data_7SDQ # _entry.id 7SDQ # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7SDQ pdb_00007sdq 10.2210/pdb7sdq/pdb WWPDB D_1000259425 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2022-10-05 2 'Structure model' 1 1 2023-04-19 3 'Structure model' 1 2 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' chem_comp_atom 4 3 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_abbrev' 2 2 'Structure model' '_citation.journal_id_CSD' 3 2 'Structure model' '_citation.journal_id_ISSN' 4 2 'Structure model' '_citation.page_first' 5 2 'Structure model' '_citation.page_last' 6 2 'Structure model' '_citation.pdbx_database_id_DOI' 7 2 'Structure model' '_citation.pdbx_database_id_PubMed' 8 2 'Structure model' '_citation.title' 9 2 'Structure model' '_citation.year' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7SDQ _pdbx_database_status.recvd_initial_deposition_date 2021-09-29 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name PDB _pdbx_database_related.details 'Contains a different base pair in the same motif.' _pdbx_database_related.db_id 7SD6 _pdbx_database_related.content_type unspecified # _pdbx_contact_author.id 3 _pdbx_contact_author.email ncs01@nyu.edu _pdbx_contact_author.name_first Nadrian _pdbx_contact_author.name_last Seeman _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-9680-4649 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Lu, B.' 1 0000-0001-6424-2197 'Vecchioni, S.' 2 0000-0001-8243-650X 'Seeman, N.C.' 3 0000-0002-9680-4649 'Sha, R.' 4 0000-0002-0807-734X 'Ohayon, Y.P.' 5 0000-0001-7500-4282 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Adv Mater' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 1521-4095 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first e2201938 _citation.page_last e2201938 _citation.title 'Metal-Mediated DNA Nanotechnology in 3D: Structural Library by Templated Diffraction.' _citation.year 2023 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1002/adma.202201938 _citation.pdbx_database_id_PubMed 36939292 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Vecchioni, S.' 1 ? primary 'Lu, B.' 2 ? primary 'Livernois, W.' 3 ? primary 'Ohayon, Y.P.' 4 ? primary 'Yoder, J.B.' 5 ? primary 'Yang, C.F.' 6 ? primary 'Woloszyn, K.' 7 ? primary 'Bernfeld, W.' 8 ? primary 'Anantram, M.P.' 9 ? primary 'Canary, J.W.' 10 ? primary 'Hendrickson, W.A.' 11 ? primary 'Rothschild, L.J.' 12 ? primary 'Mao, C.' 13 ? primary 'Wind, S.J.' 14 ? primary 'Seeman, N.C.' 15 ? primary 'Sha, R.' 16 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*GP*AP*GP*CP*AP*GP*CP*CP*TP*GP*TP*(5CM)P*TP*GP*GP*AP*CP*AP*TP*CP*A)-3') ; 6462.201 1 ? ? ? ? 2 polymer syn ;DNA (5'-D(P*CP*CP*AP*UP*AP*CP*A)-3') ; 2052.375 1 ? ? ? ? 3 polymer syn ;DNA (5'-D(P*GP*GP*CP*TP*GP*CP*T)-3') ; 2129.409 1 ? ? ? ? 4 polymer syn ;DNA (5'-D(P*CP*TP*GP*AP*TP*GP*T)-3') ; 2128.421 1 ? ? ? ? 5 non-polymer syn 'SILVER ION' 107.868 2 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no yes ;(DG)(DA)(DG)(DC)(DA)(DG)(DC)(DC)(DT)(DG)(DT)(5CM)(DT)(DG)(DG)(DA)(DC)(DA)(DT) (DC)(DA) ; GAGCAGCCTGTCTGGACATCA A ? 2 polydeoxyribonucleotide no no '(DC)(DC)(DA)(DU)(DA)(DC)(DA)' CCAUACA B ? 3 polydeoxyribonucleotide no no '(DG)(DG)(DC)(DT)(DG)(DC)(DT)' GGCTGCT C ? 4 polydeoxyribonucleotide no no '(DC)(DT)(DG)(DA)(DT)(DG)(DT)' CTGATGT D ? # _pdbx_entity_nonpoly.entity_id 5 _pdbx_entity_nonpoly.name 'SILVER ION' _pdbx_entity_nonpoly.comp_id AG # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DA n 1 3 DG n 1 4 DC n 1 5 DA n 1 6 DG n 1 7 DC n 1 8 DC n 1 9 DT n 1 10 DG n 1 11 DT n 1 12 5CM n 1 13 DT n 1 14 DG n 1 15 DG n 1 16 DA n 1 17 DC n 1 18 DA n 1 19 DT n 1 20 DC n 1 21 DA n 2 1 DC n 2 2 DC n 2 3 DA n 2 4 DU n 2 5 DA n 2 6 DC n 2 7 DA n 3 1 DG n 3 2 DG n 3 3 DC n 3 4 DT n 3 5 DG n 3 6 DC n 3 7 DT n 4 1 DC n 4 2 DT n 4 3 DG n 4 4 DA n 4 5 DT n 4 6 DG n 4 7 DT n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 21 'synthetic construct' ? 32630 ? 2 1 sample 1 7 'synthetic construct' ? 32630 ? 3 1 sample 1 7 'synthetic construct' ? 32630 ? 4 1 sample 1 7 'synthetic construct' ? 32630 ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 5CM 'DNA linking' n "5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE" ? 'C10 H16 N3 O7 P' 321.224 AG non-polymer . 'SILVER ION' ? 'Ag 1' 107.868 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 DU 'DNA linking' y "2'-DEOXYURIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O8 P' 308.182 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DA 2 2 2 DA DA A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DC 4 4 4 DC DC A . n A 1 5 DA 5 5 5 DA DA A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DC 7 7 7 DC DC A . n A 1 8 DC 8 8 8 DC DC A . n A 1 9 DT 9 9 9 DT DT A . n A 1 10 DG 10 10 10 DG DG A . n A 1 11 DT 11 11 11 DT DT A . n A 1 12 5CM 12 12 12 5CM 5CM A . n A 1 13 DT 13 13 13 DT DT A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DA 16 16 16 DA DA A . n A 1 17 DC 17 17 17 DC DC A . n A 1 18 DA 18 18 18 DA DA A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DC 20 20 20 DC DC A . n A 1 21 DA 21 21 21 DA DA A . n B 2 1 DC 1 1 1 DC DC B . n B 2 2 DC 2 2 2 DC DC B . n B 2 3 DA 3 3 3 DA DA B . n B 2 4 DU 4 4 4 DU dU B . n B 2 5 DA 5 5 5 DA DA B . n B 2 6 DC 6 6 6 DC DC B . n B 2 7 DA 7 7 7 DA DA B . n C 3 1 DG 1 8 8 DG DG C . n C 3 2 DG 2 9 9 DG DG C . n C 3 3 DC 3 10 10 DC DC C . n C 3 4 DT 4 11 11 DT DT C . n C 3 5 DG 5 12 12 DG DG C . n C 3 6 DC 6 13 13 DC DC C . n C 3 7 DT 7 14 14 DT DT C . n D 4 1 DC 1 1 1 DC DC D . n D 4 2 DT 2 2 2 DT DT D . n D 4 3 DG 3 3 3 DG DG D . n D 4 4 DA 4 4 4 DA DA D . n D 4 5 DT 5 5 5 DT DT D . n D 4 6 DG 6 6 6 DG DG D . n D 4 7 DT 7 7 7 DT DT D . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code E 5 AG 1 101 4 AG AG B . F 5 AG 1 102 5 AG AG B . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.19.2_4158 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? autoPROC ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? STARANISO ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? AutoSol ? ? ? . 4 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 7SDQ _cell.details ? _cell.formula_units_Z ? _cell.length_a 105.465 _cell.length_a_esd ? _cell.length_b 105.465 _cell.length_b_esd ? _cell.length_c 93.608 _cell.length_c_esd ? _cell.volume 901696.351 _cell.volume_esd ? _cell.Z_PDB 9 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? # _symmetry.entry_id 7SDQ _symmetry.cell_setting ? _symmetry.Int_Tables_number 146 _symmetry.space_group_name_Hall 'R 3' _symmetry.space_group_name_H-M 'H 3' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7SDQ _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 8.41 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description Rhombohedral _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 7.8 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details '338-293 at 0.4/hr' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'MOPS, Magnesium sulfate, Silver nitrate' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER2 X 9M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2020-11-14 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.65313 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 17-ID' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.65313 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 17-ID _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate 233.59 _reflns.entry_id 7SDQ _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 4.3 _reflns.d_resolution_low 65.373 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 1899 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 87.9 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 9.9 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 5.2 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.9986 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_all _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 4.3 4.773 ? 0.7 ? ? ? ? 211 61.2 ? ? ? ? 8.005 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 1 1 ? ? ? ? ? ? ? ? ? ? ? 10.037 65.373 ? ? ? ? ? ? 209 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 2 1 0.984 ? ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 286.21 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 7SDQ _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 4.30 _refine.ls_d_res_low 41.65 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 1875 _refine.ls_number_reflns_R_free 109 _refine.ls_number_reflns_R_work 1766 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 71.05 _refine.ls_percent_reflns_R_free 5.81 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2002 _refine.ls_R_factor_R_free 0.2094 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1997 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.97 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct SAD _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 31.2042 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.0000 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 4.30 _refine_hist.d_res_low 41.65 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 859 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 857 _refine_hist.pdbx_number_atoms_ligand 2 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0086 ? 957 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.2169 ? 1469 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0573 ? 162 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0055 ? 42 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 38.2287 ? 417 ? f_dihedral_angle_d ? ? # _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.d_res_high 4.30 _refine_ls_shell.d_res_low 41.65 _refine_ls_shell.number_reflns_all ? _refine_ls_shell.number_reflns_obs ? _refine_ls_shell.number_reflns_R_free 109 _refine_ls_shell.number_reflns_R_work 1766 _refine_ls_shell.percent_reflns_obs 71.05 _refine_ls_shell.percent_reflns_R_free ? _refine_ls_shell.R_factor_all ? _refine_ls_shell.R_factor_obs ? _refine_ls_shell.R_factor_R_free 0.2094 _refine_ls_shell.R_factor_R_free_error ? _refine_ls_shell.R_factor_R_work 0.1997 _refine_ls_shell.redundancy_reflns_all ? _refine_ls_shell.redundancy_reflns_obs ? _refine_ls_shell.wR_factor_all ? _refine_ls_shell.wR_factor_obs ? _refine_ls_shell.wR_factor_R_free ? _refine_ls_shell.wR_factor_R_work ? _refine_ls_shell.pdbx_R_complete ? _refine_ls_shell.pdbx_total_number_of_bins_used ? _refine_ls_shell.pdbx_phase_error ? _refine_ls_shell.pdbx_fsc_work ? _refine_ls_shell.pdbx_fsc_free ? # _struct.entry_id 7SDQ _struct.title '[mC:Ag+:U] Metal-mediated DNA base pair in a self-assembling rhombohedral lattice' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7SDQ _struct_keywords.text 'Tensegrity triangle, self-assembling crystal, metal-mediated mismatch, DNA' _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 5 ? F N N 5 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 7SDQ 7SDQ ? 1 ? 1 2 PDB 7SDQ 7SDQ ? 2 ? 1 3 PDB 7SDQ 7SDQ ? 3 ? 1 4 PDB 7SDQ 7SDQ ? 4 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 7SDQ A 1 ? 21 ? 7SDQ 1 ? 21 ? 1 21 2 2 7SDQ B 1 ? 7 ? 7SDQ 1 ? 7 ? 1 7 3 3 7SDQ C 1 ? 7 ? 7SDQ 8 ? 14 ? 8 14 4 4 7SDQ D 1 ? 7 ? 7SDQ 1 ? 7 ? 1 7 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dodecameric _pdbx_struct_assembly.oligomeric_count 12 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1,2,3 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details ? # loop_ _pdbx_struct_oper_list.id _pdbx_struct_oper_list.type _pdbx_struct_oper_list.name _pdbx_struct_oper_list.symmetry_operation _pdbx_struct_oper_list.matrix[1][1] _pdbx_struct_oper_list.matrix[1][2] _pdbx_struct_oper_list.matrix[1][3] _pdbx_struct_oper_list.vector[1] _pdbx_struct_oper_list.matrix[2][1] _pdbx_struct_oper_list.matrix[2][2] _pdbx_struct_oper_list.matrix[2][3] _pdbx_struct_oper_list.vector[2] _pdbx_struct_oper_list.matrix[3][1] _pdbx_struct_oper_list.matrix[3][2] _pdbx_struct_oper_list.matrix[3][3] _pdbx_struct_oper_list.vector[3] 1 'identity operation' 1_555 x,y,z 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 2 'crystal symmetry operation' 2_555 -y,x-y,z -0.5000000000 -0.8660254038 0.0000000000 0.0000000000 0.8660254038 -0.5000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 3 'crystal symmetry operation' 3_555 -x+y,-x,z -0.5000000000 0.8660254038 0.0000000000 0.0000000000 -0.8660254038 -0.5000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A DT 11 "O3'" ? ? ? 1_555 A 5CM 12 P ? ? A DT 11 A 5CM 12 1_555 ? ? ? ? ? ? ? 1.613 ? ? covale2 covale both ? A 5CM 12 "O3'" ? ? ? 1_555 A DT 13 P ? ? A 5CM 12 A DT 13 1_555 ? ? ? ? ? ? ? 1.614 ? ? metalc1 metalc ? ? A 5CM 12 N3 ? ? ? 1_555 E AG . AG ? ? A 5CM 12 B AG 101 1_555 ? ? ? ? ? ? ? 2.123 ? ? metalc2 metalc ? ? A 5CM 12 N4 ? ? ? 1_555 E AG . AG ? ? A 5CM 12 B AG 101 1_555 ? ? ? ? ? ? ? 2.570 ? ? metalc3 metalc ? ? A 5CM 12 N4 ? ? ? 1_555 F AG . AG ? ? A 5CM 12 B AG 102 1_555 ? ? ? ? ? ? ? 2.154 ? ? metalc4 metalc ? ? B DA 3 N6 ? ? ? 1_555 F AG . AG ? ? B DA 3 B AG 102 1_555 ? ? ? ? ? ? ? 2.687 ? ? metalc5 metalc ? ? B DU 4 O2 ? ? ? 1_555 E AG . AG ? ? B DU 4 B AG 101 1_555 ? ? ? ? ? ? ? 2.583 ? ? metalc6 metalc ? ? B DU 4 N3 ? ? ? 1_555 E AG . AG ? ? B DU 4 B AG 101 1_555 ? ? ? ? ? ? ? 2.115 ? ? metalc7 metalc ? ? B DU 4 O4 ? ? ? 1_555 F AG . AG ? ? B DU 4 B AG 102 1_555 ? ? ? ? ? ? ? 2.091 ? ? hydrog1 hydrog ? ? A DA 2 N1 ? ? ? 1_555 C DT 7 N3 ? ? A DA 2 C DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DA 2 N6 ? ? ? 1_555 C DT 7 O4 ? ? A DA 2 C DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DG 3 N1 ? ? ? 1_555 C DC 6 N3 ? ? A DG 3 C DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DG 3 N2 ? ? ? 1_555 C DC 6 O2 ? ? A DG 3 C DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DG 3 O6 ? ? ? 1_555 C DC 6 N4 ? ? A DG 3 C DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DC 4 N3 ? ? ? 1_555 C DG 5 N1 ? ? A DC 4 C DG 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DC 4 N4 ? ? ? 1_555 C DG 5 O6 ? ? A DC 4 C DG 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DC 4 O2 ? ? ? 1_555 C DG 5 N2 ? ? A DC 4 C DG 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DA 5 N1 ? ? ? 1_555 C DT 4 N3 ? ? A DA 5 C DT 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DA 5 N6 ? ? ? 1_555 C DT 4 O4 ? ? A DA 5 C DT 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DG 6 N1 ? ? ? 1_555 C DC 3 N3 ? ? A DG 6 C DC 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DG 6 N2 ? ? ? 1_555 C DC 3 O2 ? ? A DG 6 C DC 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DG 6 O6 ? ? ? 1_555 C DC 3 N4 ? ? A DG 6 C DC 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DC 7 N3 ? ? ? 1_555 C DG 2 N1 ? ? A DC 7 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DC 7 N4 ? ? ? 1_555 C DG 2 O6 ? ? A DC 7 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 7 O2 ? ? ? 1_555 C DG 2 N2 ? ? A DC 7 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DC 8 N3 ? ? ? 1_555 C DG 1 N1 ? ? A DC 8 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DC 8 N4 ? ? ? 1_555 C DG 1 O6 ? ? A DC 8 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DC 8 O2 ? ? ? 1_555 C DG 1 N2 ? ? A DC 8 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DT 9 N3 ? ? ? 1_555 B DA 7 N1 ? ? A DT 9 B DA 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DT 9 O4 ? ? ? 1_555 B DA 7 N6 ? ? A DT 9 B DA 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DG 10 N1 ? ? ? 1_555 B DC 6 N3 ? ? A DG 10 B DC 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DG 10 N2 ? ? ? 1_555 B DC 6 O2 ? ? A DG 10 B DC 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DG 10 O6 ? ? ? 1_555 B DC 6 N4 ? ? A DG 10 B DC 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A 5CM 12 N4 ? ? ? 1_555 B DU 4 O4 ? ? A 5CM 12 B DU 4 1_555 ? ? ? ? ? ? '5CM-DU MISPAIR' ? ? ? hydrog26 hydrog ? ? A DT 13 N3 ? ? ? 1_555 B DA 3 N1 ? ? A DT 13 B DA 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DT 13 O4 ? ? ? 1_555 B DA 3 N6 ? ? A DT 13 B DA 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DG 14 N1 ? ? ? 1_555 B DC 2 N3 ? ? A DG 14 B DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DG 14 N2 ? ? ? 1_555 B DC 2 O2 ? ? A DG 14 B DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A DG 14 O6 ? ? ? 1_555 B DC 2 N4 ? ? A DG 14 B DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A DG 15 N1 ? ? ? 1_555 B DC 1 N3 ? ? A DG 15 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A DG 15 N2 ? ? ? 1_555 B DC 1 O2 ? ? A DG 15 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DG 15 O6 ? ? ? 1_555 B DC 1 N4 ? ? A DG 15 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DA 16 N1 ? ? ? 1_555 D DT 7 N3 ? ? A DA 16 D DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DA 16 N6 ? ? ? 1_555 D DT 7 O4 ? ? A DA 16 D DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DC 17 N3 ? ? ? 1_555 D DG 6 N1 ? ? A DC 17 D DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DC 17 N4 ? ? ? 1_555 D DG 6 O6 ? ? A DC 17 D DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DC 17 O2 ? ? ? 1_555 D DG 6 N2 ? ? A DC 17 D DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DA 18 N1 ? ? ? 1_555 D DT 5 N3 ? ? A DA 18 D DT 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DA 18 N6 ? ? ? 1_555 D DT 5 O4 ? ? A DA 18 D DT 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DT 19 N3 ? ? ? 1_555 D DA 4 N1 ? ? A DT 19 D DA 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DT 19 O4 ? ? ? 1_555 D DA 4 N6 ? ? A DT 19 D DA 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DC 20 N3 ? ? ? 1_555 D DG 3 N1 ? ? A DC 20 D DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DC 20 N4 ? ? ? 1_555 D DG 3 O6 ? ? A DC 20 D DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A DC 20 O2 ? ? ? 1_555 D DG 3 N2 ? ? A DC 20 D DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A DA 21 N1 ? ? ? 1_555 D DT 2 N3 ? ? A DA 21 D DT 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A DA 21 N6 ? ? ? 1_555 D DT 2 O4 ? ? A DA 21 D DT 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 N3 ? A 5CM 12 ? A 5CM 12 ? 1_555 AG ? E AG . ? B AG 101 ? 1_555 N4 ? A 5CM 12 ? A 5CM 12 ? 1_555 61.3 ? 2 N3 ? A 5CM 12 ? A 5CM 12 ? 1_555 AG ? E AG . ? B AG 101 ? 1_555 O2 ? B DU 4 ? B DU 4 ? 1_555 149.5 ? 3 N4 ? A 5CM 12 ? A 5CM 12 ? 1_555 AG ? E AG . ? B AG 101 ? 1_555 O2 ? B DU 4 ? B DU 4 ? 1_555 149.2 ? 4 N3 ? A 5CM 12 ? A 5CM 12 ? 1_555 AG ? E AG . ? B AG 101 ? 1_555 N3 ? B DU 4 ? B DU 4 ? 1_555 152.8 ? 5 N4 ? A 5CM 12 ? A 5CM 12 ? 1_555 AG ? E AG . ? B AG 101 ? 1_555 N3 ? B DU 4 ? B DU 4 ? 1_555 91.9 ? 6 O2 ? B DU 4 ? B DU 4 ? 1_555 AG ? E AG . ? B AG 101 ? 1_555 N3 ? B DU 4 ? B DU 4 ? 1_555 57.5 ? 7 N4 ? A 5CM 12 ? A 5CM 12 ? 1_555 AG ? F AG . ? B AG 102 ? 1_555 N6 ? B DA 3 ? B DA 3 ? 1_555 84.7 ? 8 N4 ? A 5CM 12 ? A 5CM 12 ? 1_555 AG ? F AG . ? B AG 102 ? 1_555 O4 ? B DU 4 ? B DU 4 ? 1_555 105.3 ? 9 N6 ? B DA 3 ? B DA 3 ? 1_555 AG ? F AG . ? B AG 102 ? 1_555 O4 ? B DU 4 ? B DU 4 ? 1_555 91.5 ? # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 P B DU 4 ? ? "O5'" B DU 4 ? ? 1.655 1.593 0.062 0.010 N 2 1 "C5'" B DU 4 ? ? "C4'" B DU 4 ? ? 1.427 1.509 -0.082 0.011 N 3 1 "C4'" B DU 4 ? ? "C3'" B DU 4 ? ? 1.600 1.529 0.071 0.010 N 4 1 "C3'" B DU 4 ? ? "C2'" B DU 4 ? ? 1.231 1.516 -0.285 0.008 N 5 1 "C2'" B DU 4 ? ? "C1'" B DU 4 ? ? 1.635 1.519 0.116 0.010 N 6 1 "O4'" B DU 4 ? ? "C1'" B DU 4 ? ? 1.310 1.418 -0.108 0.012 N 7 1 "O3'" B DU 4 ? ? "C3'" B DU 4 ? ? 1.532 1.435 0.097 0.013 N 8 1 C4 B DU 4 ? ? O4 B DU 4 ? ? 1.182 1.232 -0.050 0.008 N 9 1 N1 B DU 4 ? ? C2 B DU 4 ? ? 1.492 1.381 0.111 0.009 N 10 1 N1 B DU 4 ? ? C6 B DU 4 ? ? 1.439 1.375 0.064 0.009 N 11 1 C2 B DU 4 ? ? N3 B DU 4 ? ? 1.483 1.373 0.110 0.007 N 12 1 N3 B DU 4 ? ? C4 B DU 4 ? ? 1.466 1.380 0.086 0.009 N 13 1 C4 B DU 4 ? ? C5 B DU 4 ? ? 1.490 1.431 0.059 0.009 N 14 1 C5 B DU 4 ? ? C6 B DU 4 ? ? 1.479 1.337 0.142 0.009 N 15 1 P D DC 1 ? ? OP3 D DC 1 ? ? 1.479 1.607 -0.128 0.012 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A DA 2 ? ? "C1'" A DA 2 ? ? N9 A DA 2 ? ? 111.93 108.30 3.63 0.30 N 2 1 "O4'" A DC 7 ? ? "C1'" A DC 7 ? ? N1 A DC 7 ? ? 110.92 108.30 2.62 0.30 N 3 1 "O4'" A DT 11 ? ? "C1'" A DT 11 ? ? N1 A DT 11 ? ? 112.41 108.30 4.11 0.30 N 4 1 OP1 B DU 4 ? ? P B DU 4 ? ? OP2 B DU 4 ? ? 108.89 119.60 -10.71 1.50 N 5 1 "C1'" B DU 4 ? ? "O4'" B DU 4 ? ? "C4'" B DU 4 ? ? 104.00 110.10 -6.10 1.00 N 6 1 "O4'" B DU 4 ? ? "C1'" B DU 4 ? ? N1 B DU 4 ? ? 110.78 108.30 2.48 0.30 N 7 1 N1 B DU 4 ? ? C2 B DU 4 ? ? N3 B DU 4 ? ? 121.00 114.90 6.10 0.60 N 8 1 C2 B DU 4 ? ? N3 B DU 4 ? ? C4 B DU 4 ? ? 117.27 127.00 -9.73 0.60 N 9 1 N3 B DU 4 ? ? C4 B DU 4 ? ? C5 B DU 4 ? ? 121.56 114.60 6.96 0.60 N 10 1 C5 B DU 4 ? ? C6 B DU 4 ? ? N1 B DU 4 ? ? 118.91 122.70 -3.79 0.50 N 11 1 C5 B DU 4 ? ? C4 B DU 4 ? ? O4 B DU 4 ? ? 116.13 125.90 -9.77 0.60 N 12 1 "O4'" B DC 6 ? ? "C1'" B DC 6 ? ? N1 B DC 6 ? ? 110.38 108.30 2.08 0.30 N 13 1 "O4'" B DA 7 ? ? "C1'" B DA 7 ? ? N9 B DA 7 ? ? 110.68 108.30 2.38 0.30 N 14 1 "O4'" D DC 1 ? ? "C1'" D DC 1 ? ? N1 D DC 1 ? ? 110.97 108.30 2.67 0.30 N 15 1 "C3'" D DG 3 ? ? "C2'" D DG 3 ? ? "C1'" D DG 3 ? ? 97.52 102.40 -4.88 0.80 N 16 1 "O4'" D DG 3 ? ? "C1'" D DG 3 ? ? N9 D DG 3 ? ? 111.11 108.30 2.81 0.30 N # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 -y,x-y,z 3 -x+y,-x,z 4 x+1/3,y+2/3,z+2/3 5 -y+1/3,x-y+2/3,z+2/3 6 -x+y+1/3,-x+2/3,z+2/3 7 x+2/3,y+1/3,z+1/3 8 -y+2/3,x-y+1/3,z+1/3 9 -x+y+2/3,-x+1/3,z+1/3 # loop_ _pdbx_refine_tls.id _pdbx_refine_tls.pdbx_refine_id _pdbx_refine_tls.details _pdbx_refine_tls.method _pdbx_refine_tls.origin_x _pdbx_refine_tls.origin_y _pdbx_refine_tls.origin_z _pdbx_refine_tls.T[1][1] _pdbx_refine_tls.T[1][1]_esd _pdbx_refine_tls.T[1][2] _pdbx_refine_tls.T[1][2]_esd _pdbx_refine_tls.T[1][3] _pdbx_refine_tls.T[1][3]_esd _pdbx_refine_tls.T[2][2] _pdbx_refine_tls.T[2][2]_esd _pdbx_refine_tls.T[2][3] _pdbx_refine_tls.T[2][3]_esd _pdbx_refine_tls.T[3][3] _pdbx_refine_tls.T[3][3]_esd _pdbx_refine_tls.L[1][1] _pdbx_refine_tls.L[1][1]_esd _pdbx_refine_tls.L[1][2] _pdbx_refine_tls.L[1][2]_esd _pdbx_refine_tls.L[1][3] _pdbx_refine_tls.L[1][3]_esd _pdbx_refine_tls.L[2][2] _pdbx_refine_tls.L[2][2]_esd _pdbx_refine_tls.L[2][3] _pdbx_refine_tls.L[2][3]_esd _pdbx_refine_tls.L[3][3] _pdbx_refine_tls.L[3][3]_esd _pdbx_refine_tls.S[1][1] _pdbx_refine_tls.S[1][1]_esd _pdbx_refine_tls.S[1][2] _pdbx_refine_tls.S[1][2]_esd _pdbx_refine_tls.S[1][3] _pdbx_refine_tls.S[1][3]_esd _pdbx_refine_tls.S[2][1] _pdbx_refine_tls.S[2][1]_esd _pdbx_refine_tls.S[2][2] _pdbx_refine_tls.S[2][2]_esd _pdbx_refine_tls.S[2][3] _pdbx_refine_tls.S[2][3]_esd _pdbx_refine_tls.S[3][1] _pdbx_refine_tls.S[3][1]_esd _pdbx_refine_tls.S[3][2] _pdbx_refine_tls.S[3][2]_esd _pdbx_refine_tls.S[3][3] _pdbx_refine_tls.S[3][3]_esd 1 'X-RAY DIFFRACTION' ? refined -14.9079003301 -3.53768995777 23.5129176007 3.40143658423 ? 0.461913036891 ? 0.357607777507 ? 1.86462332822 ? 0.453386279692 ? 3.00915480597 ? 9.88548074076 ? -2.05994386045 ? 2.97418041471 ? 6.19526273955 ? -7.16297063046 ? 1.82799302239 ? -0.0802502565932 ? -0.942199295851 ? -1.52562839957 ? 1.7342690788 ? 3.75433001626 ? 7.01080492793 ? -0.257120714847 ? -1.32202476091 ? -2.61423139012 ? 2 'X-RAY DIFFRACTION' ? refined -14.1493355499 -0.452996633505 22.2794757559 2.44588180327 ? -0.460239397602 ? -0.53422807789 ? 3.11762513921 ? 0.663417250421 ? 2.9380172202 ? 6.54670022636 ? 0.433362566174 ? -4.82763778418 ? 3.04434868222 ? 2.46284031708 ? 6.80216807582 ? 0.788839629151 ? 3.35766556674 ? 1.94609605576 ? 0.686828928185 ? 0.621855154219 ? 2.37967172433 ? 2.83399181357 ? -3.08248772112 ? -1.10049766263 ? 3 'X-RAY DIFFRACTION' ? refined -17.1729730509 -20.6308667785 35.3004707307 2.44340974218 ? 0.219448174619 ? 0.342418995484 ? 2.82834995503 ? 0.4887504482 ? 5.80604822263 ? 9.11908519452 ? 3.31071755226 ? -5.58158293959 ? 1.80394527562 ? -2.39861237746 ? 4.63042105707 ? 0.900199783163 ? -2.32604936854 ? 1.24865110007 ? -0.608759766118 ? 4.26339693255 ? 7.49532971703 ? -0.409608123765 ? -2.92642740645 ? -4.3320595393 ? 4 'X-RAY DIFFRACTION' ? refined -12.3808802762 19.032940522 8.36573273036 3.69357205855 ? -0.0984034340383 ? 0.648047413529 ? 1.55203366026 ? 0.765525976145 ? 2.78460296113 ? 8.0927812666 ? -1.65722881247 ? -0.768404418911 ? 3.19647970373 ? 1.27832811346 ? 3.81732569331 ? -1.62975040435 ? 4.13261920229 ? -3.50992402963 ? -4.41608896963 ? 2.39364179889 ? -0.0629069240331 ? 0.954625577424 ? -1.7327194151 ? -0.200627368895 ? # loop_ _pdbx_refine_tls_group.id _pdbx_refine_tls_group.pdbx_refine_id _pdbx_refine_tls_group.refine_tls_id _pdbx_refine_tls_group.beg_label_asym_id _pdbx_refine_tls_group.beg_label_seq_id _pdbx_refine_tls_group.beg_auth_asym_id _pdbx_refine_tls_group.beg_auth_seq_id _pdbx_refine_tls_group.beg_PDB_ins_code _pdbx_refine_tls_group.end_label_asym_id _pdbx_refine_tls_group.end_label_seq_id _pdbx_refine_tls_group.end_auth_asym_id _pdbx_refine_tls_group.end_auth_seq_id _pdbx_refine_tls_group.end_PDB_ins_code _pdbx_refine_tls_group.selection _pdbx_refine_tls_group.selection_details 1 'X-RAY DIFFRACTION' 1 A ? A 1 ? A ? A 21 ? ? ;(chain 'A' and resid 1 through 21) ; 2 'X-RAY DIFFRACTION' 2 B ? B 1 ? D ? B 7 ? ? ;(chain 'B' and resid 1 through 7) ; 3 'X-RAY DIFFRACTION' 3 E ? C 8 ? E ? C 14 ? ? ;(chain 'C' and resid 8 through 14) ; 4 'X-RAY DIFFRACTION' 4 F ? D 1 ? F ? D 7 ? ? ;(chain 'D' and resid 1 through 7) ; # _pdbx_entry_details.entry_id 7SDQ _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 5CM N1 N N N 1 5CM C2 C N N 2 5CM N3 N N N 3 5CM C4 C N N 4 5CM C5 C N N 5 5CM C5A C N N 6 5CM C6 C N N 7 5CM O2 O N N 8 5CM N4 N N N 9 5CM "C1'" C N R 10 5CM "C2'" C N N 11 5CM "C3'" C N S 12 5CM "C4'" C N R 13 5CM "O4'" O N N 14 5CM "O3'" O N N 15 5CM "C5'" C N N 16 5CM "O5'" O N N 17 5CM P P N N 18 5CM OP1 O N N 19 5CM OP2 O N N 20 5CM OP3 O N N 21 5CM H5A1 H N N 22 5CM H5A2 H N N 23 5CM H5A3 H N N 24 5CM H6 H N N 25 5CM HN41 H N N 26 5CM HN42 H N N 27 5CM "H1'" H N N 28 5CM "H2'" H N N 29 5CM "H2''" H N N 30 5CM "H3'" H N N 31 5CM "H4'" H N N 32 5CM "HO3'" H N N 33 5CM "H5'" H N N 34 5CM "H5''" H N N 35 5CM HOP2 H N N 36 5CM HOP3 H N N 37 AG AG AG N N 38 DA OP3 O N N 39 DA P P N N 40 DA OP1 O N N 41 DA OP2 O N N 42 DA "O5'" O N N 43 DA "C5'" C N N 44 DA "C4'" C N R 45 DA "O4'" O N N 46 DA "C3'" C N S 47 DA "O3'" O N N 48 DA "C2'" C N N 49 DA "C1'" C N R 50 DA N9 N Y N 51 DA C8 C Y N 52 DA N7 N Y N 53 DA C5 C Y N 54 DA C6 C Y N 55 DA N6 N N N 56 DA N1 N Y N 57 DA C2 C Y N 58 DA N3 N Y N 59 DA C4 C Y N 60 DA HOP3 H N N 61 DA HOP2 H N N 62 DA "H5'" H N N 63 DA "H5''" H N N 64 DA "H4'" H N N 65 DA "H3'" H N N 66 DA "HO3'" H N N 67 DA "H2'" H N N 68 DA "H2''" H N N 69 DA "H1'" H N N 70 DA H8 H N N 71 DA H61 H N N 72 DA H62 H N N 73 DA H2 H N N 74 DC OP3 O N N 75 DC P P N N 76 DC OP1 O N N 77 DC OP2 O N N 78 DC "O5'" O N N 79 DC "C5'" C N N 80 DC "C4'" C N R 81 DC "O4'" O N N 82 DC "C3'" C N S 83 DC "O3'" O N N 84 DC "C2'" C N N 85 DC "C1'" C N R 86 DC N1 N N N 87 DC C2 C N N 88 DC O2 O N N 89 DC N3 N N N 90 DC C4 C N N 91 DC N4 N N N 92 DC C5 C N N 93 DC C6 C N N 94 DC HOP3 H N N 95 DC HOP2 H N N 96 DC "H5'" H N N 97 DC "H5''" H N N 98 DC "H4'" H N N 99 DC "H3'" H N N 100 DC "HO3'" H N N 101 DC "H2'" H N N 102 DC "H2''" H N N 103 DC "H1'" H N N 104 DC H41 H N N 105 DC H42 H N N 106 DC H5 H N N 107 DC H6 H N N 108 DG OP3 O N N 109 DG P P N N 110 DG OP1 O N N 111 DG OP2 O N N 112 DG "O5'" O N N 113 DG "C5'" C N N 114 DG "C4'" C N R 115 DG "O4'" O N N 116 DG "C3'" C N S 117 DG "O3'" O N N 118 DG "C2'" C N N 119 DG "C1'" C N R 120 DG N9 N Y N 121 DG C8 C Y N 122 DG N7 N Y N 123 DG C5 C Y N 124 DG C6 C N N 125 DG O6 O N N 126 DG N1 N N N 127 DG C2 C N N 128 DG N2 N N N 129 DG N3 N N N 130 DG C4 C Y N 131 DG HOP3 H N N 132 DG HOP2 H N N 133 DG "H5'" H N N 134 DG "H5''" H N N 135 DG "H4'" H N N 136 DG "H3'" H N N 137 DG "HO3'" H N N 138 DG "H2'" H N N 139 DG "H2''" H N N 140 DG "H1'" H N N 141 DG H8 H N N 142 DG H1 H N N 143 DG H21 H N N 144 DG H22 H N N 145 DT OP3 O N N 146 DT P P N N 147 DT OP1 O N N 148 DT OP2 O N N 149 DT "O5'" O N N 150 DT "C5'" C N N 151 DT "C4'" C N R 152 DT "O4'" O N N 153 DT "C3'" C N S 154 DT "O3'" O N N 155 DT "C2'" C N N 156 DT "C1'" C N R 157 DT N1 N N N 158 DT C2 C N N 159 DT O2 O N N 160 DT N3 N N N 161 DT C4 C N N 162 DT O4 O N N 163 DT C5 C N N 164 DT C7 C N N 165 DT C6 C N N 166 DT HOP3 H N N 167 DT HOP2 H N N 168 DT "H5'" H N N 169 DT "H5''" H N N 170 DT "H4'" H N N 171 DT "H3'" H N N 172 DT "HO3'" H N N 173 DT "H2'" H N N 174 DT "H2''" H N N 175 DT "H1'" H N N 176 DT H3 H N N 177 DT H71 H N N 178 DT H72 H N N 179 DT H73 H N N 180 DT H6 H N N 181 DU OP3 O N N 182 DU P P N N 183 DU OP1 O N N 184 DU OP2 O N N 185 DU "O5'" O N N 186 DU "C5'" C N N 187 DU "C4'" C N R 188 DU "O4'" O N N 189 DU "C3'" C N S 190 DU "O3'" O N N 191 DU "C2'" C N N 192 DU "C1'" C N R 193 DU N1 N N N 194 DU C2 C N N 195 DU O2 O N N 196 DU N3 N N N 197 DU C4 C N N 198 DU O4 O N N 199 DU C5 C N N 200 DU C6 C N N 201 DU HOP3 H N N 202 DU HOP2 H N N 203 DU "H5'" H N N 204 DU "H5''" H N N 205 DU "H4'" H N N 206 DU "H3'" H N N 207 DU "HO3'" H N N 208 DU "H2'" H N N 209 DU "H2''" H N N 210 DU "H1'" H N N 211 DU H3 H N N 212 DU H5 H N N 213 DU H6 H N N 214 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 5CM N1 C2 sing N N 1 5CM N1 C6 sing N N 2 5CM N1 "C1'" sing N N 3 5CM C2 N3 sing N N 4 5CM C2 O2 doub N N 5 5CM N3 C4 doub N N 6 5CM C4 C5 sing N N 7 5CM C4 N4 sing N N 8 5CM C5 C5A sing N N 9 5CM C5 C6 doub N N 10 5CM C5A H5A1 sing N N 11 5CM C5A H5A2 sing N N 12 5CM C5A H5A3 sing N N 13 5CM C6 H6 sing N N 14 5CM N4 HN41 sing N N 15 5CM N4 HN42 sing N N 16 5CM "C1'" "C2'" sing N N 17 5CM "C1'" "O4'" sing N N 18 5CM "C1'" "H1'" sing N N 19 5CM "C2'" "C3'" sing N N 20 5CM "C2'" "H2'" sing N N 21 5CM "C2'" "H2''" sing N N 22 5CM "C3'" "C4'" sing N N 23 5CM "C3'" "O3'" sing N N 24 5CM "C3'" "H3'" sing N N 25 5CM "C4'" "O4'" sing N N 26 5CM "C4'" "C5'" sing N N 27 5CM "C4'" "H4'" sing N N 28 5CM "O3'" "HO3'" sing N N 29 5CM "C5'" "O5'" sing N N 30 5CM "C5'" "H5'" sing N N 31 5CM "C5'" "H5''" sing N N 32 5CM "O5'" P sing N N 33 5CM P OP1 doub N N 34 5CM P OP2 sing N N 35 5CM P OP3 sing N N 36 5CM OP2 HOP2 sing N N 37 5CM OP3 HOP3 sing N N 38 DA OP3 P sing N N 39 DA OP3 HOP3 sing N N 40 DA P OP1 doub N N 41 DA P OP2 sing N N 42 DA P "O5'" sing N N 43 DA OP2 HOP2 sing N N 44 DA "O5'" "C5'" sing N N 45 DA "C5'" "C4'" sing N N 46 DA "C5'" "H5'" sing N N 47 DA "C5'" "H5''" sing N N 48 DA "C4'" "O4'" sing N N 49 DA "C4'" "C3'" sing N N 50 DA "C4'" "H4'" sing N N 51 DA "O4'" "C1'" sing N N 52 DA "C3'" "O3'" sing N N 53 DA "C3'" "C2'" sing N N 54 DA "C3'" "H3'" sing N N 55 DA "O3'" "HO3'" sing N N 56 DA "C2'" "C1'" sing N N 57 DA "C2'" "H2'" sing N N 58 DA "C2'" "H2''" sing N N 59 DA "C1'" N9 sing N N 60 DA "C1'" "H1'" sing N N 61 DA N9 C8 sing Y N 62 DA N9 C4 sing Y N 63 DA C8 N7 doub Y N 64 DA C8 H8 sing N N 65 DA N7 C5 sing Y N 66 DA C5 C6 sing Y N 67 DA C5 C4 doub Y N 68 DA C6 N6 sing N N 69 DA C6 N1 doub Y N 70 DA N6 H61 sing N N 71 DA N6 H62 sing N N 72 DA N1 C2 sing Y N 73 DA C2 N3 doub Y N 74 DA C2 H2 sing N N 75 DA N3 C4 sing Y N 76 DC OP3 P sing N N 77 DC OP3 HOP3 sing N N 78 DC P OP1 doub N N 79 DC P OP2 sing N N 80 DC P "O5'" sing N N 81 DC OP2 HOP2 sing N N 82 DC "O5'" "C5'" sing N N 83 DC "C5'" "C4'" sing N N 84 DC "C5'" "H5'" sing N N 85 DC "C5'" "H5''" sing N N 86 DC "C4'" "O4'" sing N N 87 DC "C4'" "C3'" sing N N 88 DC "C4'" "H4'" sing N N 89 DC "O4'" "C1'" sing N N 90 DC "C3'" "O3'" sing N N 91 DC "C3'" "C2'" sing N N 92 DC "C3'" "H3'" sing N N 93 DC "O3'" "HO3'" sing N N 94 DC "C2'" "C1'" sing N N 95 DC "C2'" "H2'" sing N N 96 DC "C2'" "H2''" sing N N 97 DC "C1'" N1 sing N N 98 DC "C1'" "H1'" sing N N 99 DC N1 C2 sing N N 100 DC N1 C6 sing N N 101 DC C2 O2 doub N N 102 DC C2 N3 sing N N 103 DC N3 C4 doub N N 104 DC C4 N4 sing N N 105 DC C4 C5 sing N N 106 DC N4 H41 sing N N 107 DC N4 H42 sing N N 108 DC C5 C6 doub N N 109 DC C5 H5 sing N N 110 DC C6 H6 sing N N 111 DG OP3 P sing N N 112 DG OP3 HOP3 sing N N 113 DG P OP1 doub N N 114 DG P OP2 sing N N 115 DG P "O5'" sing N N 116 DG OP2 HOP2 sing N N 117 DG "O5'" "C5'" sing N N 118 DG "C5'" "C4'" sing N N 119 DG "C5'" "H5'" sing N N 120 DG "C5'" "H5''" sing N N 121 DG "C4'" "O4'" sing N N 122 DG "C4'" "C3'" sing N N 123 DG "C4'" "H4'" sing N N 124 DG "O4'" "C1'" sing N N 125 DG "C3'" "O3'" sing N N 126 DG "C3'" "C2'" sing N N 127 DG "C3'" "H3'" sing N N 128 DG "O3'" "HO3'" sing N N 129 DG "C2'" "C1'" sing N N 130 DG "C2'" "H2'" sing N N 131 DG "C2'" "H2''" sing N N 132 DG "C1'" N9 sing N N 133 DG "C1'" "H1'" sing N N 134 DG N9 C8 sing Y N 135 DG N9 C4 sing Y N 136 DG C8 N7 doub Y N 137 DG C8 H8 sing N N 138 DG N7 C5 sing Y N 139 DG C5 C6 sing N N 140 DG C5 C4 doub Y N 141 DG C6 O6 doub N N 142 DG C6 N1 sing N N 143 DG N1 C2 sing N N 144 DG N1 H1 sing N N 145 DG C2 N2 sing N N 146 DG C2 N3 doub N N 147 DG N2 H21 sing N N 148 DG N2 H22 sing N N 149 DG N3 C4 sing N N 150 DT OP3 P sing N N 151 DT OP3 HOP3 sing N N 152 DT P OP1 doub N N 153 DT P OP2 sing N N 154 DT P "O5'" sing N N 155 DT OP2 HOP2 sing N N 156 DT "O5'" "C5'" sing N N 157 DT "C5'" "C4'" sing N N 158 DT "C5'" "H5'" sing N N 159 DT "C5'" "H5''" sing N N 160 DT "C4'" "O4'" sing N N 161 DT "C4'" "C3'" sing N N 162 DT "C4'" "H4'" sing N N 163 DT "O4'" "C1'" sing N N 164 DT "C3'" "O3'" sing N N 165 DT "C3'" "C2'" sing N N 166 DT "C3'" "H3'" sing N N 167 DT "O3'" "HO3'" sing N N 168 DT "C2'" "C1'" sing N N 169 DT "C2'" "H2'" sing N N 170 DT "C2'" "H2''" sing N N 171 DT "C1'" N1 sing N N 172 DT "C1'" "H1'" sing N N 173 DT N1 C2 sing N N 174 DT N1 C6 sing N N 175 DT C2 O2 doub N N 176 DT C2 N3 sing N N 177 DT N3 C4 sing N N 178 DT N3 H3 sing N N 179 DT C4 O4 doub N N 180 DT C4 C5 sing N N 181 DT C5 C7 sing N N 182 DT C5 C6 doub N N 183 DT C7 H71 sing N N 184 DT C7 H72 sing N N 185 DT C7 H73 sing N N 186 DT C6 H6 sing N N 187 DU OP3 P sing N N 188 DU OP3 HOP3 sing N N 189 DU P OP1 doub N N 190 DU P OP2 sing N N 191 DU P "O5'" sing N N 192 DU OP2 HOP2 sing N N 193 DU "O5'" "C5'" sing N N 194 DU "C5'" "C4'" sing N N 195 DU "C5'" "H5'" sing N N 196 DU "C5'" "H5''" sing N N 197 DU "C4'" "O4'" sing N N 198 DU "C4'" "C3'" sing N N 199 DU "C4'" "H4'" sing N N 200 DU "O4'" "C1'" sing N N 201 DU "C3'" "O3'" sing N N 202 DU "C3'" "C2'" sing N N 203 DU "C3'" "H3'" sing N N 204 DU "O3'" "HO3'" sing N N 205 DU "C2'" "C1'" sing N N 206 DU "C2'" "H2'" sing N N 207 DU "C2'" "H2''" sing N N 208 DU "C1'" N1 sing N N 209 DU "C1'" "H1'" sing N N 210 DU N1 C2 sing N N 211 DU N1 C6 sing N N 212 DU C2 O2 doub N N 213 DU C2 N3 sing N N 214 DU N3 C4 sing N N 215 DU N3 H3 sing N N 216 DU C4 O4 doub N N 217 DU C4 C5 sing N N 218 DU C5 C6 doub N N 219 DU C5 H5 sing N N 220 DU C6 H6 sing N N 221 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7SDQ 'double helix' 7SDQ 'a-form double helix' 7SDQ 'b-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DA 2 1_555 C DT 7 1_555 0.346 0.215 -0.487 2.871 -3.781 -9.520 1 A_DA2:DT14_C A 2 ? C 14 ? 20 1 1 A DG 3 1_555 C DC 6 1_555 -0.186 -0.161 -0.693 -4.678 -6.458 2.175 2 A_DG3:DC13_C A 3 ? C 13 ? 19 1 1 A DC 4 1_555 C DG 5 1_555 -0.018 0.344 -0.349 -2.299 -8.313 -9.827 3 A_DC4:DG12_C A 4 ? C 12 ? 19 1 1 A DA 5 1_555 C DT 4 1_555 0.087 -0.073 -0.269 -5.004 -8.449 -8.090 4 A_DA5:DT11_C A 5 ? C 11 ? 20 1 1 A DG 6 1_555 C DC 3 1_555 -0.080 -0.316 0.932 9.632 -7.416 -1.054 5 A_DG6:DC10_C A 6 ? C 10 ? 19 1 1 A DC 7 1_555 C DG 2 1_555 0.215 -0.461 1.174 4.782 -8.149 0.595 6 A_DC7:DG9_C A 7 ? C 9 ? 19 1 1 A DC 8 1_555 C DG 1 1_555 0.006 -0.293 0.919 -4.734 -14.247 -6.751 7 A_DC8:DG8_C A 8 ? C 8 ? 19 1 1 A DT 9 1_555 B DA 7 1_555 -0.479 -0.571 1.575 -2.754 -4.312 1.808 8 A_DT9:DA7_B A 9 ? B 7 ? 20 1 1 A DG 10 1_555 B DC 6 1_555 -0.231 -0.259 0.953 -9.088 -18.064 -0.926 9 A_DG10:DC6_B A 10 ? B 6 ? 19 1 1 A 5CM 12 1_555 B DU 4 1_555 -1.324 -0.730 -0.159 1.494 -7.741 -9.183 10 A_5CM12:DU4_B A 12 ? B 4 ? ? ? 1 A DT 13 1_555 B DA 3 1_555 -0.287 -0.105 0.497 -1.002 -5.981 7.820 11 A_DT13:DA3_B A 13 ? B 3 ? 20 1 1 A DG 14 1_555 B DC 2 1_555 -0.193 -0.213 0.054 -7.918 -11.113 -6.096 12 A_DG14:DC2_B A 14 ? B 2 ? 19 1 1 A DG 15 1_555 B DC 1 1_555 -0.079 -0.409 -0.838 -0.303 0.156 -1.966 13 A_DG15:DC1_B A 15 ? B 1 ? 19 1 1 A DA 16 1_555 D DT 7 1_555 0.286 -0.474 1.385 6.816 -10.476 -9.935 14 A_DA16:DT7_D A 16 ? D 7 ? 20 1 1 A DC 17 1_555 D DG 6 1_555 0.220 -0.180 0.853 -3.926 -5.427 -0.274 15 A_DC17:DG6_D A 17 ? D 6 ? 19 1 1 A DA 18 1_555 D DT 5 1_555 -0.006 -0.116 -0.780 -13.364 -11.486 2.209 16 A_DA18:DT5_D A 18 ? D 5 ? 20 1 1 A DT 19 1_555 D DA 4 1_555 -0.124 -0.244 0.046 -4.908 -8.009 4.263 17 A_DT19:DA4_D A 19 ? D 4 ? 20 1 1 A DC 20 1_555 D DG 3 1_555 0.152 -0.200 -0.511 -4.771 -8.997 3.492 18 A_DC20:DG3_D A 20 ? D 3 ? 19 1 1 A DA 21 1_555 D DT 2 1_555 0.121 -0.114 0.178 -4.850 -9.905 -0.466 19 A_DA21:DT2_D A 21 ? D 2 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DA 2 1_555 C DT 7 1_555 A DG 3 1_555 C DC 6 1_555 0.192 -0.472 3.601 -3.652 11.130 37.972 -2.099 -0.744 3.308 16.628 5.457 39.674 1 AA_DA2DG3:DC13DT14_CC A 2 ? C 14 ? A 3 ? C 13 ? 1 A DG 3 1_555 C DC 6 1_555 A DC 4 1_555 C DG 5 1_555 -0.621 -1.426 3.024 -3.687 -0.202 28.048 -2.874 0.468 3.089 -0.414 7.566 28.285 2 AA_DG3DC4:DG12DC13_CC A 3 ? C 13 ? A 4 ? C 12 ? 1 A DC 4 1_555 C DG 5 1_555 A DA 5 1_555 C DT 4 1_555 -0.935 -0.286 3.287 -6.068 15.671 37.282 -2.167 0.661 3.044 23.130 8.956 40.771 3 AA_DC4DA5:DT11DG12_CC A 4 ? C 12 ? A 5 ? C 11 ? 1 A DA 5 1_555 C DT 4 1_555 A DG 6 1_555 C DC 3 1_555 0.235 -1.361 2.982 -18.275 3.968 27.800 -2.942 -3.047 2.209 7.305 33.644 33.401 4 AA_DA5DG6:DC10DT11_CC A 5 ? C 11 ? A 6 ? C 10 ? 1 A DG 6 1_555 C DC 3 1_555 A DC 7 1_555 C DG 2 1_555 0.208 -1.756 3.318 -6.297 3.509 28.158 -4.254 -1.765 2.966 7.067 12.681 29.048 5 AA_DG6DC7:DG9DC10_CC A 6 ? C 10 ? A 7 ? C 9 ? 1 A DC 7 1_555 C DG 2 1_555 A DC 8 1_555 C DG 1 1_555 -0.937 -0.306 3.432 -3.483 -18.217 47.644 1.022 0.826 3.387 -21.621 4.134 50.930 6 AA_DC7DC8:DG8DG9_CC A 7 ? C 9 ? A 8 ? C 8 ? 1 A DC 8 1_555 C DG 1 1_555 A DT 9 1_555 B DA 7 1_555 -1.762 -0.966 3.631 -7.740 -6.794 15.945 1.612 0.171 4.116 -21.779 24.812 18.963 7 AA_DC8DT9:DA7DG8_BC A 8 ? C 8 ? A 9 ? B 7 ? 1 A DT 9 1_555 B DA 7 1_555 A DG 10 1_555 B DC 6 1_555 -0.584 -0.535 3.478 2.528 10.260 32.469 -2.598 1.410 3.117 17.772 -4.378 34.101 8 AA_DT9DG10:DC6DA7_BB A 9 ? B 7 ? A 10 ? B 6 ? 1 A DG 10 1_555 B DC 6 1_555 A 5CM 12 1_555 B DU 4 1_555 -1.481 -0.819 6.229 -2.265 0.737 66.953 -0.797 1.173 6.262 0.668 2.052 66.990 9 AA_DG105CM12:DU4DC6_BB A 10 ? B 6 ? A 12 ? B 4 ? 1 A 5CM 12 1_555 B DU 4 1_555 A DT 13 1_555 B DA 3 1_555 0.534 -0.334 3.313 -0.600 2.148 35.446 -0.864 -0.964 3.278 3.524 0.984 35.514 10 AA_5CM12DT13:DA3DU4_BB A 12 ? B 4 ? A 13 ? B 3 ? 1 A DT 13 1_555 B DA 3 1_555 A DG 14 1_555 B DC 2 1_555 -1.607 3.096 3.513 -9.279 -0.228 49.652 3.650 1.149 3.724 -0.269 10.939 50.458 11 AA_DT13DG14:DC2DA3_BB A 13 ? B 3 ? A 14 ? B 2 ? 1 A DG 14 1_555 B DC 2 1_555 A DG 15 1_555 B DC 1 1_555 -0.212 0.928 3.662 -8.157 -3.519 38.980 1.811 -0.737 3.540 -5.191 12.035 39.941 12 AA_DG14DG15:DC1DC2_BB A 14 ? B 2 ? A 15 ? B 1 ? 1 A DG 15 1_555 B DC 1 1_555 A DA 16 1_555 D DT 7 1_555 -1.493 -1.182 3.001 -21.073 -7.164 25.614 -0.721 -1.289 3.449 -13.386 39.374 33.811 13 AA_DG15DA16:DT7DC1_DB A 15 ? B 1 ? A 16 ? D 7 ? 1 A DA 16 1_555 D DT 7 1_555 A DC 17 1_555 D DG 6 1_555 0.750 -1.493 3.619 4.754 -6.092 28.943 -1.414 -0.300 3.915 -11.923 -9.304 29.936 14 AA_DA16DC17:DG6DT7_DD A 16 ? D 7 ? A 17 ? D 6 ? 1 A DC 17 1_555 D DG 6 1_555 A DA 18 1_555 D DT 5 1_555 -0.381 0.128 3.354 9.176 2.371 38.091 -0.096 1.680 3.184 3.565 -13.800 39.210 15 AA_DC17DA18:DT5DG6_DD A 17 ? D 6 ? A 18 ? D 5 ? 1 A DA 18 1_555 D DT 5 1_555 A DT 19 1_555 D DA 4 1_555 0.339 -0.034 2.966 -5.668 -1.038 34.654 0.084 -1.325 2.876 -1.728 9.435 35.115 16 AA_DA18DT19:DA4DT5_DD A 18 ? D 5 ? A 19 ? D 4 ? 1 A DT 19 1_555 D DA 4 1_555 A DC 20 1_555 D DG 3 1_555 0.168 0.568 2.976 6.458 -4.359 44.850 1.082 0.298 2.908 -5.663 -8.389 45.488 17 AA_DT19DC20:DG3DA4_DD A 19 ? D 4 ? A 20 ? D 3 ? 1 A DC 20 1_555 D DG 3 1_555 A DA 21 1_555 D DT 2 1_555 -0.736 -0.115 3.308 -4.439 11.085 30.236 -2.198 0.519 3.147 20.284 8.123 32.457 18 AA_DC20DA21:DT2DG3_DD A 20 ? D 3 ? A 21 ? D 2 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'Office of Naval Research (ONR)' 'United States' N000141912596 1 'Department of Energy (DOE, United States)' 'United States' DE-SC0007991 2 'National Science Foundation (NSF, United States)' 'United States' 2106790 3 'Human Frontier Science Program (HFSP)' 'United States' RPG0010/2017 4 'National Science Foundation (NSF, United States)' 'United States' DMR-1420073 5 'National Aeronautic Space Administration (NASA, United States)' 'United States' '2020 NASA Center Innovation Fund' 6 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id AG _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id AG _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _space_group.name_H-M_alt 'R 3 :H' _space_group.name_Hall 'R 3' _space_group.IT_number 146 _space_group.crystal_system trigonal _space_group.id 1 # _atom_sites.entry_id 7SDQ _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.009482 _atom_sites.fract_transf_matrix[1][2] 0.005474 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.010949 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.010683 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source AG ? ? 46.70359 ? ? ? 5.43095 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? C ? ? 5.96793 ? ? ? 14.89577 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 6.96715 ? ? ? 11.43723 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 7.96527 ? ? ? 9.05267 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 14.90797 ? ? ? 11.91318 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_