data_7FJ0 # _entry.id 7FJ0 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.391 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7FJ0 pdb_00007fj0 10.2210/pdb7fj0/pdb WWPDB D_1300023652 ? ? BMRB 36435 ? 10.13018/BMR36435 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2021-12-01 2 'Structure model' 1 1 2022-03-02 3 'Structure model' 1 2 2023-06-14 4 'Structure model' 1 3 2024-05-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' Other 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 3 'Structure model' pdbx_database_status 3 4 'Structure model' chem_comp_atom 4 4 'Structure model' chem_comp_bond 5 4 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 2 'Structure model' '_citation.year' 5 3 'Structure model' '_pdbx_database_status.status_code_nmr_data' 6 4 'Structure model' '_database_2.pdbx_DOI' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.entry_id 7FJ0 _pdbx_database_status.recvd_initial_deposition_date 2021-08-02 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs REL _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _pdbx_database_related.db_name _pdbx_database_related.details _pdbx_database_related.db_id _pdbx_database_related.content_type PDB 'An RNA complex with the same compound.' 7FHI unspecified BMRB 'Interaction between a fluoroquinolone derivative and RNAs with a single bulge' 36435 unspecified # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Nagano, K.' 1 ? 'Kamimura, T.' 2 ? 'Kawai, G.' 3 0000-0003-1480-2840 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country JP _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev J.Biochem. _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 0021-924X _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 171 _citation.language ? _citation.page_first 239 _citation.page_last 244 _citation.title 'Interaction between a fluoroquinolone derivative and RNAs with a single bulge.' _citation.year 2022 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/jb/mvab124 _citation.pdbx_database_id_PubMed 34791286 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Nagano, K.' 1 ? primary 'Kamimura, T.' 2 ? primary 'Kawai, G.' 3 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;RNA (5'-R(*GP*GP*AP*UP*GP*CP*UP*UP*AP*CP*UP*CP*AP*GP*CP*GP*AP*UP*CP*C)-3') ; 6359.814 1 ? ? ? ? 2 non-polymer syn '1-cyclopropyl-N-[3-(dimethylamino)propyl]-7-(4-ethylpiperazin-1-yl)-6-fluoranyl-4-oxidanylidene-quinoline-3-carboxamide' 443.557 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGAUGCUUACUCAGCGAUCC _entity_poly.pdbx_seq_one_letter_code_can GGAUGCUUACUCAGCGAUCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name '1-cyclopropyl-N-[3-(dimethylamino)propyl]-7-(4-ethylpiperazin-1-yl)-6-fluoranyl-4-oxidanylidene-quinoline-3-carboxamide' _pdbx_entity_nonpoly.comp_id 53D # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 U n 1 5 G n 1 6 C n 1 7 U n 1 8 U n 1 9 A n 1 10 C n 1 11 U n 1 12 C n 1 13 A n 1 14 G n 1 15 C n 1 16 G n 1 17 A n 1 18 U n 1 19 C n 1 20 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 20 _pdbx_entity_src_syn.organism_scientific 'Mus musculus' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 10090 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 53D non-polymer . '1-cyclopropyl-N-[3-(dimethylamino)propyl]-7-(4-ethylpiperazin-1-yl)-6-fluoranyl-4-oxidanylidene-quinoline-3-carboxamide' ? 'C24 H34 F N5 O2' 443.557 A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 U 4 4 4 U U A . n A 1 5 G 5 5 5 G G A . n A 1 6 C 6 6 6 C C A . n A 1 7 U 7 7 7 U U A . n A 1 8 U 8 8 8 U U A . n A 1 9 A 9 9 9 A A A . n A 1 10 C 10 10 10 C C A . n A 1 11 U 11 11 11 U U A . n A 1 12 C 12 12 12 C C A . n A 1 13 A 13 13 13 A A A . n A 1 14 G 14 14 14 G G A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 A 17 17 17 A A A . n A 1 18 U 18 18 18 U U A . n A 1 19 C 19 19 19 C C A . n A 1 20 C 20 20 20 C C A . n # _pdbx_nonpoly_scheme.asym_id B _pdbx_nonpoly_scheme.entity_id 2 _pdbx_nonpoly_scheme.mon_id 53D _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 101 _pdbx_nonpoly_scheme.auth_seq_num 21 _pdbx_nonpoly_scheme.pdb_mon_id 53D _pdbx_nonpoly_scheme.auth_mon_id K22 _pdbx_nonpoly_scheme.pdb_strand_id A _pdbx_nonpoly_scheme.pdb_ins_code . # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7FJ0 _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 7FJ0 _struct.title 'Interaction between a fluoroquinolone derivative and RNAs with a single bulge' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7FJ0 _struct_keywords.text 'Complex, fluoroquinolone, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7FJ0 _struct_ref.pdbx_db_accession 7FJ0 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7FJ0 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 20 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7FJ0 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 20 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 20 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 0 ? 1 MORE 0 ? 1 'SSA (A^2)' 4520 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'NMR Distance Restraints' _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 1 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 1 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 1 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 19 N3 ? ? A G 2 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 19 O2 ? ? A G 2 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 19 N4 ? ? A G 2 A C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 18 N3 ? ? A A 3 A U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 18 O4 ? ? A A 3 A U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 17 N1 ? ? A U 4 A A 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 17 N6 ? ? A U 4 A A 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 15 N3 ? ? A G 5 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 15 O2 ? ? A G 5 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 15 N4 ? ? A G 5 A C 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 14 N1 ? ? A C 6 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 14 O6 ? ? A C 6 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 14 N2 ? ? A C 6 A G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 13 N1 ? ? A U 7 A A 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 13 N6 ? ? A U 7 A A 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 1 _pdbx_validate_close_contact.auth_atom_id_1 H3 _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 U _pdbx_validate_close_contact.auth_seq_id_1 4 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 H61 _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 A _pdbx_validate_close_contact.auth_seq_id_2 17 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 1.28 # _pdbx_entry_details.entry_id 7FJ0 _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # _pdbx_nmr_ensemble.entry_id 7FJ0 _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 11 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 7FJ0 _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'minimized average structure' # _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.contents ;0.18 mM RNA (5'-R(*GP*GP*AP*UP*GP*CP*UP*UP*AP*CP*UP*CP*AP*GP*CP*GP*AP*UP*CP*C)-3'), 95% H2O/5% D2O ; _pdbx_nmr_sample_details.solvent_system '95% H2O/5% D2O' _pdbx_nmr_sample_details.label sample1 _pdbx_nmr_sample_details.type solution _pdbx_nmr_sample_details.details ? # _pdbx_nmr_exptl_sample.solution_id 1 _pdbx_nmr_exptl_sample.component ;RNA (5'-R(*GP*GP*AP*UP*GP*CP*UP*UP*AP*CP*UP*CP*AP*GP*CP*GP*AP*UP*CP*C)-3') ; _pdbx_nmr_exptl_sample.concentration 0.18 _pdbx_nmr_exptl_sample.concentration_range ? _pdbx_nmr_exptl_sample.concentration_units mM _pdbx_nmr_exptl_sample.isotopic_labeling none # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 288 _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 6.5 _pdbx_nmr_exptl_sample_conditions.ionic_strength 50 _pdbx_nmr_exptl_sample_conditions.details '20 mM sodium phosphate buffer (pH 6.5) with 50 mM sodium chloride' _pdbx_nmr_exptl_sample_conditions.ionic_strength_err ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_units mM _pdbx_nmr_exptl_sample_conditions.label condition_1 _pdbx_nmr_exptl_sample_conditions.pH_err ? _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.pressure_err ? _pdbx_nmr_exptl_sample_conditions.temperature_err ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D NOESY' 1 isotropic 2 1 1 '2D HOHAHA' 1 isotropic # _pdbx_nmr_refine.entry_id 7FJ0 _pdbx_nmr_refine.method na _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 refinement CNS 1.3 'Brunger, Adams, Clore, Gros, Nilges and Read' 2 'structure calculation' CNS 1.3 'Brunger, Adams, Clore, Gros, Nilges and Read' 3 'chemical shift assignment' Sparky 3.114 Goddard 4 'peak picking' Sparky 3.114 Goddard # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 53D C5 C N N 1 53D C2 C Y N 2 53D C7 C Y N 3 53D N14 N N N 4 53D C13 C N N 5 53D C8 C Y N 6 53D C4 C N N 7 53D C3 C Y N 8 53D C21 C N N 9 53D C20 C N N 10 53D C18 C N N 11 53D N17 N N N 12 53D C16 C N N 13 53D C19 C N N 14 53D C15 C N N 15 53D C12 C N N 16 53D C28 C N N 17 53D C29 C N N 18 53D N27 N N N 19 53D C26 C N N 20 53D C25 C N N 21 53D C24 C N N 22 53D O22 O N N 23 53D N23 N N N 24 53D C11 C N N 25 53D C22 C N N 26 53D O4 O N N 27 53D F9 F N N 28 53D C6 C N N 29 53D N1 N N N 30 53D C10 C Y N 31 53D C9 C Y N 32 53D H7 H N N 33 53D H132 H N N 34 53D H131 H N N 35 53D H211 H N N 36 53D H213 H N N 37 53D H212 H N N 38 53D H202 H N N 39 53D H201 H N N 40 53D H181 H N N 41 53D H182 H N N 42 53D H161 H N N 43 53D H162 H N N 44 53D H192 H N N 45 53D H191 H N N 46 53D H152 H N N 47 53D H151 H N N 48 53D H121 H N N 49 53D H122 H N N 50 53D H282 H N N 51 53D H281 H N N 52 53D H283 H N N 53 53D H291 H N N 54 53D H293 H N N 55 53D H292 H N N 56 53D H261 H N N 57 53D H262 H N N 58 53D H252 H N N 59 53D H251 H N N 60 53D H242 H N N 61 53D H241 H N N 62 53D H23 H N N 63 53D H11 H N N 64 53D H6 H N N 65 53D H10 H N N 66 A OP3 O N N 67 A P P N N 68 A OP1 O N N 69 A OP2 O N N 70 A "O5'" O N N 71 A "C5'" C N N 72 A "C4'" C N R 73 A "O4'" O N N 74 A "C3'" C N S 75 A "O3'" O N N 76 A "C2'" C N R 77 A "O2'" O N N 78 A "C1'" C N R 79 A N9 N Y N 80 A C8 C Y N 81 A N7 N Y N 82 A C5 C Y N 83 A C6 C Y N 84 A N6 N N N 85 A N1 N Y N 86 A C2 C Y N 87 A N3 N Y N 88 A C4 C Y N 89 A HOP3 H N N 90 A HOP2 H N N 91 A "H5'" H N N 92 A "H5''" H N N 93 A "H4'" H N N 94 A "H3'" H N N 95 A "HO3'" H N N 96 A "H2'" H N N 97 A "HO2'" H N N 98 A "H1'" H N N 99 A H8 H N N 100 A H61 H N N 101 A H62 H N N 102 A H2 H N N 103 C OP3 O N N 104 C P P N N 105 C OP1 O N N 106 C OP2 O N N 107 C "O5'" O N N 108 C "C5'" C N N 109 C "C4'" C N R 110 C "O4'" O N N 111 C "C3'" C N S 112 C "O3'" O N N 113 C "C2'" C N R 114 C "O2'" O N N 115 C "C1'" C N R 116 C N1 N N N 117 C C2 C N N 118 C O2 O N N 119 C N3 N N N 120 C C4 C N N 121 C N4 N N N 122 C C5 C N N 123 C C6 C N N 124 C HOP3 H N N 125 C HOP2 H N N 126 C "H5'" H N N 127 C "H5''" H N N 128 C "H4'" H N N 129 C "H3'" H N N 130 C "HO3'" H N N 131 C "H2'" H N N 132 C "HO2'" H N N 133 C "H1'" H N N 134 C H41 H N N 135 C H42 H N N 136 C H5 H N N 137 C H6 H N N 138 G OP3 O N N 139 G P P N N 140 G OP1 O N N 141 G OP2 O N N 142 G "O5'" O N N 143 G "C5'" C N N 144 G "C4'" C N R 145 G "O4'" O N N 146 G "C3'" C N S 147 G "O3'" O N N 148 G "C2'" C N R 149 G "O2'" O N N 150 G "C1'" C N R 151 G N9 N Y N 152 G C8 C Y N 153 G N7 N Y N 154 G C5 C Y N 155 G C6 C N N 156 G O6 O N N 157 G N1 N N N 158 G C2 C N N 159 G N2 N N N 160 G N3 N N N 161 G C4 C Y N 162 G HOP3 H N N 163 G HOP2 H N N 164 G "H5'" H N N 165 G "H5''" H N N 166 G "H4'" H N N 167 G "H3'" H N N 168 G "HO3'" H N N 169 G "H2'" H N N 170 G "HO2'" H N N 171 G "H1'" H N N 172 G H8 H N N 173 G H1 H N N 174 G H21 H N N 175 G H22 H N N 176 U OP3 O N N 177 U P P N N 178 U OP1 O N N 179 U OP2 O N N 180 U "O5'" O N N 181 U "C5'" C N N 182 U "C4'" C N R 183 U "O4'" O N N 184 U "C3'" C N S 185 U "O3'" O N N 186 U "C2'" C N R 187 U "O2'" O N N 188 U "C1'" C N R 189 U N1 N N N 190 U C2 C N N 191 U O2 O N N 192 U N3 N N N 193 U C4 C N N 194 U O4 O N N 195 U C5 C N N 196 U C6 C N N 197 U HOP3 H N N 198 U HOP2 H N N 199 U "H5'" H N N 200 U "H5''" H N N 201 U "H4'" H N N 202 U "H3'" H N N 203 U "HO3'" H N N 204 U "H2'" H N N 205 U "HO2'" H N N 206 U "H1'" H N N 207 U H3 H N N 208 U H5 H N N 209 U H6 H N N 210 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 53D O22 C22 doub N N 1 53D C12 C11 sing N N 2 53D C12 C13 sing N N 3 53D C22 C5 sing N N 4 53D C22 N23 sing N N 5 53D C11 N1 sing N N 6 53D C11 C13 sing N N 7 53D C25 C26 sing N N 8 53D C25 C24 sing N N 9 53D C6 C5 doub N N 10 53D C6 N1 sing N N 11 53D C5 C4 sing N N 12 53D N1 C2 sing N N 13 53D C2 C7 doub Y N 14 53D C2 C3 sing Y N 15 53D C4 C3 sing N N 16 53D C4 O4 doub N N 17 53D C7 C8 sing Y N 18 53D C19 N14 sing N N 19 53D C19 C18 sing N N 20 53D C3 C10 doub Y N 21 53D C8 N14 sing N N 22 53D C8 C9 doub Y N 23 53D N14 C15 sing N N 24 53D C10 C9 sing Y N 25 53D C9 F9 sing N N 26 53D C26 N27 sing N N 27 53D C20 C21 sing N N 28 53D C20 N17 sing N N 29 53D C24 N23 sing N N 30 53D C18 N17 sing N N 31 53D C15 C16 sing N N 32 53D N17 C16 sing N N 33 53D N27 C28 sing N N 34 53D N27 C29 sing N N 35 53D C7 H7 sing N N 36 53D C13 H132 sing N N 37 53D C13 H131 sing N N 38 53D C21 H211 sing N N 39 53D C21 H213 sing N N 40 53D C21 H212 sing N N 41 53D C20 H202 sing N N 42 53D C20 H201 sing N N 43 53D C18 H181 sing N N 44 53D C18 H182 sing N N 45 53D C16 H161 sing N N 46 53D C16 H162 sing N N 47 53D C19 H192 sing N N 48 53D C19 H191 sing N N 49 53D C15 H152 sing N N 50 53D C15 H151 sing N N 51 53D C12 H121 sing N N 52 53D C12 H122 sing N N 53 53D C28 H282 sing N N 54 53D C28 H281 sing N N 55 53D C28 H283 sing N N 56 53D C29 H291 sing N N 57 53D C29 H293 sing N N 58 53D C29 H292 sing N N 59 53D C26 H261 sing N N 60 53D C26 H262 sing N N 61 53D C25 H252 sing N N 62 53D C25 H251 sing N N 63 53D C24 H242 sing N N 64 53D C24 H241 sing N N 65 53D N23 H23 sing N N 66 53D C11 H11 sing N N 67 53D C6 H6 sing N N 68 53D C10 H10 sing N N 69 A OP3 P sing N N 70 A OP3 HOP3 sing N N 71 A P OP1 doub N N 72 A P OP2 sing N N 73 A P "O5'" sing N N 74 A OP2 HOP2 sing N N 75 A "O5'" "C5'" sing N N 76 A "C5'" "C4'" sing N N 77 A "C5'" "H5'" sing N N 78 A "C5'" "H5''" sing N N 79 A "C4'" "O4'" sing N N 80 A "C4'" "C3'" sing N N 81 A "C4'" "H4'" sing N N 82 A "O4'" "C1'" sing N N 83 A "C3'" "O3'" sing N N 84 A "C3'" "C2'" sing N N 85 A "C3'" "H3'" sing N N 86 A "O3'" "HO3'" sing N N 87 A "C2'" "O2'" sing N N 88 A "C2'" "C1'" sing N N 89 A "C2'" "H2'" sing N N 90 A "O2'" "HO2'" sing N N 91 A "C1'" N9 sing N N 92 A "C1'" "H1'" sing N N 93 A N9 C8 sing Y N 94 A N9 C4 sing Y N 95 A C8 N7 doub Y N 96 A C8 H8 sing N N 97 A N7 C5 sing Y N 98 A C5 C6 sing Y N 99 A C5 C4 doub Y N 100 A C6 N6 sing N N 101 A C6 N1 doub Y N 102 A N6 H61 sing N N 103 A N6 H62 sing N N 104 A N1 C2 sing Y N 105 A C2 N3 doub Y N 106 A C2 H2 sing N N 107 A N3 C4 sing Y N 108 C OP3 P sing N N 109 C OP3 HOP3 sing N N 110 C P OP1 doub N N 111 C P OP2 sing N N 112 C P "O5'" sing N N 113 C OP2 HOP2 sing N N 114 C "O5'" "C5'" sing N N 115 C "C5'" "C4'" sing N N 116 C "C5'" "H5'" sing N N 117 C "C5'" "H5''" sing N N 118 C "C4'" "O4'" sing N N 119 C "C4'" "C3'" sing N N 120 C "C4'" "H4'" sing N N 121 C "O4'" "C1'" sing N N 122 C "C3'" "O3'" sing N N 123 C "C3'" "C2'" sing N N 124 C "C3'" "H3'" sing N N 125 C "O3'" "HO3'" sing N N 126 C "C2'" "O2'" sing N N 127 C "C2'" "C1'" sing N N 128 C "C2'" "H2'" sing N N 129 C "O2'" "HO2'" sing N N 130 C "C1'" N1 sing N N 131 C "C1'" "H1'" sing N N 132 C N1 C2 sing N N 133 C N1 C6 sing N N 134 C C2 O2 doub N N 135 C C2 N3 sing N N 136 C N3 C4 doub N N 137 C C4 N4 sing N N 138 C C4 C5 sing N N 139 C N4 H41 sing N N 140 C N4 H42 sing N N 141 C C5 C6 doub N N 142 C C5 H5 sing N N 143 C C6 H6 sing N N 144 G OP3 P sing N N 145 G OP3 HOP3 sing N N 146 G P OP1 doub N N 147 G P OP2 sing N N 148 G P "O5'" sing N N 149 G OP2 HOP2 sing N N 150 G "O5'" "C5'" sing N N 151 G "C5'" "C4'" sing N N 152 G "C5'" "H5'" sing N N 153 G "C5'" "H5''" sing N N 154 G "C4'" "O4'" sing N N 155 G "C4'" "C3'" sing N N 156 G "C4'" "H4'" sing N N 157 G "O4'" "C1'" sing N N 158 G "C3'" "O3'" sing N N 159 G "C3'" "C2'" sing N N 160 G "C3'" "H3'" sing N N 161 G "O3'" "HO3'" sing N N 162 G "C2'" "O2'" sing N N 163 G "C2'" "C1'" sing N N 164 G "C2'" "H2'" sing N N 165 G "O2'" "HO2'" sing N N 166 G "C1'" N9 sing N N 167 G "C1'" "H1'" sing N N 168 G N9 C8 sing Y N 169 G N9 C4 sing Y N 170 G C8 N7 doub Y N 171 G C8 H8 sing N N 172 G N7 C5 sing Y N 173 G C5 C6 sing N N 174 G C5 C4 doub Y N 175 G C6 O6 doub N N 176 G C6 N1 sing N N 177 G N1 C2 sing N N 178 G N1 H1 sing N N 179 G C2 N2 sing N N 180 G C2 N3 doub N N 181 G N2 H21 sing N N 182 G N2 H22 sing N N 183 G N3 C4 sing N N 184 U OP3 P sing N N 185 U OP3 HOP3 sing N N 186 U P OP1 doub N N 187 U P OP2 sing N N 188 U P "O5'" sing N N 189 U OP2 HOP2 sing N N 190 U "O5'" "C5'" sing N N 191 U "C5'" "C4'" sing N N 192 U "C5'" "H5'" sing N N 193 U "C5'" "H5''" sing N N 194 U "C4'" "O4'" sing N N 195 U "C4'" "C3'" sing N N 196 U "C4'" "H4'" sing N N 197 U "O4'" "C1'" sing N N 198 U "C3'" "O3'" sing N N 199 U "C3'" "C2'" sing N N 200 U "C3'" "H3'" sing N N 201 U "O3'" "HO3'" sing N N 202 U "C2'" "O2'" sing N N 203 U "C2'" "C1'" sing N N 204 U "C2'" "H2'" sing N N 205 U "O2'" "HO2'" sing N N 206 U "C1'" N1 sing N N 207 U "C1'" "H1'" sing N N 208 U N1 C2 sing N N 209 U N1 C6 sing N N 210 U C2 O2 doub N N 211 U C2 N3 sing N N 212 U N3 C4 sing N N 213 U N3 H3 sing N N 214 U C4 O4 doub N N 215 U C4 C5 sing N N 216 U C5 C6 doub N N 217 U C5 H5 sing N N 218 U C6 H6 sing N N 219 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7FJ0 'a-form double helix' 7FJ0 'hairpin loop' 7FJ0 'bulge loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 20 1_555 0.876 -0.126 -0.021 0.998 0.607 -0.540 1 A_G1:C20_A A 1 ? A 20 ? 19 1 1 A G 2 1_555 A C 19 1_555 -0.040 -0.179 -0.335 -3.484 -1.681 -1.948 2 A_G2:C19_A A 2 ? A 19 ? 19 1 1 A A 3 1_555 A U 18 1_555 -0.751 -0.205 0.056 1.082 -0.374 -0.826 3 A_A3:U18_A A 3 ? A 18 ? 20 1 1 A U 4 1_555 A A 17 1_555 1.151 -0.500 -0.090 -1.663 -3.779 -0.609 4 A_U4:A17_A A 4 ? A 17 ? 20 1 1 A G 5 1_555 A C 15 1_555 -0.433 -0.709 0.823 -13.946 -8.386 -5.526 5 A_G5:C15_A A 5 ? A 15 ? 19 1 1 A C 6 1_555 A G 14 1_555 0.413 -0.386 0.127 -4.424 2.664 -1.453 6 A_C6:G14_A A 6 ? A 14 ? 19 1 1 A U 7 1_555 A A 13 1_555 1.091 -0.443 0.006 0.089 -0.438 -0.644 7 A_U7:A13_A A 7 ? A 13 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 20 1_555 A G 2 1_555 A C 19 1_555 -0.620 -1.533 3.149 4.090 15.871 28.146 -5.064 1.707 1.927 29.666 -7.646 32.487 1 AA_G1G2:C19C20_AA A 1 ? A 20 ? A 2 ? A 19 ? 1 A G 2 1_555 A C 19 1_555 A A 3 1_555 A U 18 1_555 0.513 -1.001 3.356 -3.702 -0.800 30.922 -1.708 -1.677 3.298 -1.493 6.910 31.147 2 AA_G2A3:U18C19_AA A 2 ? A 19 ? A 3 ? A 18 ? 1 A A 3 1_555 A U 18 1_555 A U 4 1_555 A A 17 1_555 -0.600 -0.811 3.381 3.136 14.794 41.779 -2.440 1.084 2.897 19.976 -4.235 44.317 3 AA_A3U4:A17U18_AA A 3 ? A 18 ? A 4 ? A 17 ? 1 A G 5 1_555 A C 15 1_555 A C 6 1_555 A G 14 1_555 0.015 -0.616 3.259 1.127 1.268 31.594 -1.362 0.180 3.231 2.328 -2.067 31.638 4 AA_G5C6:G14C15_AA A 5 ? A 15 ? A 6 ? A 14 ? 1 A C 6 1_555 A G 14 1_555 A U 7 1_555 A A 13 1_555 -0.208 -0.668 4.625 5.859 -4.847 30.352 0.068 1.967 4.556 -9.079 -10.974 31.268 5 AA_C6U7:A13G14_AA A 6 ? A 14 ? A 7 ? A 13 ? # _pdbx_audit_support.funding_organization 'Not funded' _pdbx_audit_support.country ? _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id 53D _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id 53D _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.model AVANCE _pdbx_nmr_spectrometer.type ? _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.field_strength 600 _pdbx_nmr_spectrometer.details ? # _atom_sites.entry_id 7FJ0 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C F H N O P # loop_