data_8BWT # _entry.id 8BWT # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.395 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8BWT pdb_00008bwt 10.2210/pdb8bwt/pdb WWPDB D_1292126851 ? ? BMRB 34777 ? 10.13018/BMR34777 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-08-30 2 'Structure model' 1 1 2024-06-19 3 'Structure model' 1 2 2024-07-03 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 2 'Structure model' database_2 4 3 'Structure model' citation # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_ASTM' 4 2 'Structure model' '_citation.journal_id_CSD' 5 2 'Structure model' '_citation.journal_id_ISSN' 6 2 'Structure model' '_citation.pdbx_database_id_DOI' 7 2 'Structure model' '_citation.pdbx_database_id_PubMed' 8 2 'Structure model' '_citation.title' 9 2 'Structure model' '_citation.year' 10 2 'Structure model' '_database_2.pdbx_DOI' 11 3 'Structure model' '_citation.journal_volume' 12 3 'Structure model' '_citation.page_first' 13 3 'Structure model' '_citation.page_last' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.entry_id 8BWT _pdbx_database_status.recvd_initial_deposition_date 2022-12-07 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.status_code_cs REL _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name BMRB _pdbx_database_related.details ;Structure of a symmetrical internal loop motif with three consecutive U:U mismatches from stem-loop 1 in the 3'-UTR of the SARS-CoV2 genomic RNA ; _pdbx_database_related.db_id 34777 _pdbx_database_related.content_type unspecified # _pdbx_contact_author.id 3 _pdbx_contact_author.email woehnert@bio.uni-frankfurt.de _pdbx_contact_author.name_first Jens _pdbx_contact_author.name_last Woehnert _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0001-7193-401X # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Voegele, J.' 1 ? 'Duchardt-Ferner, E.' 2 ? 'Schwalbe, H.' 3 ? 'Woehnert, J.' 4 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 52 _citation.language ? _citation.page_first 6687 _citation.page_last 6706 _citation.title ;Structure of an internal loop motif with three consecutive U•U mismatches from stem-loop 1 in the 3'-UTR of the SARS-CoV-2 genomic RNA. ; _citation.year 2024 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkae349 _citation.pdbx_database_id_PubMed 38783391 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Vogele, J.' 1 ? primary 'Duchardt-Ferner, E.' 2 0000-0001-7521-8264 primary 'Bains, J.K.' 3 ? primary 'Knezic, B.' 4 ? primary 'Wacker, A.' 5 ? primary 'Sich, C.' 6 ? primary 'Weigand, J.E.' 7 0000-0003-4247-1348 primary 'Sponer, J.' 8 ? primary 'Schwalbe, H.' 9 0000-0001-5693-7909 primary 'Krepl, M.' 10 0000-0002-9833-4281 primary 'Wohnert, J.' 11 0000-0001-7193-401X # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (26-MER)' _entity.formula_weight 8242.842 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCGUUUUCGCUUCGGCGUUUACGCC _entity_poly.pdbx_seq_one_letter_code_can GGCGUUUUCGCUUCGGCGUUUACGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 G n 1 5 U n 1 6 U n 1 7 U n 1 8 U n 1 9 C n 1 10 G n 1 11 C n 1 12 U n 1 13 U n 1 14 C n 1 15 G n 1 16 G n 1 17 C n 1 18 G n 1 19 U n 1 20 U n 1 21 U n 1 22 A n 1 23 C n 1 24 G n 1 25 C n 1 26 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 26 _pdbx_entity_src_syn.organism_scientific 'Severe acute respiratory syndrome coronavirus 2' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 2697049 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 U 5 5 5 U U A . n A 1 6 U 6 6 6 U U A . n A 1 7 U 7 7 7 U U A . n A 1 8 U 8 8 8 U U A . n A 1 9 C 9 9 9 C C A . n A 1 10 G 10 10 10 G G A . n A 1 11 C 11 11 11 C C A . n A 1 12 U 12 12 12 U U A . n A 1 13 U 13 13 13 U U A . n A 1 14 C 14 14 14 C C A . n A 1 15 G 15 15 15 G G A . n A 1 16 G 16 16 16 G G A . n A 1 17 C 17 17 17 C C A . n A 1 18 G 18 18 18 G G A . n A 1 19 U 19 19 19 U U A . n A 1 20 U 20 20 20 U U A . n A 1 21 U 21 21 21 U U A . n A 1 22 A 22 22 22 A A A . n A 1 23 C 23 23 23 C C A . n A 1 24 G 24 24 24 G G A . n A 1 25 C 25 25 25 C C A . n A 1 26 C 26 26 26 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8BWT _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 8BWT _struct.title ;Structure of a symmetrical internal loop motif with three consecutive U:U mismatches from stem-loop 1 in the 3'-UTR of the SARS-CoV2 genomic RNA ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8BWT _struct_keywords.text ;RNA structure, U:U mismatch, SARS-CoV-2, 3'-UTR, RNA ; _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8BWT _struct_ref.pdbx_db_accession 8BWT _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8BWT _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 26 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 8BWT _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 26 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 26 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 26 N3 ? ? A G 1 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 26 O2 ? ? A G 1 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 26 N4 ? ? A G 1 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 25 N3 ? ? A G 2 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 25 O2 ? ? A G 2 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 25 N4 ? ? A G 2 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 24 N1 ? ? A C 3 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 24 O6 ? ? A C 3 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 24 N2 ? ? A C 3 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 4 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 4 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 4 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 22 N1 ? ? A U 5 A A 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 22 N6 ? ? A U 5 A A 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 6 N3 ? ? ? 1_555 A U 21 O4 ? ? A U 6 A U 21 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog16 hydrog ? ? A U 6 O2 ? ? ? 1_555 A U 21 N3 ? ? A U 6 A U 21 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog17 hydrog ? ? A U 7 N3 ? ? ? 1_555 A U 20 O2 ? ? A U 7 A U 20 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog18 hydrog ? ? A U 7 O4 ? ? ? 1_555 A U 20 N3 ? ? A U 7 A U 20 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog19 hydrog ? ? A U 8 N3 ? ? ? 1_555 A U 19 O2 ? ? A U 8 A U 19 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog20 hydrog ? ? A U 8 O4 ? ? ? 1_555 A U 19 N3 ? ? A U 8 A U 19 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog21 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 18 N1 ? ? A C 9 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 18 O6 ? ? A C 9 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 18 N2 ? ? A C 9 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 17 N3 ? ? A G 10 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 17 O2 ? ? A G 10 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 17 N4 ? ? A G 10 A C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 16 N1 ? ? A C 11 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 16 O6 ? ? A C 11 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 16 N2 ? ? A C 11 A G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 12 O2 ? ? ? 1_555 A G 15 N1 ? ? A U 12 A G 15 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_nmr_ensemble.entry_id 8BWT _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 8BWT _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 '830 uM RNA (26-MER), 25 mM potassium phosphate, 50 mM potassium chloride, 5 % D2O, 95% H2O/5% D2O' '95% H2O/5% D2O' 'natural abundance' solution ? 2 '1 mM 13C,15N-A,U RNA (26-MER), 25 mM potassium phosphate, 50 mM potassium chloride, 5 % D2O, 95% H2O/5% D2O' '95% H2O/5% D2O' 13C,15N-A,U solution ? 3 '1 mM 13C,15N-A,U RNA (26-MER), 25 mM potassium phosphate, 50 mM potassium chloride, 100 % D2O, 100% D2O' '100% D2O' 13C,15N-A,U solution ? # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 'RNA (26-MER)' 830 ? uM 'natural abundance' 1 'potassium phosphate' 25 ? mM 'natural abundance' 1 'potassium chloride' 50 ? mM 'natural abundance' 1 D2O 5 ? % 'natural abundance' 2 'RNA (26-MER)' 1 ? mM 13C,15N-A,U 2 'potassium phosphate' 25 ? mM 'natural abundance' 2 'potassium chloride' 50 ? mM 'natural abundance' 2 D2O 5 ? % 'natural abundance' 3 'RNA (26-MER)' 1 ? mM 13C,15N-A,U 3 'potassium phosphate' 25 ? mM 'natural abundance' 3 'potassium chloride' 50 ? mM 'natural abundance' 3 D2O 100 ? % 'natural abundance' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.details _pdbx_nmr_exptl_sample_conditions.ionic_strength_err _pdbx_nmr_exptl_sample_conditions.ionic_strength_units _pdbx_nmr_exptl_sample_conditions.label _pdbx_nmr_exptl_sample_conditions.pH_err _pdbx_nmr_exptl_sample_conditions.pH_units _pdbx_nmr_exptl_sample_conditions.pressure_err _pdbx_nmr_exptl_sample_conditions.temperature_err _pdbx_nmr_exptl_sample_conditions.temperature_units 1 283 atm 1 6.2 50 ? ? mM conditions_1_283K ? pH ? ? K 2 298 atm 1 6.2 50 ? ? mM conditions_2_298K ? pH ? ? K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 2 '2D 1H-15N HSQC' 4 isotropic 2 1 1 '2D 1H-1H NOESY' 3 isotropic 3 1 2 '2D 1H-13C HSQC aromatic' 4 isotropic 4 1 2 '2D 1H-13C HSQC aliphatic' 4 isotropic 5 1 3 '2D 1H-13C HSQC aliphatic' 1 isotropic 6 1 2 '2D 1H-15N HSQC NH2 only' 4 isotropic 7 1 2 'H56C56(C4N3)H optimized for H56' 1 isotropic 8 1 2 'H56C56(C4N3)H optimized for C56' 1 isotropic 9 1 3 'H(C)N aromatic' 1 isotropic 10 1 3 'H(C)N aliphatic' 1 isotropic 11 2 3 'H(C)P-CCH-TOCSY' 2 isotropic 12 1 2 'H(N)CO' 1 isotropic 13 1 3 '3D HCCH-COSY' 1 isotropic 14 1 3 '3D HCCH-TOCSY' 1 isotropic 15 1 3 HCC-TOCSY-CCH-E.COSY 1 isotropic 17 1 2 '3D 1H-13C NOESY aliphatic' 4 isotropic 16 1 2 '3D 1H-13C NOESY aromatic' 4 isotropic 19 1 3 '3D 1H-13C NOESY aliphatic' 1 isotropic 18 1 3 '3D 1H-13C NOESY aromatic' 1 isotropic # _pdbx_nmr_refine.entry_id 8BWT _pdbx_nmr_refine.method 'distance geometry' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 2 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 'chemical shift assignment' CARA ? 'Keller and Wuthrich' 2 'structure calculation' CYANA ? 'Guntert, Mumenthaler and Wuthrich' 3 collection TopSpin ? 'Bruker Biospin' 4 'peak picking' CARA ? 'Keller and Wuthrich' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8BWT 'double helix' 8BWT 'a-form double helix' 8BWT tetraloop 8BWT 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 26 1_555 -0.628 -0.332 0.536 3.945 -18.440 -4.694 1 A_G1:C26_A A 1 ? A 26 ? 19 1 1 A G 2 1_555 A C 25 1_555 -0.311 -0.384 0.917 -0.355 -16.020 -8.379 2 A_G2:C25_A A 2 ? A 25 ? 19 1 1 A C 3 1_555 A G 24 1_555 -0.333 -0.269 0.847 -1.492 -18.076 -8.844 3 A_C3:G24_A A 3 ? A 24 ? 19 1 1 A G 4 1_555 A C 23 1_555 0.415 -0.203 0.700 5.651 -17.705 -7.104 4 A_G4:C23_A A 4 ? A 23 ? 19 1 1 A U 5 1_555 A A 22 1_555 -0.110 -0.199 0.667 18.513 -3.475 -3.449 5 A_U5:A22_A A 5 ? A 22 ? 20 1 1 A U 6 1_555 A U 21 1_555 1.754 -1.731 0.258 24.296 -25.857 11.495 6 A_U6:U21_A A 6 ? A 21 ? 16 1 1 A U 7 1_555 A U 20 1_555 -1.666 -1.820 -0.272 -12.772 -10.297 10.032 7 A_U7:U20_A A 7 ? A 20 ? 16 1 1 A U 8 1_555 A U 19 1_555 -1.730 -1.839 0.421 -1.106 -15.069 7.744 8 A_U8:U19_A A 8 ? A 19 ? 16 1 1 A C 9 1_555 A G 18 1_555 -0.453 -0.019 0.172 17.659 -7.742 -1.212 9 A_C9:G18_A A 9 ? A 18 ? 19 1 1 A G 10 1_555 A C 17 1_555 0.190 -0.140 -0.219 2.942 -13.688 -1.530 10 A_G10:C17_A A 10 ? A 17 ? 19 1 1 A C 11 1_555 A G 16 1_555 0.678 -0.277 -0.288 -10.348 -17.592 5.917 11 A_C11:G16_A A 11 ? A 16 ? 19 1 1 A U 12 1_555 A G 15 1_555 0.440 -5.773 0.300 -6.283 -8.910 -106.480 12 A_U12:G15_A A 12 ? A 15 ? ? 6 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 26 1_555 A G 2 1_555 A C 25 1_555 0.204 -1.091 3.838 -10.700 31.696 35.077 -4.009 -1.152 2.098 42.561 14.369 48.106 1 AA_G1G2:C25C26_AA A 1 ? A 26 ? A 2 ? A 25 ? 1 A G 2 1_555 A C 25 1_555 A C 3 1_555 A G 24 1_555 0.072 -1.999 3.165 0.349 10.892 36.233 -4.326 -0.072 2.483 17.045 -0.547 37.783 2 AA_G2C3:G24C25_AA A 2 ? A 25 ? A 3 ? A 24 ? 1 A C 3 1_555 A G 24 1_555 A G 4 1_555 A C 23 1_555 -0.021 -1.599 2.638 -0.203 8.266 37.224 -3.242 0.013 2.245 12.757 0.314 38.099 3 AA_C3G4:C23G24_AA A 3 ? A 24 ? A 4 ? A 23 ? 1 A G 4 1_555 A C 23 1_555 A U 5 1_555 A A 22 1_555 0.478 -1.678 2.893 2.900 11.849 31.615 -4.419 -0.446 2.176 20.804 -5.092 33.831 4 AA_G4U5:A22C23_AA A 4 ? A 23 ? A 5 ? A 22 ? 1 A U 5 1_555 A A 22 1_555 A U 6 1_555 A U 21 1_555 1.077 -1.318 3.246 5.840 4.936 37.958 -2.591 -0.914 3.182 7.496 -8.868 38.693 5 AA_U5U6:U21A22_AA A 5 ? A 22 ? A 6 ? A 21 ? 1 A U 6 1_555 A U 21 1_555 A U 7 1_555 A U 20 1_555 0.213 -2.798 3.608 5.871 31.067 25.863 -6.569 0.173 0.254 50.779 -9.595 40.637 6 AA_U6U7:U20U21_AA A 6 ? A 21 ? A 7 ? A 20 ? 1 A U 7 1_555 A U 20 1_555 A U 8 1_555 A U 19 1_555 0.073 -0.766 3.368 -2.265 11.743 24.774 -4.445 -0.701 2.715 25.556 4.930 27.469 7 AA_U7U8:U19U20_AA A 7 ? A 20 ? A 8 ? A 19 ? 1 A U 8 1_555 A U 19 1_555 A C 9 1_555 A G 18 1_555 -1.282 -1.688 2.777 -0.110 8.734 27.005 -5.000 2.598 2.141 18.110 0.229 28.357 8 AA_U8C9:G18U19_AA A 8 ? A 19 ? A 9 ? A 18 ? 1 A C 9 1_555 A G 18 1_555 A G 10 1_555 A C 17 1_555 -0.116 -1.261 3.752 -0.917 34.117 32.353 -4.485 0.068 1.743 47.757 1.283 46.693 9 AA_C9G10:C17G18_AA A 9 ? A 18 ? A 10 ? A 17 ? 1 A G 10 1_555 A C 17 1_555 A C 11 1_555 A G 16 1_555 0.037 -1.166 3.496 2.581 26.853 31.290 -4.455 0.216 1.946 41.461 -3.985 41.092 10 AA_G10C11:G16C17_AA A 10 ? A 17 ? A 11 ? A 16 ? 1 A C 11 1_555 A G 16 1_555 A U 12 1_555 A G 15 1_555 -0.911 -1.091 3.464 2.458 8.063 102.514 -0.821 0.620 3.381 5.163 -1.574 102.763 11 AA_C11U12:G15G16_AA A 11 ? A 16 ? A 12 ? A 15 ? # _pdbx_audit_support.funding_organization 'German Research Foundation (DFG)' _pdbx_audit_support.country Germany _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 AVANCE ? Bruker 600 ? 2 AVANCE ? Bruker 700 ? 3 AVANCE ? Bruker 800 ? 4 AVANCE ? Bruker 900 ? # _atom_sites.entry_id 8BWT _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_ #