data_7URI # _entry.id 7URI # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.393 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 7URI pdb_00007uri 10.2210/pdb7uri/pdb WWPDB D_1000264718 ? ? EMDB EMD-26713 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2022-08-10 2 'Structure model' 1 1 2022-10-26 3 'Structure model' 1 2 2024-06-12 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Data collection' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' chem_comp_atom 4 3 'Structure model' chem_comp_bond # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 2 'Structure model' '_citation_author.identifier_ORCID' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 7URI _pdbx_database_status.recvd_initial_deposition_date 2022-04-22 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name EMDB _pdbx_database_related.details 'allo-tRNAUTu1A in the A site of the E. coli ribosome' _pdbx_database_related.db_id EMD-26713 _pdbx_database_related.content_type 'associated EM volume' # loop_ _pdbx_contact_author.id _pdbx_contact_author.email _pdbx_contact_author.name_first _pdbx_contact_author.name_last _pdbx_contact_author.name_mi _pdbx_contact_author.role _pdbx_contact_author.identifier_ORCID 2 dieter.soll@yale.edu Dieter Soll ? 'principal investigator/group leader' 0000-0002-3077-8986 3 puglisi@stanford.edu Joseph Puglisi ? 'principal investigator/group leader' 0000-0001-9268-5112 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Zhang, J.' 1 ? 'Prabhakar, A.' 2 ? 'Krahn, N.' 3 0000-0003-0696-433X 'Vargas-Rodriguez, O.' 4 0000-0002-2301-2800 'Krupkin, M.' 5 0000-0002-5917-0894 'Fu, Z.' 6 ? 'Acosta-Reyes, F.J.' 7 0000-0001-8524-1484 'Ge, X.' 8 ? 'Choi, J.' 9 ? 'Crnkovic, A.' 10 0000-0002-0581-1887 'Ehrenberg, M.' 11 ? 'Viani Puglisi, E.' 12 0000-0002-4795-5299 'Soll, D.' 13 0000-0002-3077-8986 'Puglisi, J.' 14 0000-0001-9268-5112 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 50 _citation.language ? _citation.page_first 10201 _citation.page_last 10211 _citation.title 'Uncovering translation roadblocks during the development of a synthetic tRNA.' _citation.year 2022 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkac576 _citation.pdbx_database_id_PubMed 35882385 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Prabhakar, A.' 1 ? primary 'Krahn, N.' 2 ? primary 'Zhang, J.' 3 ? primary 'Vargas-Rodriguez, O.' 4 ? primary 'Krupkin, M.' 5 ? primary 'Fu, Z.' 6 ? primary 'Acosta-Reyes, F.J.' 7 ? primary 'Ge, X.' 8 ? primary 'Choi, J.' 9 ? primary 'Crnkovic, A.' 10 ? primary 'Ehrenberg, M.' 11 ? primary 'Puglisi, E.V.' 12 ? primary 'Soll, D.' 13 ? primary 'Puglisi, J.' 14 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description Allo-tRNAUTu1A _entity.formula_weight 28782.008 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGAGGGGAAAUUCUAUCUGGUGAUAGACGGGAACUCUAAAUUCCUUGAAAUGCCUCGCCGCAUUGGGUUCGAUUCCCUUC CCCUCCGCCA ; _entity_poly.pdbx_seq_one_letter_code_can ;GGAGGGGAAAUUCUAUCUGGUGAUAGACGGGAACUCUAAAUUCCUUGAAAUGCCUCGCCGCAUUGGGUUCGAUUCCCUUC CCCUCCGCCA ; _entity_poly.pdbx_strand_id y _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 G n 1 5 G n 1 6 G n 1 7 G n 1 8 A n 1 9 A n 1 10 A n 1 11 U n 1 12 U n 1 13 C n 1 14 U n 1 15 A n 1 16 U n 1 17 C n 1 18 U n 1 19 G n 1 20 G n 1 21 U n 1 22 G n 1 23 A n 1 24 U n 1 25 A n 1 26 G n 1 27 A n 1 28 C n 1 29 G n 1 30 G n 1 31 G n 1 32 A n 1 33 A n 1 34 C n 1 35 U n 1 36 C n 1 37 U n 1 38 A n 1 39 A n 1 40 A n 1 41 U n 1 42 U n 1 43 C n 1 44 C n 1 45 U n 1 46 U n 1 47 G n 1 48 A n 1 49 A n 1 50 A n 1 51 U n 1 52 G n 1 53 C n 1 54 C n 1 55 U n 1 56 C n 1 57 G n 1 58 C n 1 59 C n 1 60 G n 1 61 C n 1 62 A n 1 63 U n 1 64 U n 1 65 G n 1 66 G n 1 67 G n 1 68 U n 1 69 U n 1 70 C n 1 71 G n 1 72 A n 1 73 U n 1 74 U n 1 75 C n 1 76 C n 1 77 C n 1 78 U n 1 79 U n 1 80 C n 1 81 C n 1 82 C n 1 83 C n 1 84 U n 1 85 C n 1 86 C n 1 87 G n 1 88 C n 1 89 C n 1 90 A n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 90 _pdbx_entity_src_syn.organism_scientific metagenome _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 256318 _pdbx_entity_src_syn.details ;Oil polluted marine microbial communities from Coal Oil Point, Santa Barbara, California, USA - Santa Barbara Oil Seep Sample 6 (Crude oil metagenome 6, ASSEMBLY_DATE=20131204) ; # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G y . n A 1 2 G 2 2 2 G G y . n A 1 3 A 3 3 3 A A y . n A 1 4 G 4 4 4 G G y . n A 1 5 G 5 5 5 G G y . n A 1 6 G 6 5 5 G G y A n A 1 7 G 7 5 5 G G y B n A 1 8 A 8 6 6 A A y . n A 1 9 A 9 7 7 A A y . n A 1 10 A 10 8 8 A A y . n A 1 11 U 11 9 9 U U y . n A 1 12 U 12 10 10 U U y . n A 1 13 C 13 11 11 C C y . n A 1 14 U 14 12 12 U U y . n A 1 15 A 15 13 13 A A y . n A 1 16 U 16 14 14 U U y . n A 1 17 C 17 15 15 C C y . n A 1 18 U 18 16 16 U U y . n A 1 19 G 19 18 18 G G y . n A 1 20 G 20 19 19 G G y . n A 1 21 U 21 20 20 U U y . n A 1 22 G 22 20 20 G G y A n A 1 23 A 23 21 21 A A y . n A 1 24 U 24 22 22 U U y . n A 1 25 A 25 23 23 A A y . n A 1 26 G 26 24 24 G G y . n A 1 27 A 27 25 25 A A y . n A 1 28 C 28 26 26 C C y . n A 1 29 G 29 27 27 G G y . n A 1 30 G 30 28 28 G G y . n A 1 31 G 31 29 29 G G y . n A 1 32 A 32 30 30 A A y . n A 1 33 A 33 31 31 A A y . n A 1 34 C 34 32 32 C C y . n A 1 35 U 35 33 33 U U y . n A 1 36 C 36 34 34 C C y . n A 1 37 U 37 35 35 U U y . n A 1 38 A 38 36 36 A A y . n A 1 39 A 39 37 37 A A y . n A 1 40 A 40 38 38 A A y . n A 1 41 U 41 39 39 U U y . n A 1 42 U 42 40 40 U U y . n A 1 43 C 43 41 41 C C y . n A 1 44 C 44 42 42 C C y . n A 1 45 U 45 42 42 U U y A n A 1 46 U 46 43 43 U U y . n A 1 47 G 47 44 44 G G y . n A 1 48 A 48 45 45 A A y . n A 1 49 A 49 46 46 A A y . n A 1 50 A 50 47 47 A A y . n A 1 51 U 51 47 47 U U y A n A 1 52 G 52 47 47 G G y B n A 1 53 C 53 47 47 C C y C n A 1 54 C 54 47 47 C C y D n A 1 55 U 55 47 47 U U y E n A 1 56 C 56 47 47 C C y F n A 1 57 G 57 47 47 G G y G n A 1 58 C 58 47 47 C C y H n A 1 59 C 59 47 47 C C y I n A 1 60 G 60 47 47 G G y J n A 1 61 C 61 47 47 C C y K n A 1 62 A 62 47 47 A A y L n A 1 63 U 63 47 47 U U y M n A 1 64 U 64 48 48 U U y . n A 1 65 G 65 51 51 G G y . n A 1 66 G 66 52 52 G G y . n A 1 67 G 67 53 53 G G y . n A 1 68 U 68 54 54 U U y . n A 1 69 U 69 55 55 U U y . n A 1 70 C 70 56 56 C C y . n A 1 71 G 71 57 57 G G y . n A 1 72 A 72 58 58 A A y . n A 1 73 U 73 59 59 U U y . n A 1 74 U 74 60 60 U U y . n A 1 75 C 75 61 61 C C y . n A 1 76 C 76 62 62 C C y . n A 1 77 C 77 63 63 C C y . n A 1 78 U 78 66 66 U U y . n A 1 79 U 79 67 67 U U y . n A 1 80 C 80 67 67 C C y A n A 1 81 C 81 67 67 C C y B n A 1 82 C 82 68 68 C C y . n A 1 83 C 83 69 69 C C y . n A 1 84 U 84 70 70 U U y . n A 1 85 C 85 71 71 C C y . n A 1 86 C 86 72 72 C C y . n A 1 87 G 87 73 73 G G y . n A 1 88 C 88 74 74 C C y . n A 1 89 C 89 75 75 C C y . n A 1 90 A 90 76 76 A A y . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 7URI _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _struct.entry_id 7URI _struct.title 'allo-tRNAUTu1A in the A site of the E. coli ribosome' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 7URI _struct_keywords.text 'tRNA, selenocysteine, RNA' _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 7URI _struct_ref.pdbx_db_accession 7URI _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 7URI _struct_ref_seq.pdbx_strand_id y _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 90 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 7URI _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 76 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 76 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 86 N3 ? ? y G 1 y C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 86 O2 ? ? y G 1 y C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 86 N4 ? ? y G 1 y C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 85 N3 ? ? y G 2 y C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 85 O2 ? ? y G 2 y C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 85 N4 ? ? y G 2 y C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 84 O4 ? ? y A 3 y U 70 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog8 hydrog ? ? A G 7 N1 ? B ? 1_555 A C 80 N3 ? A y G 5 y C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 7 N1 ? B ? 1_555 A C 81 N3 ? B y G 5 y C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 7 N2 ? B ? 1_555 A C 80 O2 ? A y G 5 y C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 7 N2 ? B ? 1_555 A C 81 O2 ? B y G 5 y C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 7 O6 ? B ? 1_555 A C 80 N4 ? A y G 5 y C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 7 O6 ? B ? 1_555 A C 81 N4 ? B y G 5 y C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 6 N1 ? A ? 1_555 A C 82 O2 ? ? y G 5 y C 68 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog15 hydrog ? ? A G 6 N2 ? A ? 1_555 A C 82 N3 ? ? y G 5 y C 68 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog16 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 79 N3 ? ? y A 6 y U 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 79 O4 ? ? y A 6 y U 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A A 9 N1 ? ? ? 1_555 A U 78 N3 ? ? y A 7 y U 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A A 9 N6 ? ? ? 1_555 A U 78 O4 ? ? y A 7 y U 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A U 12 N3 ? ? ? 1_555 A A 27 N1 ? ? y U 10 y A 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A U 12 O4 ? ? ? 1_555 A A 27 N6 ? ? y U 10 y A 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 26 N1 ? ? y C 11 y G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 26 O6 ? ? y C 11 y G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 26 N2 ? ? y C 11 y G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 25 N1 ? ? y U 12 y A 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 25 N6 ? ? y U 12 y A 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 15 N1 ? ? ? 1_555 A U 24 N3 ? ? y A 13 y U 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A A 15 N6 ? ? ? 1_555 A U 24 O4 ? ? y A 13 y U 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 16 N3 ? ? ? 1_555 A A 23 N1 ? ? y U 14 y A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 16 O4 ? ? ? 1_555 A A 23 N6 ? ? y U 14 y A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 17 N3 ? ? ? 1_555 A G 22 N1 ? A y C 15 y G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 17 N4 ? ? ? 1_555 A G 22 O6 ? A y C 15 y G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 17 O2 ? ? ? 1_555 A G 22 N2 ? A y C 15 y G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A U 18 N3 ? ? ? 1_555 A U 73 O2 ? ? y U 16 y U 59 1_555 ? ? ? ? ? ? TYPE_13_PAIR ? ? ? hydrog35 hydrog ? ? A U 18 O2 ? ? ? 1_555 A U 73 N3 ? ? y U 16 y U 59 1_555 ? ? ? ? ? ? TYPE_13_PAIR ? ? ? hydrog36 hydrog ? ? A G 19 N1 ? ? ? 1_555 A U 69 O2 ? ? y G 18 y U 55 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog37 hydrog ? ? A G 20 N1 ? ? ? 1_555 A C 70 N3 ? ? y G 19 y C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 20 N2 ? ? ? 1_555 A C 70 O2 ? ? y G 19 y C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 20 O6 ? ? ? 1_555 A C 70 N4 ? ? y G 19 y C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 28 N3 ? ? ? 1_555 A G 47 N1 ? ? y C 26 y G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 28 N4 ? ? ? 1_555 A G 47 O6 ? ? y C 26 y G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 28 O2 ? ? ? 1_555 A G 47 N2 ? ? y C 26 y G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 29 N1 ? ? ? 1_555 A U 45 O2 ? A y G 27 y U 42 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog44 hydrog ? ? A G 29 O6 ? ? ? 1_555 A U 45 N3 ? A y G 27 y U 42 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog45 hydrog ? ? A G 30 N1 ? ? ? 1_555 A C 44 N3 ? ? y G 28 y C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 30 N2 ? ? ? 1_555 A C 44 O2 ? ? y G 28 y C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 30 O6 ? ? ? 1_555 A C 44 N4 ? ? y G 28 y C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 43 N3 ? ? y G 29 y C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 43 O2 ? ? y G 29 y C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 43 N4 ? ? y G 29 y C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A A 32 N1 ? ? ? 1_555 A U 42 N3 ? ? y A 30 y U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A A 32 N6 ? ? ? 1_555 A U 42 O4 ? ? y A 30 y U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A A 33 N1 ? ? ? 1_555 A U 41 N3 ? ? y A 31 y U 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A A 33 N6 ? ? ? 1_555 A U 41 O4 ? ? y A 31 y U 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 34 O2 ? ? ? 1_555 A A 40 N6 ? ? y C 32 y A 38 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog56 hydrog ? ? A A 49 N1 ? ? ? 1_555 A U 64 N3 ? ? y A 46 y U 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A A 49 N6 ? ? ? 1_555 A U 64 O4 ? ? y A 46 y U 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A A 50 N1 ? ? ? 1_555 A U 63 N3 ? M y A 47 y U 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A A 50 N6 ? ? ? 1_555 A U 63 O4 ? M y A 47 y U 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A C 54 N4 ? D ? 1_555 A C 59 N3 ? I y C 47 y C 47 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ? ? ? hydrog61 hydrog ? ? A C 53 N3 ? C ? 1_555 A G 60 N1 ? J y C 47 y G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A C 53 N4 ? C ? 1_555 A G 60 O6 ? J y C 47 y G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A C 53 O2 ? C ? 1_555 A G 60 N2 ? J y C 47 y G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 52 N1 ? B ? 1_555 A C 61 N3 ? K y G 47 y C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 52 N2 ? B ? 1_555 A C 61 O2 ? K y G 47 y C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 52 O6 ? B ? 1_555 A C 61 N4 ? K y G 47 y C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A U 51 N3 ? A ? 1_555 A A 62 N1 ? L y U 47 y A 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A U 51 O4 ? A ? 1_555 A A 62 N6 ? L y U 47 y A 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A U 55 N3 ? E ? 1_555 A C 58 N3 ? H y U 47 y C 47 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog70 hydrog ? ? A U 55 O4 ? E ? 1_555 A C 58 N4 ? H y U 47 y C 47 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog71 hydrog ? ? A G 65 N1 ? ? ? 1_555 A C 77 N3 ? ? y G 51 y C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A G 65 N2 ? ? ? 1_555 A C 77 O2 ? ? y G 51 y C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A G 65 O6 ? ? ? 1_555 A C 77 N4 ? ? y G 51 y C 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A G 66 N1 ? ? ? 1_555 A C 76 N3 ? ? y G 52 y C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A G 66 N2 ? ? ? 1_555 A C 76 O2 ? ? y G 52 y C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A G 66 O6 ? ? ? 1_555 A C 76 N4 ? ? y G 52 y C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A G 67 N1 ? ? ? 1_555 A C 75 N3 ? ? y G 53 y C 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A G 67 N2 ? ? ? 1_555 A C 75 O2 ? ? y G 53 y C 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A G 67 O6 ? ? ? 1_555 A C 75 N4 ? ? y G 53 y C 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A U 68 N3 ? ? ? 1_555 A A 72 N7 ? ? y U 54 y A 58 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog81 hydrog ? ? A U 68 O2 ? ? ? 1_555 A A 72 N6 ? ? y U 54 y A 58 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _em_3d_fitting.entry_id 7URI _em_3d_fitting.id 1 _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_protocol ? _em_3d_fitting.ref_space ? _em_3d_fitting.target_criteria ? _em_3d_fitting.method ? # _em_3d_reconstruction.entry_id 7URI _em_3d_reconstruction.id 1 _em_3d_reconstruction.algorithm ? _em_3d_reconstruction.details ? _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.num_class_averages ? _em_3d_reconstruction.num_particles 424828 _em_3d_reconstruction.resolution 2.6 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.symmetry_type POINT _em_3d_reconstruction.method ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.magnification_calibration ? # _em_buffer.id 1 _em_buffer.details ? _em_buffer.pH 7 _em_buffer.specimen_id 1 _em_buffer.name ? # _em_entity_assembly.id 1 _em_entity_assembly.parent_id 0 _em_entity_assembly.details ? _em_entity_assembly.name 'E. coli 70S ribosome with allo-tRNAUTu1A in the A site' _em_entity_assembly.source NATURAL _em_entity_assembly.type RIBOSOME _em_entity_assembly.entity_id_list 1 _em_entity_assembly.synonym ? _em_entity_assembly.oligomeric_details ? # _em_imaging.id 1 _em_imaging.entry_id 7URI _em_imaging.accelerating_voltage 300 _em_imaging.alignment_procedure ? _em_imaging.c2_aperture_diameter ? _em_imaging.calibrated_defocus_max ? _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_magnification ? _em_imaging.cryogen ? _em_imaging.details ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.illumination_mode 'FLOOD BEAM' _em_imaging.microscope_model 'FEI TITAN KRIOS' _em_imaging.mode 'BRIGHT FIELD' _em_imaging.nominal_cs ? _em_imaging.nominal_defocus_max 2000 _em_imaging.nominal_defocus_min 1000 _em_imaging.nominal_magnification ? _em_imaging.recording_temperature_maximum ? _em_imaging.recording_temperature_minimum ? _em_imaging.residual_tilt ? _em_imaging.specimen_holder_model ? _em_imaging.specimen_id 1 _em_imaging.citation_id ? _em_imaging.date ? _em_imaging.temperature ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.astigmatism ? _em_imaging.detector_distance ? _em_imaging.electron_beam_tilt_params ? _em_imaging.specimen_holder_type ? # _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.chamber_temperature ? _em_vitrification.cryogen_name ETHANE-PROPANE _em_vitrification.details 'blot for 3 seconds before plunging' _em_vitrification.humidity ? _em_vitrification.instrument 'FEI VITROBOT MARK IV' _em_vitrification.entry_id 7URI _em_vitrification.citation_id ? _em_vitrification.method ? _em_vitrification.temp ? _em_vitrification.time_resolved_state ? # _em_experiment.entry_id 7URI _em_experiment.id 1 _em_experiment.aggregation_state '3D ARRAY' _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.entity_assembly_id 1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # _em_ctf_correction.id 1 _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.type NONE _em_ctf_correction.details ? # _em_entity_assembly_naturalsource.id 2 _em_entity_assembly_naturalsource.entity_assembly_id 1 _em_entity_assembly_naturalsource.cell ? _em_entity_assembly_naturalsource.cellular_location ? _em_entity_assembly_naturalsource.ncbi_tax_id 562 _em_entity_assembly_naturalsource.organ ? _em_entity_assembly_naturalsource.organelle ? _em_entity_assembly_naturalsource.organism 'Escherichia coli' _em_entity_assembly_naturalsource.strain ? _em_entity_assembly_naturalsource.tissue ? # _em_image_processing.id 1 _em_image_processing.image_recording_id 1 _em_image_processing.details ? # _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.avg_electron_dose_per_image 40 _em_image_recording.average_exposure_time ? _em_image_recording.details ? _em_image_recording.detector_mode ? _em_image_recording.film_or_detector_model 'GATAN K3 (6k x 4k)' _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged ? _em_image_recording.num_real_images ? _em_image_recording.avg_electron_dose_per_subtomogram ? # _em_particle_selection.id 1 _em_particle_selection.image_processing_id 1 _em_particle_selection.details ? _em_particle_selection.method ? _em_particle_selection.num_particles_selected 10850093 _em_particle_selection.reference_model ? # loop_ _em_software.id _em_software.category _em_software.details _em_software.name _em_software.version _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id 1 'SYMMETRY DETERMINATION' ? ? ? 1 1 1 2 'IMAGE ACQUISITION' ? ? ? ? ? 1 3 MASKING ? ? ? ? ? ? 4 'CTF CORRECTION' ? CTFFIND 4 1 ? ? 5 'LAYERLINE INDEXING' ? ? ? ? ? ? 6 'DIFFRACTION INDEXING' ? ? ? ? ? ? 7 'MODEL FITTING' ? ? ? ? ? ? 8 'MODEL REFINEMENT' ? ? ? ? ? ? 9 OTHER ? ? ? ? ? ? 10 'INITIAL EULER ASSIGNMENT' ? ? ? 1 ? ? 11 'FINAL EULER ASSIGNMENT' ? ? ? 1 ? ? 12 CLASSIFICATION ? ? ? 1 ? ? 13 RECONSTRUCTION ? ? ? 1 ? ? # _em_specimen.id 1 _em_specimen.experiment_id 1 _em_specimen.concentration ? _em_specimen.details ? _em_specimen.embedding_applied NO _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 7URI 'double helix' 7URI 'a-form double helix' 7URI 'parallel strands' 7URI 'hairpin loop' 7URI 'mismatched base pair' 7URI 'internal loop' 7URI 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 86 1_555 -1.329 -1.192 -0.320 -8.401 1.855 -1.790 1 y_G1:C72_y y 1 ? y 72 ? 19 1 1 A G 2 1_555 A C 85 1_555 -1.735 -0.363 -0.219 -6.384 1.616 -1.781 2 y_G2:C71_y y 2 ? y 71 ? 19 1 1 A A 3 1_555 A U 84 1_555 -1.269 0.554 -0.371 -2.245 2.152 -5.397 3 y_A3:U70_y y 3 ? y 70 ? ? ? 1 A G 6 1_555 A C 82 1_555 -0.161 -0.537 2.341 -3.684 2.292 30.080 4 y_G5A:C68_y y 5 A y 68 ? 22 1 1 A G 7 1_555 A C 80 1_555 0.643 0.544 -0.591 2.008 -6.392 -2.560 5 y_G5B:C67A_y y 5 B y 67 A 19 1 1 A A 8 1_555 A U 79 1_555 0.868 -0.166 -0.698 -2.539 -7.155 -0.693 6 y_A6:U67_y y 6 ? y 67 ? 20 1 1 A A 9 1_555 A U 78 1_555 0.703 -0.446 -0.639 -1.381 -11.681 -4.289 7 y_A7:U66_y y 7 ? y 66 ? 20 1 1 A G 65 1_555 A C 77 1_555 -0.024 -0.635 -0.624 -9.037 -4.013 -3.091 8 y_G51:C63_y y 51 ? y 63 ? 19 1 1 A G 66 1_555 A C 76 1_555 -0.164 -0.438 -0.400 -12.235 -0.105 -2.186 9 y_G52:C62_y y 52 ? y 62 ? 19 1 1 A G 67 1_555 A C 75 1_555 -0.608 -0.408 -0.231 -18.820 13.361 -6.308 10 y_G53:C61_y y 53 ? y 61 ? 19 1 1 A U 68 1_555 A A 72 1_555 4.294 -1.870 0.642 -3.190 9.855 -108.293 11 y_U54:A58_y y 54 ? y 58 ? 24 4 1 A U 69 1_555 A G 19 1_555 0.505 -5.593 0.458 15.257 1.452 -89.504 12 y_U55:G18_y y 55 ? y 18 ? ? 6 1 A A 40 1_555 A C 34 1_555 -5.996 -1.413 1.535 18.495 15.933 6.978 13 y_A38:C32_y y 38 ? y 32 ? ? ? 1 A U 41 1_555 A A 33 1_555 -0.116 -0.053 0.075 13.947 -5.069 -0.437 14 y_U39:A31_y y 39 ? y 31 ? 20 1 1 A U 42 1_555 A A 32 1_555 -0.036 -0.115 -0.295 6.201 -6.435 1.697 15 y_U40:A30_y y 40 ? y 30 ? 20 1 1 A C 43 1_555 A G 31 1_555 0.142 -0.112 -0.332 1.868 -2.801 -0.856 16 y_C41:G29_y y 41 ? y 29 ? 19 1 1 A C 44 1_555 A G 30 1_555 0.011 -0.098 -0.249 1.114 -2.196 -1.530 17 y_C42:G28_y y 42 ? y 28 ? 19 1 1 A U 45 1_555 A G 29 1_555 1.973 -0.233 0.066 1.865 -7.014 1.267 18 y_U42A:G27_y y 42 A y 27 ? 28 1 1 A G 47 1_555 A C 28 1_555 -0.104 -0.135 -0.519 -1.558 -6.915 1.449 19 y_G44:C26_y y 44 ? y 26 ? 19 1 1 A U 12 1_555 A A 27 1_555 -0.119 -0.185 -0.353 1.706 0.833 -2.349 20 y_U10:A25_y y 10 ? y 25 ? 20 1 1 A C 13 1_555 A G 26 1_555 0.067 -0.115 -0.222 -1.214 -4.342 -1.528 21 y_C11:G24_y y 11 ? y 24 ? 19 1 1 A U 14 1_555 A A 25 1_555 -0.056 -0.043 0.019 -2.092 -2.835 -3.603 22 y_U12:A23_y y 12 ? y 23 ? 20 1 1 A A 15 1_555 A U 24 1_555 -0.072 -0.027 0.177 -1.419 -7.408 -2.713 23 y_A13:U22_y y 13 ? y 22 ? 20 1 1 A U 16 1_555 A A 23 1_555 0.004 -0.050 0.206 -0.850 -5.970 -1.629 24 y_U14:A21_y y 14 ? y 21 ? 20 1 1 A C 17 1_555 A G 22 1_555 0.092 -0.088 0.274 2.056 -2.731 -1.973 25 y_C15:G20A_y y 15 ? y 20 A 19 1 1 A U 18 1_555 A U 73 1_555 -1.912 -2.630 0.569 -6.402 -7.511 -178.624 26 y_U16:U59_y y 16 ? y 59 ? 13 2 1 A G 20 1_555 A C 70 1_555 -0.736 -0.273 0.015 -9.249 -15.477 -2.027 27 y_G19:C56_y y 19 ? y 56 ? 19 1 1 A A 49 1_555 A U 64 1_555 -0.007 -0.122 -0.774 -5.704 4.208 -6.724 28 y_A46:U48_y y 46 ? y 48 ? 20 1 1 A A 50 1_555 A U 63 1_555 -0.079 -0.080 -0.154 -2.777 -6.166 -1.712 29 y_A47:U47M_y y 47 ? y 47 M 20 1 1 A U 51 1_555 A A 62 1_555 -0.053 -0.169 0.215 -3.885 -10.322 -3.211 30 y_U47A:A47L_y y 47 A y 47 L 20 1 1 A G 52 1_555 A C 61 1_555 -0.053 -0.157 0.518 1.647 2.023 -1.423 31 y_G47B:C47K_y y 47 B y 47 K 19 1 1 A C 53 1_555 A G 60 1_555 0.175 -0.224 0.292 15.760 -0.115 -3.363 32 y_C47C:G47J_y y 47 C y 47 J 19 1 1 A C 54 1_555 A C 59 1_555 -2.800 -0.665 -0.349 9.610 -32.266 2.963 33 y_C47D:C47I_y y 47 D y 47 I ? ? 1 A U 55 1_555 A C 58 1_555 0.669 -1.491 -0.227 -10.730 -25.692 12.033 34 y_U47E:C47H_y y 47 E y 47 H 18 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 86 1_555 A G 2 1_555 A C 85 1_555 -0.462 -1.691 3.220 -2.325 8.184 30.673 -4.470 0.449 2.717 15.110 4.293 31.804 1 yy_G1G2:C71C72_yy y 1 ? y 72 ? y 2 ? y 71 ? 1 A G 2 1_555 A C 85 1_555 A A 3 1_555 A U 84 1_555 -0.233 -1.577 3.194 -0.375 8.398 31.738 -4.116 0.353 2.702 15.029 0.671 32.804 2 yy_G2A3:U70C71_yy y 2 ? y 71 ? y 3 ? y 70 ? 1 A G 6 1_555 A C 82 1_555 A G 7 1_555 A C 80 1_555 -0.780 -3.093 4.671 -4.380 11.449 35.421 -6.782 0.465 3.602 18.160 6.946 37.418 3 yy_G5AG5B:C67AC68_yy y 5 A y 68 ? y 5 B y 67 A 1 A G 7 1_555 A C 80 1_555 A A 8 1_555 A U 79 1_555 0.393 -2.205 3.345 6.939 14.189 40.429 -4.275 0.096 2.501 19.650 -9.610 43.284 4 yy_G5BA6:U67C67A_yy y 5 B y 67 A y 6 ? y 67 ? 1 A A 8 1_555 A U 79 1_555 A A 9 1_555 A U 78 1_555 -0.363 -1.140 3.210 -0.442 7.502 31.377 -3.310 0.580 2.872 13.628 0.802 32.243 5 yy_A6A7:U66U67_yy y 6 ? y 67 ? y 7 ? y 66 ? 1 A A 9 1_555 A U 78 1_555 A G 65 1_555 A C 77 1_555 0.002 -1.458 3.402 0.781 13.046 37.093 -3.679 0.088 2.754 19.771 -1.184 39.252 6 yy_A7G51:C63U66_yy y 7 ? y 66 ? y 51 ? y 63 ? 1 A G 65 1_555 A C 77 1_555 A G 66 1_555 A C 76 1_555 -0.085 -1.668 3.352 -0.423 6.515 35.910 -3.550 0.079 3.014 10.460 0.679 36.479 7 yy_G51G52:C62C63_yy y 51 ? y 63 ? y 52 ? y 62 ? 1 A G 66 1_555 A C 76 1_555 A G 67 1_555 A C 75 1_555 -0.093 -2.154 3.234 -4.765 9.842 30.758 -5.367 -0.575 2.435 17.862 8.648 32.600 8 yy_G52G53:C61C62_yy y 52 ? y 62 ? y 53 ? y 61 ? 1 A G 67 1_555 A C 75 1_555 A U 68 1_555 A A 72 1_555 -2.641 -2.121 3.152 -2.985 -2.221 93.955 -1.411 1.752 3.253 -1.518 2.041 94.012 9 yy_G53U54:A58C61_yy y 53 ? y 61 ? y 54 ? y 58 ? 1 A U 68 1_555 A A 72 1_555 A U 69 1_555 A G 19 1_555 2.585 -2.158 3.509 4.217 3.702 40.530 -3.528 -3.199 3.546 5.313 -6.052 40.901 10 yy_U54U55:G18A58_yy y 54 ? y 58 ? y 55 ? y 18 ? 1 A A 40 1_555 A C 34 1_555 A U 41 1_555 A A 33 1_555 -0.330 -1.034 3.590 3.011 8.201 55.340 -1.607 0.538 3.397 8.769 -3.220 55.971 11 yy_A38U39:A31C32_yy y 38 ? y 32 ? y 39 ? y 31 ? 1 A U 41 1_555 A A 33 1_555 A U 42 1_555 A A 32 1_555 -0.025 -1.837 3.453 0.788 6.566 33.108 -4.232 0.171 3.042 11.381 -1.367 33.744 12 yy_U39U40:A30A31_yy y 39 ? y 31 ? y 40 ? y 30 ? 1 A U 42 1_555 A A 32 1_555 A C 43 1_555 A G 31 1_555 -0.043 -1.669 3.326 0.958 8.013 33.038 -4.084 0.221 2.852 13.835 -1.654 33.983 13 yy_U40C41:G29A30_yy y 40 ? y 30 ? y 41 ? y 29 ? 1 A C 43 1_555 A G 31 1_555 A C 44 1_555 A G 30 1_555 -0.023 -1.887 3.261 0.315 9.609 27.597 -5.631 0.107 2.477 19.412 -0.636 29.193 14 yy_C41C42:G28G29_yy y 41 ? y 29 ? y 42 ? y 28 ? 1 A C 44 1_555 A G 30 1_555 A U 45 1_555 A G 29 1_555 0.326 -1.246 3.381 2.049 3.962 42.789 -2.099 -0.238 3.270 5.413 -2.800 43.010 15 yy_C42U42A:G27G28_yy y 42 ? y 28 ? y 42 A y 27 ? 1 A U 45 1_555 A G 29 1_555 A G 47 1_555 A C 28 1_555 -1.486 -1.156 3.209 7.940 13.526 41.244 -2.681 2.651 2.421 18.420 -10.812 44.004 16 yy_U42AG44:C26G27_yy y 42 A y 27 ? y 44 ? y 26 ? 1 A G 47 1_555 A C 28 1_555 A U 12 1_555 A A 27 1_555 -0.305 -1.863 3.309 -1.015 6.554 28.432 -5.054 0.395 2.826 13.119 2.031 29.180 17 yy_G44U10:A25C26_yy y 44 ? y 26 ? y 10 ? y 25 ? 1 A U 12 1_555 A A 27 1_555 A C 13 1_555 A G 26 1_555 0.082 -1.530 3.327 1.165 3.782 37.325 -2.870 0.023 3.163 5.889 -1.814 37.527 18 yy_U10C11:G24A25_yy y 10 ? y 25 ? y 11 ? y 24 ? 1 A C 13 1_555 A G 26 1_555 A U 14 1_555 A A 25 1_555 -0.440 -1.449 3.300 -1.518 6.524 35.704 -3.213 0.499 3.013 10.526 2.448 36.307 19 yy_C11U12:A23G24_yy y 11 ? y 24 ? y 12 ? y 23 ? 1 A U 14 1_555 A A 25 1_555 A A 15 1_555 A U 24 1_555 0.022 -1.284 3.046 -1.042 16.043 30.965 -4.208 -0.171 2.141 27.821 1.807 34.799 20 yy_U12A13:U22A23_yy y 12 ? y 23 ? y 13 ? y 22 ? 1 A A 15 1_555 A U 24 1_555 A U 16 1_555 A A 23 1_555 -0.036 -1.543 3.347 -1.113 2.754 34.635 -3.006 -0.110 3.218 4.616 1.866 34.758 21 yy_A13U14:A21U22_yy y 13 ? y 22 ? y 14 ? y 21 ? 1 A U 16 1_555 A A 23 1_555 A C 17 1_555 A G 22 1_555 0.145 -1.448 3.175 0.366 5.590 30.410 -3.727 -0.205 2.871 10.544 -0.691 30.910 22 yy_U14C15:G20AA21_yy y 14 ? y 21 ? y 15 ? y 20 A 1 A C 17 1_555 A G 22 1_555 A U 18 1_555 A U 73 1_555 -1.341 -0.265 3.209 -0.766 3.199 126.242 -0.174 0.746 3.210 1.793 0.430 126.265 23 yy_C15U16:U59G20A_yy y 15 ? y 20 A y 16 ? y 59 ? 1 A A 49 1_555 A U 64 1_555 A A 50 1_555 A U 63 1_555 0.924 -1.374 3.173 -4.506 13.318 39.787 -3.142 -1.703 2.494 18.870 6.384 42.103 24 yy_A46A47:U47MU48_yy y 46 ? y 48 ? y 47 ? y 47 M 1 A A 50 1_555 A U 63 1_555 A U 51 1_555 A A 62 1_555 -0.680 -1.491 3.320 -4.406 -0.560 37.816 -2.212 0.467 3.396 -0.860 6.770 38.067 25 yy_A47U47A:A47LU47M_yy y 47 ? y 47 M y 47 A y 47 L 1 A U 51 1_555 A A 62 1_555 A G 52 1_555 A C 61 1_555 0.208 -1.413 3.038 -1.956 2.514 32.515 -2.909 -0.678 2.907 4.476 3.484 32.667 26 yy_U47AG47B:C47KA47L_yy y 47 A y 47 L y 47 B y 47 K 1 A G 52 1_555 A C 61 1_555 A C 53 1_555 A G 60 1_555 -1.041 -1.134 3.172 2.374 7.762 31.009 -3.339 2.280 2.730 14.216 -4.348 32.029 27 yy_G47BC47C:G47JC47K_yy y 47 B y 47 K y 47 C y 47 J 1 A C 53 1_555 A G 60 1_555 A C 54 1_555 A C 59 1_555 0.912 -1.458 2.729 6.492 21.768 25.862 -4.915 -0.819 1.331 40.164 -11.978 34.293 28 yy_C47CC47D:C47IG47J_yy y 47 C y 47 J y 47 D y 47 I 1 A C 54 1_555 A C 59 1_555 A U 55 1_555 A C 58 1_555 -0.685 -1.753 4.393 -6.229 6.013 26.289 -5.580 -0.547 3.957 12.786 13.247 27.654 29 yy_C47DU47E:C47HC47I_yy y 47 D y 47 I y 47 E y 47 H # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' 'R35 GM122560' 1 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' 'R35 GM122560-05S1' 2 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' GM51266 3 'National Institutes of Health/National Institute Of Allergy and Infectious Diseases (NIH/NIAID)' 'United States' AI15046 4 'Department of Energy (DOE, United States)' 'United States' DE-FG0298ER2031 5 'Cystic Fibrosis Foundation' 'United States' PUGLIS20G0 6 # _atom_sites.entry_id 7URI _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C N O P # loop_