n 1 12 U n 1 13 A n 1 14 A n 1 15 C n 1 16 C n 1 17 C n 1 18 C n 1 19 A n 1 20 G n 1 21 U n 1 22 U n 1 23 A n 1 24 A n 1 25 C n 1 26 A n 1 27 A n 1 28 A n 1 29 A n 1 30 C n 1 31 A n 1 32 A n 1 33 G n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 33 _pdbx_entity_src_syn.organism_scientific 'Caldanaerobacter subterraneus subsp. tengcongensis' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 119072 _pdbx_entity_src_syn.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7E9I _struct_ref.pdbx_db_accession 7E9I _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7E9I _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 33 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7E9I _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 33 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 33 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 J0C non-polymer . '2-azanyl-5-[[2-(3-but-3-ynyl-1,2-diazirin-3-yl)ethylamino]methyl]-1,7-dihydropyrrolo[2,3-d]pyrimidin-4-one' ? 'C14 H17 N7 O' 299.331 SO4 non-polymer . 'SULFATE ION' ? 'O4 S -2' 96.063 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7E9I _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 5.20 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 76.33 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 5.6 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '0.3M potassium sodium tartrate, 0.1M sodium citrate (pH5.6), 2.2M ammonium sulfate' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2020-04-06 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.0 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SPRING-8 BEAMLINE BL45XU' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.0 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL45XU _diffrn_source.pdbx_synchrotron_site SPring-8 # _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.entry_id 7E9I _reflns.observed_criterion_sigma_I ? _reflns.observed_criterion_sigma_F ? _reflns.d_resolution_low 41.000 _reflns.d_resolution_high 2.800 _reflns.number_obs 5804 _reflns.number_all ? _reflns.percent_possible_obs 98.0 _reflns.pdbx_Rmerge_I_obs 0.17700 _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_sigmaI 1.2500 _reflns.B_iso_Wilson_estimate ? _reflns.pdbx_redundancy 8.200 # _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_ordinal 1 _reflns_shell.d_res_high 2.80 _reflns_shell.d_res_low 2.97 _reflns_shell.percent_possible_all 96.1 _reflns_shell.Rmerge_I_obs 1.93000 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.pdbx_redundancy 8.50 # _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.entry_id 7E9I _refine.pdbx_diffrn_id 1 _refine.pdbx_TLS_residual_ADP_flag ? _refine.ls_number_reflns_obs 5768 _refine.ls_number_reflns_all ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low 41.00 _refine.ls_d_res_high 2.80 _refine.ls_percent_reflns_obs 97.6 _refine.ls_R_factor_obs 0.196 _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work 0.193 _refine.ls_R_factor_R_free 0.235 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free 5.000 _refine.ls_number_reflns_R_free 290 _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean 87.77 _refine.aniso_B[1][1] ? _refine.aniso_B[2][2] ? _refine.aniso_B[3][3] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][3] ? _refine.solvent_model_details ? _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.details ? _refine.pdbx_starting_model 6E1W _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values 'GEOSTD + MONOMER LIBRARY + CDL V1.2' _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML ? _refine.pdbx_overall_phase_error ? _refine.overall_SU_B ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 686 _refine_hist.pdbx_number_atoms_ligand 27 _refine_hist.number_atoms_solvent 2 _refine_hist.number_atoms_total 715 _refine_hist.d_res_high 2.80 _refine_hist.d_res_low 41.00 # loop_ _refine_ls_restr.type _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.weight _refine_ls_restr.number _refine_ls_restr.pdbx_refine_id _refine_ls_restr.pdbx_restraint_function f_bond_d 0.006 ? ? 795 'X-RAY DIFFRACTION' ? f_angle_d 1.174 ? ? 1232 'X-RAY DIFFRACTION' ? f_dihedral_angle_d 14.950 ? ? 387 'X-RAY DIFFRACTION' ? f_chiral_restr 0.051 ? ? 161 'X-RAY DIFFRACTION' ? f_plane_restr 0.007 ? ? 33 'X-RAY DIFFRACTION' ? # _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.pdbx_total_number_of_bins_used ? _refine_ls_shell.d_res_high 2.8000 _refine_ls_shell.d_res_low 3.5300 _refine_ls_shell.number_reflns_R_work 2642 _refine_ls_shell.R_factor_R_work 0.3300 _refine_ls_shell.percent_reflns_obs 97.00 _refine_ls_shell.R_factor_R_free 0.3580 _refine_ls_shell.R_factor_R_free_error ? _refine_ls_shell.percent_reflns_R_free ? _refine_ls_shell.number_reflns_R_free 0 _refine_ls_shell.number_reflns_all ? _refine_ls_shell.R_factor_all ? # _struct.entry_id 7E9I _struct.title 'Crystal structure of a class I PreQ1 riboswitch aptamer (wild-type) complexed with a cognate ligand-derived photoaffinity probe' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7E9I _struct_keywords.text 'preq1 riboswitch, cognate ligand-derived photoaffinity probe, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A C 1 N3 ? ? ? 1_555 A G 20 N1 ? ? A C 1 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A C 1 N4 ? ? ? 1_555 A G 20 O6 ? ? A C 1 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A C 1 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 1 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A U 2 N3 ? ? ? 1_555 A A 19 N1 ? ? A U 2 A A 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A U 2 O4 ? ? ? 1_555 A A 19 N6 ? ? A U 2 A A 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 18 N3 ? ? A G 3 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 18 O2 ? ? A G 3 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 18 N4 ? ? A G 3 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 17 N3 ? ? A G 4 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 17 O2 ? ? A G 4 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 17 N4 ? ? A G 4 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 16 N3 ? ? A G 5 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 16 O2 ? ? A G 5 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 16 N4 ? ? A G 5 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 5 N2 ? ? ? 1_555 A A 27 N1 ? ? A G 5 A A 27 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog16 hydrog ? ? A G 5 N3 ? ? ? 1_555 A A 27 N6 ? ? A G 5 A A 27 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog17 hydrog ? ? A U 6 N3 ? ? ? 1_555 A A 28 N7 ? ? A U 6 A A 28 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog18 hydrog ? ? A U 6 O4 ? ? ? 1_555 A A 28 N6 ? ? A U 6 A A 28 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog19 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 11 N7 ? ? A C 7 A G 11 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog20 hydrog ? ? A C 7 O2 ? ? ? 1_555 A A 29 N6 ? ? A C 7 A A 29 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog21 hydrog ? ? A C 7 O2 ? ? ? 1_555 A C 30 N4 ? ? A C 7 A C 30 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ? ? ? hydrog22 hydrog ? ? A G 8 N2 ? ? ? 1_555 A A 31 N1 ? ? A G 8 A A 31 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog23 hydrog ? ? A G 8 N3 ? ? ? 1_555 A A 31 N6 ? ? A G 8 A A 31 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog24 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 33 N1 ? ? A C 9 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 33 O6 ? ? A C 9 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 33 N2 ? ? A C 9 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 10 N3 ? ? ? 1_555 A A 32 N6 ? ? A A 10 A A 32 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog28 hydrog ? ? A G 11 N2 ? ? ? 1_555 A A 14 N1 ? ? A G 11 A A 14 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog29 hydrog ? ? A G 11 N3 ? ? ? 1_555 A A 14 N6 ? ? A G 11 A A 14 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog30 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 30 N3 ? ? A G 11 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 30 O2 ? ? A G 11 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 30 N4 ? ? A G 11 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A A 13 N6 ? ? ? 1_555 A A 31 N3 ? ? A A 13 A A 31 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog34 hydrog ? ? A C 16 O2 ? ? ? 1_555 A A 28 N6 ? ? A C 16 A A 28 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog35 hydrog ? ? A C 17 O2 ? ? ? 1_555 A A 26 N6 ? ? A C 17 A A 26 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 7E9I _atom_sites.fract_transf_matrix[1][1] 0.008831 _atom_sites.fract_transf_matrix[1][2] 0.005098 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.010197 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.016801 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 # loop_ _atom_type.symbol C N O P S # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 C 1 1 1 C C A . n A 1 2 U 2 2 2 U U A . n A 1 3 G 3 3 3 G G A . n A 1 4 G 4 4 4 G G A . n A 1 5 G 5 5 5 G G A . n A 1 6 U 6 6 6 U U A . n A 1 7 C 7 7 7 C C A . n A 1 8 G 8 8 8 G G A . n A 1 9 C 9 9 9 C C A . n A 1 10 A 10 10 10 A A A . n A 1 11 G 11 11 11 G G A . n A 1 12 U 12 12 12 U U A . n A 1 13 A 13 13 13 A A A . n A 1 14 A 14 14 14 A A A . n A 1 15 C 15 15 15 C C A . n A 1 16 C 16 16 16 C C A . n A 1 17 C 17 17 17 C C A . n A 1 18 C 18 18 18 C C A . n A 1 19 A 19 19 19 A A A . n A 1 20 G 20 20 20 G G A . n A 1 21 U 21 21 21 U U A . n A 1 22 U 22 22 22 U U A . n A 1 23 A 23 23 23 A A A . n A 1 24 A 24 24 24 A A A . n A 1 25 C 25 25 25 C C A . n A 1 26 A 26 26 26 A A A . n A 1 27 A 27 27 27 A A A . n A 1 28 A 28 28 28 A A A . n A 1 29 A 29 29 29 A A A . n A 1 30 C 30 30 30 C C A . n A 1 31 A 31 31 31 A A A . n A 1 32 A 32 32 32 A A A . n A 1 33 G 33 33 33 G G A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 J0C 1 101 101 J0C J0C A . C 3 SO4 1 102 102 SO4 SO4 A . D 4 HOH 1 201 201 HOH HOH A . D 4 HOH 2 202 202 HOH HOH A . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 120 ? 1 MORE -6 ? 1 'SSA (A^2)' 5230 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _pdbx_struct_special_symmetry.id 1 _pdbx_struct_special_symmetry.PDB_model_num 1 _pdbx_struct_special_symmetry.auth_asym_id A _pdbx_struct_special_symmetry.auth_comp_id SO4 _pdbx_struct_special_symmetry.auth_seq_id 102 _pdbx_struct_special_symmetry.PDB_ins_code ? _pdbx_struct_special_symmetry.label_asym_id C _pdbx_struct_special_symmetry.label_comp_id SO4 _pdbx_struct_special_symmetry.label_seq_id . # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2021-11-17 2 'Structure model' 1 1 2023-11-29 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' chem_comp_atom 2 2 'Structure model' chem_comp_bond 3 2 'Structure model' pdbx_initial_refinement_model # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 x-y,x,z+1/2 3 y,-x+y,z+1/2 4 -y,x-y,z 5 -x+y,-x,z 6 x-y,-y,-z 7 -x,-x+y,-z 8 -x,-y,z+1/2 9 y,x,-z 10 -y,-x,-z+1/2 11 -x+y,y,-z+1/2 12 x,x-y,-z+1/2 # loop_ _pdbx_refine_tls.pdbx_refine_id _pdbx_refine_tls.id _pdbx_refine_tls.details _pdbx_refine_tls.method _pdbx_refine_tls.origin_x _pdbx_refine_tls.origin_y _pdbx_refine_tls.origin_z _pdbx_refine_tls.T[1][1] _pdbx_refine_tls.T[2][2] _pdbx_refine_tls.T[3][3] _pdbx_refine_tls.T[1][2] _pdbx_refine_tls.T[1][3] _pdbx_refine_tls.T[2][3] _pdbx_refine_tls.L[1][1] _pdbx_refine_tls.L[2][2] _pdbx_refine_tls.L[3][3] _pdbx_refine_tls.L[1][2] _pdbx_refine_tls.L[1][3] _pdbx_refine_tls.L[2][3] _pdbx_refine_tls.S[1][1] _pdbx_refine_tls.S[1][2] _pdbx_refine_tls.S[1][3] _pdbx_refine_tls.S[2][1] _pdbx_refine_tls.S[2][2] _pdbx_refine_tls.S[2][3] _pdbx_refine_tls.S[3][1] _pdbx_refine_tls.S[3][2] _pdbx_refine_tls.S[3][3] 'X-RAY DIFFRACTION' 1 ? refined 38.6998 35.5563 27.7255 0.7634 0.9935 0.7450 0.2781 0.0557 -0.1069 1.0290 1.5352 1.4700 -0.4086 -0.8906 1.3422 0.0386 -0.0322 -0.3423 -0.1261 0.2511 -1.1119 0.7623 0.7991 -0.1686 'X-RAY DIFFRACTION' 2 ? refined 37.2136 37.8910 18.9223 1.7666 0.9326 0.8159 0.4900 0.1183 0.0046 5.5640 2.6727 8.6317 -3.7640 6.5349 -4.0525 0.1174 0.8125 1.2606 -1.1282 -0.1561 -0.0176 -2.1182 0.6525 -0.3688 'X-RAY DIFFRACTION' 3 ? refined 33.0063 36.1378 29.9896 0.8762 0.7933 0.6524 0.2207 -0.0130 -0.0655 1.1273 2.2554 3.5159 -0.9646 -1.4517 0.2580 -0.1608 -0.0484 -0.4227 -0.1676 0.2741 -0.0932 1.1711 0.4882 -0.1038 # loop_ _pdbx_refine_tls_group.pdbx_refine_id _pdbx_refine_tls_group.id _pdbx_refine_tls_group.refine_tls_id _pdbx_refine_tls_group.beg_auth_asym_id _pdbx_refine_tls_group.beg_auth_seq_id _pdbx_refine_tls_group.beg_label_asym_id _pdbx_refine_tls_group.beg_label_seq_id _pdbx_refine_tls_group.end_auth_asym_id _pdbx_refine_tls_group.end_auth_seq_id _pdbx_refine_tls_group.end_label_asym_id _pdbx_refine_tls_group.end_label_seq_id _pdbx_refine_tls_group.selection _pdbx_refine_tls_group.selection_details 'X-RAY DIFFRACTION' 1 1 ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 1 through 10 ) ; 'X-RAY DIFFRACTION' 2 2 ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 11 through 15 ) ; 'X-RAY DIFFRACTION' 3 3 ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 16 through 33 ) ; # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.17.1-3660 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _pdbx_entry_details.entry_id 7E9I _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 N1 _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 G _pdbx_validate_rmsd_angle.auth_seq_id_1 3 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 C6 _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 G _pdbx_validate_rmsd_angle.auth_seq_id_2 3 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 O6 _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 G _pdbx_validate_rmsd_angle.auth_seq_id_3 3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 115.89 _pdbx_validate_rmsd_angle.angle_target_value 119.90 _pdbx_validate_rmsd_angle.angle_deviation -4.01 _pdbx_validate_rmsd_angle.angle_standard_deviation 0.60 _pdbx_validate_rmsd_angle.linker_flag N # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A U 12 ? "C5'" ? A U 12 "C5'" 2 1 Y 1 A U 12 ? "C4'" ? A U 12 "C4'" 3 1 Y 1 A U 12 ? "O4'" ? A U 12 "O4'" 4 1 Y 1 A U 12 ? "C3'" ? A U 12 "C3'" 5 1 Y 1 A U 12 ? "O3'" ? A U 12 "O3'" 6 1 Y 1 A U 12 ? "C2'" ? A U 12 "C2'" 7 1 Y 1 A U 12 ? "O2'" ? A U 12 "O2'" 8 1 Y 1 A U 12 ? "C1'" ? A U 12 "C1'" 9 1 Y 1 A U 12 ? N1 ? A U 12 N1 10 1 Y 1 A U 12 ? C2 ? A U 12 C2 11 1 Y 1 A U 12 ? O2 ? A U 12 O2 12 1 Y 1 A U 12 ? N3 ? A U 12 N3 13 1 Y 1 A U 12 ? C4 ? A U 12 C4 14 1 Y 1 A U 12 ? O4 ? A U 12 O4 15 1 Y 1 A U 12 ? C5 ? A U 12 C5 16 1 Y 1 A U 12 ? C6 ? A U 12 C6 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 J0C C10 C N N 114 J0C C13 C N N 115 J0C C17 C N N 116 J0C C20 C N N 117 J0C C21 C Y N 118 J0C C2 C N N 119 J0C C4 C N N 120 J0C C7 C Y N 121 J0C C8 C Y N 122 J0C C9 C Y N 123 J0C C12 C N N 124 J0C C14 C N N 125 J0C C18 C N N 126 J0C C19 C N N 127 J0C N3 N N N 128 J0C N5 N N N 129 J0C N6 N N N 130 J0C N11 N N N 131 J0C N15 N N N 132 J0C N16 N N N 133 J0C N22 N Y N 134 J0C O1 O N N 135 J0C H1 H N N 136 J0C H2 H N N 137 J0C H3 H N N 138 J0C H4 H N N 139 J0C H5 H N N 140 J0C H6 H N N 141 J0C H7 H N N 142 J0C H8 H N N 143 J0C H9 H N N 144 J0C H10 H N N 145 J0C H11 H N N 146 J0C H12 H N N 147 J0C H13 H N N 148 J0C H14 H N N 149 J0C H15 H N N 150 J0C H16 H N N 151 J0C H20 H N N 152 SO4 S S N N 153 SO4 O1 O N N 154 SO4 O2 O N N 155 SO4 O3 O N N 156 SO4 O4 O N N 157 U OP3 O N N 158 U P P N N 159 U OP1 O N N 160 U OP2 O N N 161 U "O5'" O N N 162 U "C5'" C N N 163 U "C4'" C N R 164 U "O4'" O N N 165 U "C3'" C N S 166 U "O3'" O N N 167 U "C2'" C N R 168 U "O2'" O N N 169 U "C1'" C N R 170 U N1 N N N 171 U C2 C N N 172 U O2 O N N 173 U N3 N N N 174 U C4 C N N 175 U O4 O N N 176 U C5 C N N 177 U C6 C N N 178 U HOP3 H N N 179 U HOP2 H N N 180 U "H5'" H N N 181 U "H5''" H N N 182 U "H4'" H N N 183 U "H3'" H N N 184 U "HO3'" H N N 185 U "H2'" H N N 186 U "HO2'" H N N 187 U "H1'" H N N 188 U H3 H N N 189 U H5 H N N 190 U H6 H N N 191 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 J0C N5 C4 sing N N 118 J0C C18 C17 sing N N 119 J0C C18 C19 sing N N 120 J0C N3 C4 doub N N 121 J0C N3 C2 sing N N 122 J0C C17 C14 sing N N 123 J0C C4 N6 sing N N 124 J0C O1 C2 doub N N 125 J0C C2 C8 sing N N 126 J0C C19 C20 trip N N 127 J0C N15 N16 doub N N 128 J0C N15 C14 sing N N 129 J0C N16 C14 sing N N 130 J0C C14 C13 sing N N 131 J0C N6 C7 sing N N 132 J0C C8 C7 doub Y N 133 J0C C8 C9 sing Y N 134 J0C C7 N22 sing Y N 135 J0C N11 C12 sing N N 136 J0C N11 C10 sing N N 137 J0C C13 C12 sing N N 138 J0C C9 C10 sing N N 139 J0C C9 C21 doub Y N 140 J0C N22 C21 sing Y N 141 J0C C10 H1 sing N N 142 J0C C10 H2 sing N N 143 J0C C13 H3 sing N N 144 J0C C13 H4 sing N N 145 J0C C17 H5 sing N N 146 J0C C17 H6 sing N N 147 J0C C20 H7 sing N N 148 J0C C21 H8 sing N N 149 J0C C12 H9 sing N N 150 J0C C12 H10 sing N N 151 J0C C18 H11 sing N N 152 J0C C18 H12 sing N N 153 J0C N5 H13 sing N N 154 J0C N5 H14 sing N N 155 J0C N6 H15 sing N N 156 J0C N11 H16 sing N N 157 J0C N22 H20 sing N N 158 SO4 S O1 doub N N 159 SO4 S O2 doub N N 160 SO4 S O3 sing N N 161 SO4 S O4 sing N N 162 U OP3 P sing N N 163 U OP3 HOP3 sing N N 164 U P OP1 doub N N 165 U P OP2 sing N N 166 U P "O5'" sing N N 167 U OP2 HOP2 sing N N 168 U "O5'" "C5'" sing N N 169 U "C5'" "C4'" sing N N 170 U "C5'" "H5'" sing N N 171 U "C5'" "H5''" sing N N 172 U "C4'" "O4'" sing N N 173 U "C4'" "C3'" sing N N 174 U "C4'" "H4'" sing N N 175 U "O4'" "C1'" sing N N 176 U "C3'" "O3'" sing N N 177 U "C3'" "C2'" sing N N 178 U "C3'" "H3'" sing N N 179 U "O3'" "HO3'" sing N N 180 U "C2'" "O2'" sing N N 181 U "C2'" "C1'" sing N N 182 U "C2'" "H2'" sing N N 183 U "O2'" "HO2'" sing N N 184 U "C1'" N1 sing N N 185 U "C1'" "H1'" sing N N 186 U N1 C2 sing N N 187 U N1 C6 sing N N 188 U C2 O2 doub N N 189 U C2 N3 sing N N 190 U N3 C4 sing N N 191 U N3 H3 sing N N 192 U C4 O4 doub N N 193 U C4 C5 sing N N 194 U C5 C6 doub N N 195 U C5 H5 sing N N 196 U C6 H6 sing N N 197 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7E9I 'double helix' 7E9I 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A C 1 1_555 A G 20 1_555 0.182 -0.085 -0.353 1.404 3.290 1.080 1 A_C1:G20_A A 1 ? A 20 ? 19 1 1 A U 2 1_555 A A 19 1_555 0.147 -0.099 -0.089 -1.428 -16.062 1.695 2 A_U2:A19_A A 2 ? A 19 ? 20 1 1 A G 3 1_555 A C 18 1_555 0.164 -0.108 -0.045 -6.411 -4.287 -1.557 3 A_G3:C18_A A 3 ? A 18 ? 19 1 1 A G 4 1_555 A C 17 1_555 0.174 -0.117 0.016 -5.546 -9.379 -2.716 4 A_G4:C17_A A 4 ? A 17 ? 19 1 1 A G 5 1_555 A C 16 1_555 -0.202 -0.110 -0.595 -10.571 -16.471 -1.355 5 A_G5:C16_A A 5 ? A 16 ? 19 1 1 A U 6 1_555 A A 28 1_555 -0.863 3.458 1.366 -23.797 -10.630 -73.822 6 A_U6:A28_A A 6 ? A 28 ? 23 3 1 A C 7 1_555 A A 29 1_555 4.732 0.525 2.221 -25.288 16.924 -38.100 7 A_C7:A29_A A 7 ? A 29 ? ? ? 1 A G 11 1_555 A C 30 1_555 -0.141 -0.014 0.182 -0.824 -20.654 -1.767 8 A_G11:C30_A A 11 ? A 30 ? 19 1 1 A G 8 1_555 A A 31 1_555 3.309 -4.294 -0.940 16.164 8.432 -70.837 9 A_G8:A31_A A 8 ? A 31 ? 10 6 1 A A 10 1_555 A A 32 1_555 6.227 -3.921 -1.163 3.081 -5.762 -20.958 10 A_A10:A32_A A 10 ? A 32 ? ? 10 1 A C 9 1_555 A G 33 1_555 -0.217 0.056 0.126 7.510 -13.514 1.221 11 A_C9:G33_A A 9 ? A 33 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A C 1 1_555 A G 20 1_555 A U 2 1_555 A A 19 1_555 0.512 -1.756 3.134 2.722 10.942 33.824 -4.279 -0.486 2.497 18.190 -4.525 35.601 1 AA_C1U2:A19G20_AA A 1 ? A 20 ? A 2 ? A 19 ? 1 A U 2 1_555 A A 19 1_555 A G 3 1_555 A C 18 1_555 -0.642 -1.910 3.174 -0.129 11.485 32.218 -4.842 1.076 2.376 19.923 0.225 34.153 2 AA_U2G3:C18A19_AA A 2 ? A 19 ? A 3 ? A 18 ? 1 A G 3 1_555 A C 18 1_555 A G 4 1_555 A C 17 1_555 0.549 -1.821 3.225 2.463 2.318 26.473 -4.532 -0.566 3.094 5.035 -5.351 26.685 3 AA_G3G4:C17C18_AA A 3 ? A 18 ? A 4 ? A 17 ? 1 A G 4 1_555 A C 17 1_555 A G 5 1_555 A C 16 1_555 0.068 -1.614 3.477 7.377 7.799 35.817 -3.567 0.884 3.027 12.344 -11.676 37.341 4 AA_G4G5:C16C17_AA A 4 ? A 17 ? A 5 ? A 16 ? 1 A G 5 1_555 A C 16 1_555 A U 6 1_555 A A 28 1_555 -6.578 -0.919 1.067 7.689 10.076 21.863 -1.936 14.929 -1.416 24.131 -18.414 25.232 5 AA_G5U6:A28C16_AA A 5 ? A 16 ? A 6 ? A 28 ? 1 A U 6 1_555 A A 28 1_555 A C 7 1_555 A A 29 1_555 2.850 -1.439 3.754 2.625 -2.804 49.315 -1.475 -3.176 3.962 -3.355 -3.140 49.455 6 AA_U6C7:A29A28_AA A 6 ? A 28 ? A 7 ? A 29 ? 1 A C 7 1_555 A A 29 1_555 A G 11 1_555 A C 30 1_555 0.781 -2.051 0.387 -145.199 -99.747 101.762 -0.924 -0.539 0.627 -50.117 72.954 177.577 7 AA_C7G11:C30A29_AA A 7 ? A 29 ? A 11 ? A 30 ? 1 A G 11 1_555 A C 30 1_555 A G 8 1_555 A A 31 1_555 -2.294 2.827 3.244 -171.758 -13.276 -111.067 -1.358 -1.882 1.508 6.690 -86.554 -175.628 8 AA_G11G8:A31C30_AA A 11 ? A 30 ? A 8 ? A 31 ? 1 A G 8 1_555 A A 31 1_555 A A 10 1_555 A A 32 1_555 -6.269 2.009 0.246 150.654 48.594 -61.043 -1.454 -1.823 4.713 -25.921 80.363 -161.334 9 AA_G8A10:A32A31_AA A 8 ? A 31 ? A 10 ? A 32 ? 1 A A 10 1_555 A A 32 1_555 A C 9 1_555 A G 33 1_555 1.228 0.980 -3.824 -4.852 -0.431 -60.018 -1.002 1.500 -3.718 0.430 -4.842 -60.197 10 AA_A10C9:G33A32_AA A 10 ? A 32 ? A 9 ? A 33 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'Japan Society for the Promotion of Science (JSPS)' Japan 20K21281 1 'Japan Society for the Promotion of Science (JSPS)' Japan 16KK0166 2 'National Institutes of Health/National Cancer Institute (NIH/NCI)' 'United States' ? 3 # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 '2-azanyl-5-[[2-(3-but-3-ynyl-1,2-diazirin-3-yl)ethylamino]methyl]-1,7-dihydropyrrolo[2,3-d]pyrimidin-4-one' J0C 3 'SULFATE ION' SO4 4 water HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 6E1W _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'gel filtration' _pdbx_struct_assembly_auth_evidence.details ? # _space_group.crystal_system hexagonal _space_group.name_H-M_alt 'P 63 2 2' _space_group.IT_number 182 _space_group.name_Hall 'P 6c 2c' _space_group.id 1 #