data_7JPC # _entry.id 7JPC # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7JPC pdb_00007jpc 10.2210/pdb7jpc/pdb WWPDB D_1000250925 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7JPC _pdbx_database_status.recvd_initial_deposition_date 2020-08-07 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Simmons, C.R.' 1 0000-0002-2290-6132 'MacCulloch, T.' 2 0000-0001-5875-3361 'Stephanopoulos, N.' 3 0000-0001-7859-410X 'Yan, H.' 4 0000-0001-7397-9852 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nat Commun' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2041-1723 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 13 _citation.language ? _citation.page_first 3112 _citation.page_last 3112 _citation.title 'The influence of Holliday junction sequence and dynamics on DNA crystal self-assembly.' _citation.year 2022 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41467-022-30779-6 _citation.pdbx_database_id_PubMed 35662248 _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Simmons, C.R.' 1 ? primary 'MacCulloch, T.' 2 ? primary 'Krepl, M.' 3 0000-0002-9833-4281 primary 'Matthies, M.' 4 ? primary 'Buchberger, A.' 5 ? primary 'Crawford, I.' 6 ? primary 'Sponer, J.' 7 0000-0001-6558-6186 primary 'Sulc, P.' 8 0000-0003-1565-6769 primary 'Stephanopoulos, N.' 9 0000-0001-7859-410X primary 'Yan, H.' 10 0000-0001-7397-9852 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 7JPC _cell.details ? _cell.formula_units_Z ? _cell.length_a 68.017 _cell.length_a_esd ? _cell.length_b 68.017 _cell.length_b_esd ? _cell.length_c 54.047 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 3 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7JPC _symmetry.cell_setting ? _symmetry.Int_Tables_number 145 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 32' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*GP*AP*GP*CP*AP*GP*AP*CP*CP*AP*GP*AP*CP*GP*GP*TP*AP*CP*TP*CP*A)-3') ; 6466.201 1 ? ? ? ? 2 polymer syn ;DNA (5'-D(P*CP*CP*GP*TP*CP*T)-3') ; 1760.179 1 ? ? ? ? 3 polymer syn ;DNA (5'-D(*TP*CP*TP*GP*AP*GP*TP*A)-3') ; 2441.628 1 ? ? ? ? 4 polymer syn ;DNA (5'-D(P*GP*GP*TP*CP*TP*GP*C)-3') ; 2129.409 1 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no no ;(DG)(DA)(DG)(DC)(DA)(DG)(DA)(DC)(DC)(DA)(DG)(DA)(DC)(DG)(DG)(DT)(DA)(DC)(DT)(DC) (DA) ; GAGCAGACCAGACGGTACTCA A ? 2 polydeoxyribonucleotide no no '(DC)(DC)(DG)(DT)(DC)(DT)' CCGTCT B ? 3 polydeoxyribonucleotide no no '(DT)(DC)(DT)(DG)(DA)(DG)(DT)(DA)' TCTGAGTA C ? 4 polydeoxyribonucleotide no no '(DG)(DG)(DT)(DC)(DT)(DG)(DC)' GGTCTGC D ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DA n 1 3 DG n 1 4 DC n 1 5 DA n 1 6 DG n 1 7 DA n 1 8 DC n 1 9 DC n 1 10 DA n 1 11 DG n 1 12 DA n 1 13 DC n 1 14 DG n 1 15 DG n 1 16 DT n 1 17 DA n 1 18 DC n 1 19 DT n 1 20 DC n 1 21 DA n 2 1 DC n 2 2 DC n 2 3 DG n 2 4 DT n 2 5 DC n 2 6 DT n 3 1 DT n 3 2 DC n 3 3 DT n 3 4 DG n 3 5 DA n 3 6 DG n 3 7 DT n 3 8 DA n 4 1 DG n 4 2 DG n 4 3 DT n 4 4 DC n 4 5 DT n 4 6 DG n 4 7 DC n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 21 'synthetic construct' ? 32630 ? 2 1 sample 1 6 'synthetic construct' ? 32630 ? 3 1 sample 1 8 'synthetic construct' ? 32630 ? 4 1 sample 1 7 'synthetic construct' ? 32630 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 7JPC 7JPC ? 1 ? 1 2 PDB 7JPC 7JPC ? 2 ? 1 3 PDB 7JPC 7JPC ? 3 ? 1 4 PDB 7JPC 7JPC ? 4 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 7JPC A 1 ? 21 ? 7JPC 1 ? 21 ? 1 21 2 2 7JPC B 1 ? 6 ? 7JPC 0 ? 5 ? 0 5 3 3 7JPC C 1 ? 8 ? 7JPC 1 ? 8 ? 1 8 4 4 7JPC D 1 ? 7 ? 7JPC 10 ? 16 ? 10 16 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7JPC _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 5.64 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 78.19 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 298 _exptl_crystal_grow.temp_details 'temperature gradient generated from 60 to 25 C at 0.3 degrees per hour' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.5 mL of 0.05 M Cacodylate pH 6.5 with 1.0 mM spermine, 2.0 mM CoH18N6, 30 mM CaCl2, and 2.0 M LiCl was added to the reservoir with 2 uL added to the drop containing 4 uL of DNA stock ; _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS3 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2017-04-15 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.92 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'ALS BEAMLINE 5.0.2' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.92 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 5.0.2 _diffrn_source.pdbx_synchrotron_site ALS # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 7JPC _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.100 _reflns.d_resolution_low 58.9 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 3716 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 73.200 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 4.700 _reflns.pdbx_Rmerge_I_obs 0.077 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 7.600 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 1.425 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.085 _reflns.pdbx_Rpim_I_all 0.037 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.978 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_all _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split 3.100 3.150 ? ? ? ? ? ? 78 34.400 ? ? ? ? 0.505 ? ? ? ? ? ? ? ? 3.700 ? 0.680 ? ? 0.577 0.274 ? 1 1 0.875 ? ? 3.150 3.210 ? ? ? ? ? ? 109 39.900 ? ? ? ? 0.166 ? ? ? ? ? ? ? ? 3.900 ? 0.939 ? ? 0.189 0.088 ? 2 1 0.982 ? ? 3.210 3.270 ? ? ? ? ? ? 104 41.300 ? ? ? ? 0.151 ? ? ? ? ? ? ? ? 4.100 ? 1.342 ? ? 0.170 0.078 ? 3 1 0.989 ? ? 3.270 3.340 ? ? ? ? ? ? 110 42.100 ? ? ? ? 0.192 ? ? ? ? ? ? ? ? 4.200 ? 1.024 ? ? 0.217 0.098 ? 4 1 0.981 ? ? 3.340 3.410 ? ? ? ? ? ? 131 52.800 ? ? ? ? 0.122 ? ? ? ? ? ? ? ? 4.000 ? 1.166 ? ? 0.136 0.061 ? 5 1 0.992 ? ? 3.410 3.490 ? ? ? ? ? ? 128 51.800 ? ? ? ? 0.302 ? ? ? ? ? ? ? ? 4.100 ? 0.731 ? ? 0.341 0.156 ? 6 1 0.916 ? ? 3.490 3.580 ? ? ? ? ? ? 149 57.300 ? ? ? ? 0.220 ? ? ? ? ? ? ? ? 4.300 ? 0.630 ? ? 0.247 0.112 ? 7 1 0.955 ? ? 3.580 3.680 ? ? ? ? ? ? 156 60.200 ? ? ? ? 0.279 ? ? ? ? ? ? ? ? 4.300 ? 0.715 ? ? 0.315 0.143 ? 8 1 0.952 ? ? 3.680 3.780 ? ? ? ? ? ? 162 63.300 ? ? ? ? 0.341 ? ? ? ? ? ? ? ? 4.300 ? 0.647 ? ? 0.383 0.172 ? 9 1 0.919 ? ? 3.780 3.910 ? ? ? ? ? ? 177 68.300 ? ? ? ? 0.339 ? ? ? ? ? ? ? ? 4.700 ? 0.656 ? ? 0.380 0.170 ? 10 1 0.931 ? ? 3.910 4.040 ? ? ? ? ? ? 192 81.700 ? ? ? ? 0.320 ? ? ? ? ? ? ? ? 4.500 ? 0.650 ? ? 0.357 0.158 ? 11 1 0.957 ? ? 4.040 4.210 ? ? ? ? ? ? 219 83.300 ? ? ? ? 0.282 ? ? ? ? ? ? ? ? 4.600 ? 0.718 ? ? 0.315 0.139 ? 12 1 0.955 ? ? 4.210 4.400 ? ? ? ? ? ? 236 91.500 ? ? ? ? 0.272 ? ? ? ? ? ? ? ? 4.500 ? 0.702 ? ? 0.304 0.135 ? 13 1 0.965 ? ? 4.400 4.630 ? ? ? ? ? ? 236 97.500 ? ? ? ? 0.267 ? ? ? ? ? ? ? ? 4.700 ? 0.684 ? ? 0.297 0.130 ? 14 1 0.969 ? ? 4.630 4.920 ? ? ? ? ? ? 265 99.300 ? ? ? ? 0.173 ? ? ? ? ? ? ? ? 4.800 ? 0.845 ? ? 0.193 0.085 ? 15 1 0.983 ? ? 4.920 5.300 ? ? ? ? ? ? 246 100.000 ? ? ? ? 0.145 ? ? ? ? ? ? ? ? 5.200 ? 1.182 ? ? 0.161 0.070 ? 16 1 0.986 ? ? 5.300 5.830 ? ? ? ? ? ? 257 100.000 ? ? ? ? 0.120 ? ? ? ? ? ? ? ? 5.200 ? 1.943 ? ? 0.133 0.057 ? 17 1 0.987 ? ? 5.830 6.670 ? ? ? ? ? ? 255 100.000 ? ? ? ? 0.108 ? ? ? ? ? ? ? ? 5.300 ? 2.143 ? ? 0.119 0.051 ? 18 1 0.990 ? ? 6.670 8.400 ? ? ? ? ? ? 256 100.000 ? ? ? ? 0.069 ? ? ? ? ? ? ? ? 5.200 ? 2.887 ? ? 0.076 0.033 ? 19 1 0.997 ? ? 8.400 50.000 ? ? ? ? ? ? 250 98.000 ? ? ? ? 0.053 ? ? ? ? ? ? ? ? 5.300 ? 4.017 ? ? 0.059 0.025 ? 20 1 0.997 ? ? # _refine.aniso_B[1][1] -0.8500 _refine.aniso_B[1][2] -0.4300 _refine.aniso_B[1][3] 0.0000 _refine.aniso_B[2][2] -0.8500 _refine.aniso_B[2][3] 0.0000 _refine.aniso_B[3][3] 2.7600 _refine.B_iso_max 245.920 _refine.B_iso_mean 122.0460 _refine.B_iso_min 65.100 _refine.correlation_coeff_Fo_to_Fc 0.9870 _refine.correlation_coeff_Fo_to_Fc_free 0.9860 _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7JPC _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.1000 _refine.ls_d_res_low 58.9000 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 3344 _refine.ls_number_reflns_R_free 362 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 73.2300 _refine.ls_percent_reflns_R_free 9.8000 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.1834 _refine.ls_R_factor_R_free 0.2132 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1800 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details MASK _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 0.000 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 5VY6 _refine.pdbx_stereochemistry_target_values 'MAXIMUM LIKELIHOOD' _refine.pdbx_R_Free_selection_details RANDOM _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free 0.3840 _refine.pdbx_solvent_vdw_probe_radii 1.2000 _refine.pdbx_solvent_ion_probe_radii 0.8000 _refine.pdbx_solvent_shrinkage_radii 0.8000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B 29.2770 _refine.overall_SU_ML 0.4830 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id final _refine_hist.details ? _refine_hist.d_res_high 3.1000 _refine_hist.d_res_low 58.9000 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 855 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total 42 _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 855 _refine_hist.pdbx_number_atoms_ligand 0 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.007 0.011 956 ? r_bond_refined_d ? ? 'X-RAY DIFFRACTION' ? 0.005 0.020 473 ? r_bond_other_d ? ? 'X-RAY DIFFRACTION' ? 1.169 1.171 1467 ? r_angle_refined_deg ? ? 'X-RAY DIFFRACTION' ? 1.849 3.000 1121 ? r_angle_other_deg ? ? 'X-RAY DIFFRACTION' ? 0.078 0.200 126 ? r_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.010 0.020 505 ? r_gen_planes_refined ? ? 'X-RAY DIFFRACTION' ? 0.003 0.020 214 ? r_gen_planes_other ? ? # _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.d_res_high 3.1000 _refine_ls_shell.d_res_low 3.1810 _refine_ls_shell.number_reflns_all 139 _refine_ls_shell.number_reflns_obs ? _refine_ls_shell.number_reflns_R_free 20 _refine_ls_shell.number_reflns_R_work 119 _refine_ls_shell.percent_reflns_obs 36.7700 _refine_ls_shell.percent_reflns_R_free ? _refine_ls_shell.R_factor_all ? _refine_ls_shell.R_factor_obs ? _refine_ls_shell.R_factor_R_free 0.2340 _refine_ls_shell.R_factor_R_free_error 0.0000 _refine_ls_shell.R_factor_R_work 0.3340 _refine_ls_shell.redundancy_reflns_all ? _refine_ls_shell.redundancy_reflns_obs ? _refine_ls_shell.wR_factor_all ? _refine_ls_shell.wR_factor_obs ? _refine_ls_shell.wR_factor_R_free ? _refine_ls_shell.wR_factor_R_work ? _refine_ls_shell.pdbx_R_complete ? _refine_ls_shell.pdbx_total_number_of_bins_used 20 _refine_ls_shell.pdbx_phase_error ? _refine_ls_shell.pdbx_fsc_work ? _refine_ls_shell.pdbx_fsc_free ? # _struct.entry_id 7JPC _struct.title 'Self-assembly of a 3D DNA crystal lattice (4x6 duplex version) containing the J7 immobile Holliday junction' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7JPC _struct_keywords.text 'Structural DNA nanotechnology, immobile Holliday junctions, 3D DNA self-assembly, designer DNA crystals, DNA' _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 3 N1 ? ? ? 1_555 D DC 7 N3 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DG 3 N2 ? ? ? 1_555 D DC 7 O2 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DG 3 O6 ? ? ? 1_555 D DC 7 N4 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DC 4 N3 ? ? ? 1_555 D DG 6 N1 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DC 4 N4 ? ? ? 1_555 D DG 6 O6 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DC 4 O2 ? ? ? 1_555 D DG 6 N2 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DA 5 N1 ? ? ? 1_555 D DT 5 N3 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DA 5 N6 ? ? ? 1_555 D DT 5 O4 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DG 6 O6 ? ? ? 1_555 D DC 4 N4 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? 'DG-DC PAIR' ? ? ? hydrog10 hydrog ? ? A DA 7 N1 ? ? ? 1_555 D DT 3 N3 ? ? A DA 7 D DT 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DA 7 N6 ? ? ? 1_555 D DT 3 O4 ? ? A DA 7 D DT 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DC 8 N3 ? ? ? 1_555 D DG 2 N1 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DC 8 N4 ? ? ? 1_555 D DG 2 O6 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DC 8 O2 ? ? ? 1_555 D DG 2 N2 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DC 9 N3 ? ? ? 1_555 D DG 1 N1 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 9 N4 ? ? ? 1_555 D DG 1 O6 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DC 9 O2 ? ? ? 1_555 D DG 1 N2 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DA 10 N1 ? ? ? 1_555 B DT 6 N3 ? ? A DA 10 B DT 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DA 10 N6 ? ? ? 1_555 B DT 6 O4 ? ? A DA 10 B DT 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DG 11 N1 ? ? ? 1_555 B DC 5 N3 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DG 11 N2 ? ? ? 1_555 B DC 5 O2 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DG 11 O6 ? ? ? 1_555 B DC 5 N4 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DA 12 N1 ? ? ? 1_555 B DT 4 N3 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DA 12 N6 ? ? ? 1_555 B DT 4 O4 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DC 13 N3 ? ? ? 1_555 B DG 3 N1 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DC 13 N4 ? ? ? 1_555 B DG 3 O6 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DC 13 O2 ? ? ? 1_555 B DG 3 N2 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DG 14 N1 ? ? ? 1_555 B DC 2 N3 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DG 14 N2 ? ? ? 1_555 B DC 2 O2 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A DG 14 O6 ? ? ? 1_555 B DC 2 N4 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A DG 15 N1 ? ? ? 1_555 B DC 1 N3 ? ? A DG 15 B DC 0 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A DG 15 N2 ? ? ? 1_555 B DC 1 O2 ? ? A DG 15 B DC 0 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DG 15 O6 ? ? ? 1_555 B DC 1 N4 ? ? A DG 15 B DC 0 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DT 16 N3 ? ? ? 1_555 C DA 8 N1 ? ? A DT 16 C DA 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DT 16 O4 ? ? ? 1_555 C DA 8 N6 ? ? A DT 16 C DA 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DA 17 N1 ? ? ? 1_555 C DT 7 N3 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DA 17 N6 ? ? ? 1_555 C DT 7 O4 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DC 18 N3 ? ? ? 1_555 C DG 6 N1 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DC 18 N4 ? ? ? 1_555 C DG 6 O6 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DC 18 O2 ? ? ? 1_555 C DG 6 N2 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DT 19 N3 ? ? ? 1_555 C DA 5 N1 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DT 19 O4 ? ? ? 1_555 C DA 5 N6 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DC 20 N3 ? ? ? 1_555 C DG 4 N1 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DC 20 N4 ? ? ? 1_555 C DG 4 O6 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A DC 20 O2 ? ? ? 1_555 C DG 4 N2 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A DA 21 N1 ? ? ? 1_555 C DT 3 N3 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A DA 21 N6 ? ? ? 1_555 C DT 3 O4 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 7JPC _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.014702 _atom_sites.fract_transf_matrix[1][2] 0.008488 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.016977 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.018502 _atom_sites.fract_transf_vector[1] 0.000000 _atom_sites.fract_transf_vector[2] 0.000000 _atom_sites.fract_transf_vector[3] 0.000000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C N O P # loop_ # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DA 2 2 2 DA DA A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DC 4 4 4 DC DC A . n A 1 5 DA 5 5 5 DA DA A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DA 7 7 7 DA DA A . n A 1 8 DC 8 8 8 DC DC A . n A 1 9 DC 9 9 9 DC DC A . n A 1 10 DA 10 10 10 DA DA A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DA 12 12 12 DA DA A . n A 1 13 DC 13 13 13 DC DC A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DT 16 16 16 DT DT A . n A 1 17 DA 17 17 17 DA DA A . n A 1 18 DC 18 18 18 DC DC A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DC 20 20 20 DC DC A . n A 1 21 DA 21 21 21 DA DA A . n B 2 1 DC 1 0 0 DC DC B . n B 2 2 DC 2 1 1 DC DC B . n B 2 3 DG 3 2 2 DG DG B . n B 2 4 DT 4 3 3 DT DT B . n B 2 5 DC 5 4 4 DC DC B . n B 2 6 DT 6 5 5 DT DT B . n C 3 1 DT 1 1 1 DT DT C . n C 3 2 DC 2 2 2 DC DC C . n C 3 3 DT 3 3 3 DT DT C . n C 3 4 DG 4 4 4 DG DG C . n C 3 5 DA 5 5 5 DA DA C . n C 3 6 DG 6 6 6 DG DG C . n C 3 7 DT 7 7 7 DT DT C . n C 3 8 DA 8 8 8 DA DA C . n D 4 1 DG 1 10 10 DG DG D . n D 4 2 DG 2 11 11 DG DG D . n D 4 3 DT 3 12 12 DT DT D . n D 4 4 DC 4 13 13 DC DC D . n D 4 5 DT 5 14 14 DT DT D . n D 4 6 DG 6 15 15 DG DG D . n D 4 7 DC 7 16 16 DC DC D . n # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details tetrameric _pdbx_struct_assembly.oligomeric_count 4 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 2200 ? 1 MORE -1 ? 1 'SSA (A^2)' 7860 ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2021-07-14 2 'Structure model' 1 1 2022-07-06 3 'Structure model' 1 2 2023-10-18 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' 3 3 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 2 'Structure model' database_2 4 3 'Structure model' chem_comp_atom 5 3 'Structure model' chem_comp_bond 6 3 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_CSD' 4 2 'Structure model' '_citation.journal_id_ISSN' 5 2 'Structure model' '_citation.journal_volume' 6 2 'Structure model' '_citation.page_first' 7 2 'Structure model' '_citation.page_last' 8 2 'Structure model' '_citation.pdbx_database_id_DOI' 9 2 'Structure model' '_citation.pdbx_database_id_PubMed' 10 2 'Structure model' '_citation.title' 11 2 'Structure model' '_citation.year' 12 2 'Structure model' '_database_2.pdbx_DOI' 13 2 'Structure model' '_database_2.pdbx_database_accession' # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 2 ? refinement ? ? ? ? ? ? ? ? ? ? ? REFMAC ? ? ? 5.8.0131 3 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? 3.25 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 5 # loop_ _pdbx_validate_symm_contact.id _pdbx_validate_symm_contact.PDB_model_num _pdbx_validate_symm_contact.auth_atom_id_1 _pdbx_validate_symm_contact.auth_asym_id_1 _pdbx_validate_symm_contact.auth_comp_id_1 _pdbx_validate_symm_contact.auth_seq_id_1 _pdbx_validate_symm_contact.PDB_ins_code_1 _pdbx_validate_symm_contact.label_alt_id_1 _pdbx_validate_symm_contact.site_symmetry_1 _pdbx_validate_symm_contact.auth_atom_id_2 _pdbx_validate_symm_contact.auth_asym_id_2 _pdbx_validate_symm_contact.auth_comp_id_2 _pdbx_validate_symm_contact.auth_seq_id_2 _pdbx_validate_symm_contact.PDB_ins_code_2 _pdbx_validate_symm_contact.label_alt_id_2 _pdbx_validate_symm_contact.site_symmetry_2 _pdbx_validate_symm_contact.dist 1 1 OP1 B DC 0 ? ? 1_555 "O3'" B DT 5 ? ? 3_675 1.65 2 1 "O5'" B DC 0 ? ? 1_555 "O3'" B DT 5 ? ? 3_675 2.12 # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 "C1'" _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 DA _pdbx_validate_rmsd_angle.auth_seq_id_1 5 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 "O4'" _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 DA _pdbx_validate_rmsd_angle.auth_seq_id_2 5 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 "C4'" _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 DA _pdbx_validate_rmsd_angle.auth_seq_id_3 5 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 103.74 _pdbx_validate_rmsd_angle.angle_target_value 110.10 _pdbx_validate_rmsd_angle.angle_deviation -6.36 _pdbx_validate_rmsd_angle.angle_standard_deviation 1.00 _pdbx_validate_rmsd_angle.linker_flag N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal DA OP3 O N N 1 DA P P N N 2 DA OP1 O N N 3 DA OP2 O N N 4 DA "O5'" O N N 5 DA "C5'" C N N 6 DA "C4'" C N R 7 DA "O4'" O N N 8 DA "C3'" C N S 9 DA "O3'" O N N 10 DA "C2'" C N N 11 DA "C1'" C N R 12 DA N9 N Y N 13 DA C8 C Y N 14 DA N7 N Y N 15 DA C5 C Y N 16 DA C6 C Y N 17 DA N6 N N N 18 DA N1 N Y N 19 DA C2 C Y N 20 DA N3 N Y N 21 DA C4 C Y N 22 DA HOP3 H N N 23 DA HOP2 H N N 24 DA "H5'" H N N 25 DA "H5''" H N N 26 DA "H4'" H N N 27 DA "H3'" H N N 28 DA "HO3'" H N N 29 DA "H2'" H N N 30 DA "H2''" H N N 31 DA "H1'" H N N 32 DA H8 H N N 33 DA H61 H N N 34 DA H62 H N N 35 DA H2 H N N 36 DC OP3 O N N 37 DC P P N N 38 DC OP1 O N N 39 DC OP2 O N N 40 DC "O5'" O N N 41 DC "C5'" C N N 42 DC "C4'" C N R 43 DC "O4'" O N N 44 DC "C3'" C N S 45 DC "O3'" O N N 46 DC "C2'" C N N 47 DC "C1'" C N R 48 DC N1 N N N 49 DC C2 C N N 50 DC O2 O N N 51 DC N3 N N N 52 DC C4 C N N 53 DC N4 N N N 54 DC C5 C N N 55 DC C6 C N N 56 DC HOP3 H N N 57 DC HOP2 H N N 58 DC "H5'" H N N 59 DC "H5''" H N N 60 DC "H4'" H N N 61 DC "H3'" H N N 62 DC "HO3'" H N N 63 DC "H2'" H N N 64 DC "H2''" H N N 65 DC "H1'" H N N 66 DC H41 H N N 67 DC H42 H N N 68 DC H5 H N N 69 DC H6 H N N 70 DG OP3 O N N 71 DG P P N N 72 DG OP1 O N N 73 DG OP2 O N N 74 DG "O5'" O N N 75 DG "C5'" C N N 76 DG "C4'" C N R 77 DG "O4'" O N N 78 DG "C3'" C N S 79 DG "O3'" O N N 80 DG "C2'" C N N 81 DG "C1'" C N R 82 DG N9 N Y N 83 DG C8 C Y N 84 DG N7 N Y N 85 DG C5 C Y N 86 DG C6 C N N 87 DG O6 O N N 88 DG N1 N N N 89 DG C2 C N N 90 DG N2 N N N 91 DG N3 N N N 92 DG C4 C Y N 93 DG HOP3 H N N 94 DG HOP2 H N N 95 DG "H5'" H N N 96 DG "H5''" H N N 97 DG "H4'" H N N 98 DG "H3'" H N N 99 DG "HO3'" H N N 100 DG "H2'" H N N 101 DG "H2''" H N N 102 DG "H1'" H N N 103 DG H8 H N N 104 DG H1 H N N 105 DG H21 H N N 106 DG H22 H N N 107 DT OP3 O N N 108 DT P P N N 109 DT OP1 O N N 110 DT OP2 O N N 111 DT "O5'" O N N 112 DT "C5'" C N N 113 DT "C4'" C N R 114 DT "O4'" O N N 115 DT "C3'" C N S 116 DT "O3'" O N N 117 DT "C2'" C N N 118 DT "C1'" C N R 119 DT N1 N N N 120 DT C2 C N N 121 DT O2 O N N 122 DT N3 N N N 123 DT C4 C N N 124 DT O4 O N N 125 DT C5 C N N 126 DT C7 C N N 127 DT C6 C N N 128 DT HOP3 H N N 129 DT HOP2 H N N 130 DT "H5'" H N N 131 DT "H5''" H N N 132 DT "H4'" H N N 133 DT "H3'" H N N 134 DT "HO3'" H N N 135 DT "H2'" H N N 136 DT "H2''" H N N 137 DT "H1'" H N N 138 DT H3 H N N 139 DT H71 H N N 140 DT H72 H N N 141 DT H73 H N N 142 DT H6 H N N 143 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal DA OP3 P sing N N 1 DA OP3 HOP3 sing N N 2 DA P OP1 doub N N 3 DA P OP2 sing N N 4 DA P "O5'" sing N N 5 DA OP2 HOP2 sing N N 6 DA "O5'" "C5'" sing N N 7 DA "C5'" "C4'" sing N N 8 DA "C5'" "H5'" sing N N 9 DA "C5'" "H5''" sing N N 10 DA "C4'" "O4'" sing N N 11 DA "C4'" "C3'" sing N N 12 DA "C4'" "H4'" sing N N 13 DA "O4'" "C1'" sing N N 14 DA "C3'" "O3'" sing N N 15 DA "C3'" "C2'" sing N N 16 DA "C3'" "H3'" sing N N 17 DA "O3'" "HO3'" sing N N 18 DA "C2'" "C1'" sing N N 19 DA "C2'" "H2'" sing N N 20 DA "C2'" "H2''" sing N N 21 DA "C1'" N9 sing N N 22 DA "C1'" "H1'" sing N N 23 DA N9 C8 sing Y N 24 DA N9 C4 sing Y N 25 DA C8 N7 doub Y N 26 DA C8 H8 sing N N 27 DA N7 C5 sing Y N 28 DA C5 C6 sing Y N 29 DA C5 C4 doub Y N 30 DA C6 N6 sing N N 31 DA C6 N1 doub Y N 32 DA N6 H61 sing N N 33 DA N6 H62 sing N N 34 DA N1 C2 sing Y N 35 DA C2 N3 doub Y N 36 DA C2 H2 sing N N 37 DA N3 C4 sing Y N 38 DC OP3 P sing N N 39 DC OP3 HOP3 sing N N 40 DC P OP1 doub N N 41 DC P OP2 sing N N 42 DC P "O5'" sing N N 43 DC OP2 HOP2 sing N N 44 DC "O5'" "C5'" sing N N 45 DC "C5'" "C4'" sing N N 46 DC "C5'" "H5'" sing N N 47 DC "C5'" "H5''" sing N N 48 DC "C4'" "O4'" sing N N 49 DC "C4'" "C3'" sing N N 50 DC "C4'" "H4'" sing N N 51 DC "O4'" "C1'" sing N N 52 DC "C3'" "O3'" sing N N 53 DC "C3'" "C2'" sing N N 54 DC "C3'" "H3'" sing N N 55 DC "O3'" "HO3'" sing N N 56 DC "C2'" "C1'" sing N N 57 DC "C2'" "H2'" sing N N 58 DC "C2'" "H2''" sing N N 59 DC "C1'" N1 sing N N 60 DC "C1'" "H1'" sing N N 61 DC N1 C2 sing N N 62 DC N1 C6 sing N N 63 DC C2 O2 doub N N 64 DC C2 N3 sing N N 65 DC N3 C4 doub N N 66 DC C4 N4 sing N N 67 DC C4 C5 sing N N 68 DC N4 H41 sing N N 69 DC N4 H42 sing N N 70 DC C5 C6 doub N N 71 DC C5 H5 sing N N 72 DC C6 H6 sing N N 73 DG OP3 P sing N N 74 DG OP3 HOP3 sing N N 75 DG P OP1 doub N N 76 DG P OP2 sing N N 77 DG P "O5'" sing N N 78 DG OP2 HOP2 sing N N 79 DG "O5'" "C5'" sing N N 80 DG "C5'" "C4'" sing N N 81 DG "C5'" "H5'" sing N N 82 DG "C5'" "H5''" sing N N 83 DG "C4'" "O4'" sing N N 84 DG "C4'" "C3'" sing N N 85 DG "C4'" "H4'" sing N N 86 DG "O4'" "C1'" sing N N 87 DG "C3'" "O3'" sing N N 88 DG "C3'" "C2'" sing N N 89 DG "C3'" "H3'" sing N N 90 DG "O3'" "HO3'" sing N N 91 DG "C2'" "C1'" sing N N 92 DG "C2'" "H2'" sing N N 93 DG "C2'" "H2''" sing N N 94 DG "C1'" N9 sing N N 95 DG "C1'" "H1'" sing N N 96 DG N9 C8 sing Y N 97 DG N9 C4 sing Y N 98 DG C8 N7 doub Y N 99 DG C8 H8 sing N N 100 DG N7 C5 sing Y N 101 DG C5 C6 sing N N 102 DG C5 C4 doub Y N 103 DG C6 O6 doub N N 104 DG C6 N1 sing N N 105 DG N1 C2 sing N N 106 DG N1 H1 sing N N 107 DG C2 N2 sing N N 108 DG C2 N3 doub N N 109 DG N2 H21 sing N N 110 DG N2 H22 sing N N 111 DG N3 C4 sing N N 112 DT OP3 P sing N N 113 DT OP3 HOP3 sing N N 114 DT P OP1 doub N N 115 DT P OP2 sing N N 116 DT P "O5'" sing N N 117 DT OP2 HOP2 sing N N 118 DT "O5'" "C5'" sing N N 119 DT "C5'" "C4'" sing N N 120 DT "C5'" "H5'" sing N N 121 DT "C5'" "H5''" sing N N 122 DT "C4'" "O4'" sing N N 123 DT "C4'" "C3'" sing N N 124 DT "C4'" "H4'" sing N N 125 DT "O4'" "C1'" sing N N 126 DT "C3'" "O3'" sing N N 127 DT "C3'" "C2'" sing N N 128 DT "C3'" "H3'" sing N N 129 DT "O3'" "HO3'" sing N N 130 DT "C2'" "C1'" sing N N 131 DT "C2'" "H2'" sing N N 132 DT "C2'" "H2''" sing N N 133 DT "C1'" N1 sing N N 134 DT "C1'" "H1'" sing N N 135 DT N1 C2 sing N N 136 DT N1 C6 sing N N 137 DT C2 O2 doub N N 138 DT C2 N3 sing N N 139 DT N3 C4 sing N N 140 DT N3 H3 sing N N 141 DT C4 O4 doub N N 142 DT C4 C5 sing N N 143 DT C5 C7 sing N N 144 DT C5 C6 doub N N 145 DT C7 H71 sing N N 146 DT C7 H72 sing N N 147 DT C7 H73 sing N N 148 DT C6 H6 sing N N 149 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7JPC 'double helix' 7JPC 'a-form double helix' 7JPC 'b-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 3 1_555 D DC 7 1_555 1.250 -0.138 1.604 12.667 -5.727 -17.068 1 A_DG3:DC16_D A 3 ? D 16 ? 19 1 1 A DC 4 1_555 D DG 6 1_555 -1.223 0.484 0.403 -7.297 -2.682 2.085 2 A_DC4:DG15_D A 4 ? D 15 ? 19 1 1 A DA 5 1_555 D DT 5 1_555 1.382 0.427 0.520 -2.016 -12.605 -19.065 3 A_DA5:DT14_D A 5 ? D 14 ? 20 1 1 A DG 6 1_555 D DC 4 1_555 0.656 0.151 0.454 2.526 -7.422 -23.587 4 A_DG6:DC13_D A 6 ? D 13 ? ? 1 1 A DA 7 1_555 D DT 3 1_555 1.036 0.257 0.230 7.767 -4.556 -25.866 5 A_DA7:DT12_D A 7 ? D 12 ? 20 1 1 A DC 8 1_555 D DG 2 1_555 -0.108 -0.224 0.060 9.101 -1.134 -6.988 6 A_DC8:DG11_D A 8 ? D 11 ? 19 1 1 A DC 9 1_555 D DG 1 1_555 -0.586 0.099 0.042 9.327 -5.808 -6.480 7 A_DC9:DG10_D A 9 ? D 10 ? 19 1 1 A DA 10 1_555 B DT 6 1_555 0.895 -0.088 0.853 12.723 -3.061 -7.778 8 A_DA10:DT5_B A 10 ? B 5 ? 20 1 1 A DG 11 1_555 B DC 5 1_555 1.068 0.245 0.931 12.791 -5.886 -2.547 9 A_DG11:DC4_B A 11 ? B 4 ? 19 1 1 A DA 12 1_555 B DT 4 1_555 1.101 -0.160 0.643 7.187 -4.115 -11.867 10 A_DA12:DT3_B A 12 ? B 3 ? 20 1 1 A DC 13 1_555 B DG 3 1_555 -0.163 -0.178 0.324 -2.019 0.916 -8.619 11 A_DC13:DG2_B A 13 ? B 2 ? 19 1 1 A DG 14 1_555 B DC 2 1_555 0.091 -0.219 0.632 9.290 -11.144 -7.693 12 A_DG14:DC1_B A 14 ? B 1 ? 19 1 1 A DG 15 1_555 B DC 1 1_555 0.065 -0.329 1.326 15.958 -3.286 -5.548 13 A_DG15:DC0_B A 15 ? B 0 ? 19 1 1 A DT 16 1_555 C DA 8 1_555 -0.933 -0.069 0.551 4.656 -1.176 -3.743 14 A_DT16:DA8_C A 16 ? C 8 ? 20 1 1 A DA 17 1_555 C DT 7 1_555 1.011 -0.076 0.967 10.402 -6.845 -14.120 15 A_DA17:DT7_C A 17 ? C 7 ? 20 1 1 A DC 18 1_555 C DG 6 1_555 0.516 -0.122 0.426 -6.257 -5.643 2.394 16 A_DC18:DG6_C A 18 ? C 6 ? 19 1 1 A DT 19 1_555 C DA 5 1_555 -0.606 -0.175 0.420 -7.868 0.351 -5.890 17 A_DT19:DA5_C A 19 ? C 5 ? 20 1 1 A DC 20 1_555 C DG 4 1_555 -0.060 0.015 -0.016 -3.478 -2.063 -2.013 18 A_DC20:DG4_C A 20 ? C 4 ? 19 1 1 A DA 21 1_555 C DT 3 1_555 0.724 -0.219 0.238 3.118 -10.512 -6.950 19 A_DA21:DT3_C A 21 ? C 3 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 3 1_555 D DC 7 1_555 A DC 4 1_555 D DG 6 1_555 1.460 -1.135 3.670 14.859 2.178 28.333 -2.541 0.638 3.848 4.106 -28.007 31.994 1 AA_DG3DC4:DG15DC16_DD A 3 ? D 16 ? A 4 ? D 15 ? 1 A DC 4 1_555 D DG 6 1_555 A DA 5 1_555 D DT 5 1_555 -0.975 0.012 3.266 0.202 -2.185 40.085 0.266 1.443 3.256 -3.184 -0.294 40.142 2 AA_DC4DA5:DT14DG15_DD A 4 ? D 15 ? A 5 ? D 14 ? 1 A DA 5 1_555 D DT 5 1_555 A DG 6 1_555 D DC 4 1_555 0.270 -1.116 3.147 0.559 0.631 28.736 -2.383 -0.424 3.127 1.271 -1.125 28.748 3 AA_DA5DG6:DC13DT14_DD A 5 ? D 14 ? A 6 ? D 13 ? 1 A DG 6 1_555 D DC 4 1_555 A DA 7 1_555 D DT 3 1_555 0.308 -1.557 3.131 5.760 5.604 38.093 -2.972 0.188 2.896 8.470 -8.708 38.901 4 AA_DG6DA7:DT12DC13_DD A 6 ? D 13 ? A 7 ? D 12 ? 1 A DA 7 1_555 D DT 3 1_555 A DC 8 1_555 D DG 2 1_555 1.152 -1.537 3.319 -1.527 7.421 27.985 -4.623 -2.622 2.763 15.001 3.087 28.973 5 AA_DA7DC8:DG11DT12_DD A 7 ? D 12 ? A 8 ? D 11 ? 1 A DC 8 1_555 D DG 2 1_555 A DC 9 1_555 D DG 1 1_555 -0.677 -1.715 3.126 -2.807 -3.680 31.653 -2.452 0.724 3.345 -6.702 5.111 31.981 6 AA_DC8DC9:DG10DG11_DD A 8 ? D 11 ? A 9 ? D 10 ? 1 A DC 9 1_555 D DG 1 1_555 A DA 10 1_555 B DT 6 1_555 -0.913 -1.369 3.211 -2.570 0.151 31.162 -2.569 1.211 3.267 0.281 4.773 31.266 7 AA_DC9DA10:DT5DG10_BD A 9 ? D 10 ? A 10 ? B 5 ? 1 A DA 10 1_555 B DT 6 1_555 A DG 11 1_555 B DC 5 1_555 -0.548 -0.032 3.511 -2.038 4.784 36.705 -0.742 0.568 3.503 7.550 3.217 37.059 8 AA_DA10DG11:DC4DT5_BB A 10 ? B 5 ? A 11 ? B 4 ? 1 A DG 11 1_555 B DC 5 1_555 A DA 12 1_555 B DT 4 1_555 -0.468 -0.858 3.316 -0.102 2.356 31.644 -2.004 0.837 3.247 4.314 0.187 31.729 9 AA_DG11DA12:DT3DC4_BB A 11 ? B 4 ? A 12 ? B 3 ? 1 A DA 12 1_555 B DT 4 1_555 A DC 13 1_555 B DG 3 1_555 0.096 -1.851 3.413 1.377 4.284 27.940 -4.782 0.123 3.101 8.800 -2.828 28.293 10 AA_DA12DC13:DG2DT3_BB A 12 ? B 3 ? A 13 ? B 2 ? 1 A DC 13 1_555 B DG 3 1_555 A DG 14 1_555 B DC 2 1_555 -0.208 -0.650 3.104 -1.959 1.409 30.543 -1.493 0.029 3.079 2.669 3.711 30.636 11 AA_DC13DG14:DC1DG2_BB A 13 ? B 2 ? A 14 ? B 1 ? 1 A DG 14 1_555 B DC 2 1_555 A DG 15 1_555 B DC 1 1_555 0.676 -1.039 2.799 -9.474 -6.231 39.330 -0.900 -1.861 2.699 -9.033 13.733 40.870 12 AA_DG14DG15:DC0DC1_BB A 14 ? B 1 ? A 15 ? B 0 ? 1 A DG 15 1_555 B DC 1 1_555 A DT 16 1_555 C DA 8 1_555 -1.123 -1.806 3.389 6.889 3.925 23.587 -5.310 4.567 2.629 9.273 -16.274 24.866 13 AA_DG15DT16:DA8DC0_CB A 15 ? B 0 ? A 16 ? C 8 ? 1 A DT 16 1_555 C DA 8 1_555 A DA 17 1_555 C DT 7 1_555 -0.657 0.871 3.386 -5.234 -6.636 47.973 1.581 0.385 3.295 -8.089 6.380 48.668 14 AA_DT16DA17:DT7DA8_CC A 16 ? C 8 ? A 17 ? C 7 ? 1 A DA 17 1_555 C DT 7 1_555 A DC 18 1_555 C DG 6 1_555 0.602 -1.246 3.602 -0.198 1.552 31.554 -2.602 -1.145 3.535 2.851 0.363 31.592 15 AA_DA17DC18:DG6DT7_CC A 17 ? C 7 ? A 18 ? C 6 ? 1 A DC 18 1_555 C DG 6 1_555 A DT 19 1_555 C DA 5 1_555 -1.032 -1.125 3.359 1.503 -5.322 32.389 -1.034 2.095 3.445 -9.454 -2.669 32.845 16 AA_DC18DT19:DA5DG6_CC A 18 ? C 6 ? A 19 ? C 5 ? 1 A DT 19 1_555 C DA 5 1_555 A DC 20 1_555 C DG 4 1_555 0.858 0.688 3.209 4.364 2.153 37.673 0.783 -0.760 3.317 3.316 -6.724 37.975 17 AA_DT19DC20:DG4DA5_CC A 19 ? C 5 ? A 20 ? C 4 ? 1 A DC 20 1_555 C DG 4 1_555 A DA 21 1_555 C DT 3 1_555 -0.469 1.951 3.318 -2.345 -5.759 43.755 3.123 0.408 3.070 -7.681 3.127 44.173 18 AA_DC20DA21:DT3DG4_CC A 20 ? C 4 ? A 21 ? C 3 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Science Foundation (NSF, United States)' 'United States' 1360635 1 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R01GM104960 2 'National Science Foundation (NSF, United States)' 'United States' NSF2004250 3 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 5VY6 _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? #