data_8CS2 # _entry.id 8CS2 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.380 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8CS2 pdb_00008cs2 10.2210/pdb8cs2/pdb WWPDB D_1000265362 ? ? # _pdbx_database_related.db_name PDB _pdbx_database_related.details 'Sticky end A replaced by 1AP' _pdbx_database_related.db_id 7R96 _pdbx_database_related.content_type unspecified # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8CS2 _pdbx_database_status.recvd_initial_deposition_date 2022-05-12 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Lu, B.' 1 0000-0001-6424-2197 'Vecchioni, S.' 2 0000-0001-8243-650X 'Ohayon, Y.P.' 3 0000-0001-7500-4282 'Seeman, N.C.' 4 0000-0002-9680-4649 'Mao, C.' 5 0000-0001-7516-8666 'Sha, R.' 6 0000-0002-0807-734X # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country GE _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Angew.Chem.Int.Ed.Engl. _citation.journal_id_ASTM ACIEAY _citation.journal_id_CSD 0179 _citation.journal_id_ISSN 1521-3773 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 62 _citation.language ? _citation.page_first e202213451 _citation.page_last e202213451 _citation.title 'Programmable 3D Hexagonal Geometry of DNA Tensegrity Triangles.' _citation.year 2023 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1002/anie.202213451 _citation.pdbx_database_id_PubMed 36520622 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Lu, B.' 1 ? primary 'Woloszyn, K.' 2 ? primary 'Ohayon, Y.P.' 3 ? primary 'Yang, B.' 4 ? primary 'Zhang, C.' 5 ? primary 'Mao, C.' 6 ? primary 'Seeman, N.C.' 7 ? primary 'Vecchioni, S.' 8 ? primary 'Sha, R.' 9 0000-0002-0807-734X # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 8CS2 _cell.details ? _cell.formula_units_Z ? _cell.length_a 123.973 _cell.length_a_esd ? _cell.length_b 123.973 _cell.length_b_esd ? _cell.length_c 64.153 _cell.length_c_esd ? _cell.volume 853889.795 _cell.volume_esd ? _cell.Z_PDB 6 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8CS2 _symmetry.cell_setting ? _symmetry.Int_Tables_number 173 _symmetry.space_group_name_Hall 'P 6c' _symmetry.space_group_name_H-M 'P 63' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*(1AP)P*GP*GP*CP*AP*GP*CP*CP*TP*GP*TP*AP*CP*GP*GP*AP*CP*AP*TP*CP*A)-3') ; 6472.201 1 ? ? ? ? 2 polymer syn ;DNA (5'-D(P*CP*CP*GP*TP*AP*CP*A)-3') ; 2082.400 1 ? ? ? ? 3 polymer syn ;DNA (5'-D(P*GP*GP*CP*TP*GP*C)-3') ; 1825.216 1 ? ? ? ? 4 polymer syn ;DNA (5'-D(*TP*CP*TP*GP*AP*TP*GP*T)-3') ; 2432.614 1 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no yes ;(1AP)(DG)(DG)(DC)(DA)(DG)(DC)(DC)(DT)(DG)(DT)(DA)(DC)(DG)(DG)(DA)(DC)(DA)(DT) (DC)(DA) ; AGGCAGCCTGTACGGACATCA A ? 2 polydeoxyribonucleotide no no '(DC)(DC)(DG)(DT)(DA)(DC)(DA)' CCGTACA B ? 3 polydeoxyribonucleotide no no '(DG)(DG)(DC)(DT)(DG)(DC)' GGCTGC C ? 4 polydeoxyribonucleotide no no '(DT)(DC)(DT)(DG)(DA)(DT)(DG)(DT)' TCTGATGT D ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 1AP n 1 2 DG n 1 3 DG n 1 4 DC n 1 5 DA n 1 6 DG n 1 7 DC n 1 8 DC n 1 9 DT n 1 10 DG n 1 11 DT n 1 12 DA n 1 13 DC n 1 14 DG n 1 15 DG n 1 16 DA n 1 17 DC n 1 18 DA n 1 19 DT n 1 20 DC n 1 21 DA n 2 1 DC n 2 2 DC n 2 3 DG n 2 4 DT n 2 5 DA n 2 6 DC n 2 7 DA n 3 1 DG n 3 2 DG n 3 3 DC n 3 4 DT n 3 5 DG n 3 6 DC n 4 1 DT n 4 2 DC n 4 3 DT n 4 4 DG n 4 5 DA n 4 6 DT n 4 7 DG n 4 8 DT n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 21 'synthetic construct' ? 32630 ? 2 1 sample 1 7 'synthetic construct' ? 32630 ? 3 1 sample 1 6 'synthetic construct' ? 32630 ? 4 1 sample 1 8 'synthetic construct' ? 32630 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 8CS2 8CS2 ? 1 ? 1 2 PDB 8CS2 8CS2 ? 2 ? 1 3 PDB 8CS2 8CS2 ? 3 ? 1 4 PDB 8CS2 8CS2 ? 4 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 8CS2 A 1 ? 21 ? 8CS2 101 ? 121 ? 101 121 2 2 8CS2 B 1 ? 7 ? 8CS2 119 ? 125 ? 119 125 3 3 8CS2 C 1 ? 6 ? 8CS2 209 ? 214 ? 209 214 4 4 8CS2 D 1 ? 8 ? 8CS2 201 ? 208 ? 201 208 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 1AP 'DNA linking' n '2,6-DIAMINOPURINE NUCLEOTIDE' ? 'C10 H15 N6 O6 P' 346.236 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8CS2 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 9.5 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp 293 _exptl_crystal_grow.temp_details '338-293 at 0.4/hr' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '1.83 M ammonium sulfate, 120 mM Tris, 120 mM Acetic Acid, 6 mM EDTA' _exptl_crystal_grow.pdbx_pH_range ? # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER2 X 9M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2021-02-21 _diffrn_detector.pdbx_frequency ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.00743 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 17-ID' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.00743 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 17-ID _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate 191.51 _reflns.entry_id 8CS2 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 6.00 _reflns.d_resolution_low 61.99 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 1198 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 89.8 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 19.5 _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 11.6 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 1.000 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? _reflns.pdbx_CC_split_method ? # _reflns_shell.d_res_high 6.00 _reflns_shell.d_res_low 6.75 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 200 _reflns_shell.percent_possible_all ? _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.117 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 627.06 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8CS2 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 6.00 _refine.ls_d_res_low 41.17 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 1133 _refine.ls_number_reflns_R_free 58 _refine.ls_number_reflns_R_work 1075 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 76.35 _refine.ls_percent_reflns_R_free 5.12 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.1149 _refine.ls_R_factor_R_free 0.1997 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1114 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 7R96 _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 26.8757 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.0000 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 6.00 _refine_hist.d_res_low 41.17 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 856 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 856 _refine_hist.pdbx_number_atoms_ligand 0 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0221 ? 957 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.9181 ? 1469 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.1133 ? 166 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0121 ? 42 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 38.5248 ? 400 ? f_dihedral_angle_d ? ? # _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.d_res_high 6.00 _refine_ls_shell.d_res_low 41.17 _refine_ls_shell.number_reflns_all ? _refine_ls_shell.number_reflns_obs ? _refine_ls_shell.number_reflns_R_free 58 _refine_ls_shell.number_reflns_R_work 1075 _refine_ls_shell.percent_reflns_obs 76.35 _refine_ls_shell.percent_reflns_R_free ? _refine_ls_shell.R_factor_all ? _refine_ls_shell.R_factor_obs ? _refine_ls_shell.R_factor_R_free 0.1997 _refine_ls_shell.R_factor_R_free_error ? _refine_ls_shell.R_factor_R_work 0.1114 _refine_ls_shell.redundancy_reflns_all ? _refine_ls_shell.redundancy_reflns_obs ? _refine_ls_shell.wR_factor_all ? _refine_ls_shell.wR_factor_obs ? _refine_ls_shell.wR_factor_R_free ? _refine_ls_shell.wR_factor_R_work ? _refine_ls_shell.pdbx_R_complete ? _refine_ls_shell.pdbx_total_number_of_bins_used ? _refine_ls_shell.pdbx_phase_error ? _refine_ls_shell.pdbx_fsc_work ? _refine_ls_shell.pdbx_fsc_free ? # _struct.entry_id 8CS2 _struct.title '[(1AP)G/TC] Self-Assembled 3D DNA Hexagonal Tensegrity Triangle' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8CS2 _struct_keywords.text 'tensegrity triangle, synthetic construct, self-assembly, DNA' _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale one ? A 1AP 1 "O3'" ? ? ? 1_555 A DG 2 P ? ? A 1AP 101 A DG 102 1_555 ? ? ? ? ? ? ? 1.629 ? ? covale2 covale none ? A 1AP 1 N6 ? ? ? 1_555 D DC 2 O2 ? ? A 1AP 101 D DC 202 6_554 ? ? ? ? ? ? ? 1.301 ? ? hydrog1 hydrog ? ? A DG 3 N1 ? ? ? 1_555 C DC 6 N3 ? ? A DG 103 C DC 214 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DG 3 N2 ? ? ? 1_555 C DC 6 O2 ? ? A DG 103 C DC 214 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DG 3 O6 ? ? ? 1_555 C DC 6 N4 ? ? A DG 103 C DC 214 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DC 4 N3 ? ? ? 1_555 C DG 5 N1 ? ? A DC 104 C DG 213 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DC 4 N4 ? ? ? 1_555 C DG 5 O6 ? ? A DC 104 C DG 213 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DC 4 O2 ? ? ? 1_555 C DG 5 N2 ? ? A DC 104 C DG 213 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DA 5 N1 ? ? ? 1_555 C DT 4 N3 ? ? A DA 105 C DT 212 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DA 5 N6 ? ? ? 1_555 C DT 4 O4 ? ? A DA 105 C DT 212 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DG 6 N1 ? ? ? 1_555 C DC 3 N3 ? ? A DG 106 C DC 211 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DG 6 N2 ? ? ? 1_555 C DC 3 O2 ? ? A DG 106 C DC 211 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DG 6 O6 ? ? ? 1_555 C DC 3 N4 ? ? A DG 106 C DC 211 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DC 7 N3 ? ? ? 1_555 C DG 2 N2 ? ? A DC 107 C DG 210 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog13 hydrog ? ? A DC 7 O2 ? ? ? 1_555 C DG 2 N1 ? ? A DC 107 C DG 210 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog14 hydrog ? ? A DC 8 N3 ? ? ? 1_555 C DG 1 N2 ? ? A DC 108 C DG 209 1_555 ? ? ? ? ? ? 'DC-DG PAIR' ? ? ? hydrog15 hydrog ? ? A DT 9 N3 ? ? ? 1_555 B DA 7 N1 ? ? A DT 109 B DA 125 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DT 9 O4 ? ? ? 1_555 B DA 7 N6 ? ? A DT 109 B DA 125 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DG 10 N1 ? ? ? 1_555 B DC 6 N3 ? ? A DG 110 B DC 124 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DG 10 N2 ? ? ? 1_555 B DC 6 O2 ? ? A DG 110 B DC 124 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DG 10 O6 ? ? ? 1_555 B DC 6 N4 ? ? A DG 110 B DC 124 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DG 10 N1 ? ? ? 1_555 B DA 7 N1 ? ? A DG 110 B DA 125 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog21 hydrog ? ? A DG 10 O6 ? ? ? 1_555 B DA 7 N6 ? ? A DG 110 B DA 125 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog22 hydrog ? ? A DT 11 N3 ? ? ? 1_555 B DA 5 N1 ? ? A DT 111 B DA 123 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DT 11 O4 ? ? ? 1_555 B DA 5 N6 ? ? A DT 111 B DA 123 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DA 12 N1 ? ? ? 1_555 B DT 4 N3 ? ? A DA 112 B DT 122 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DA 12 N6 ? ? ? 1_555 B DT 4 O4 ? ? A DA 112 B DT 122 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DC 13 N3 ? ? ? 1_555 B DG 3 N1 ? ? A DC 113 B DG 121 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DC 13 N4 ? ? ? 1_555 B DG 3 O6 ? ? A DC 113 B DG 121 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DC 13 O2 ? ? ? 1_555 B DG 3 N2 ? ? A DC 113 B DG 121 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DG 15 N1 ? ? ? 1_555 B DC 1 N3 ? ? A DG 115 B DC 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A DG 15 N2 ? ? ? 1_555 B DC 1 O2 ? ? A DG 115 B DC 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A DG 15 O6 ? ? ? 1_555 B DC 1 N4 ? ? A DG 115 B DC 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A DA 16 N1 ? ? ? 1_555 D DT 8 N3 ? ? A DA 116 D DT 208 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DA 16 N6 ? ? ? 1_555 D DT 8 O4 ? ? A DA 116 D DT 208 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DC 17 N3 ? ? ? 1_555 D DG 7 N1 ? ? A DC 117 D DG 207 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DC 17 N4 ? ? ? 1_555 D DG 7 O6 ? ? A DC 117 D DG 207 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DC 17 O2 ? ? ? 1_555 D DG 7 N2 ? ? A DC 117 D DG 207 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DA 18 N1 ? ? ? 1_555 D DT 6 N3 ? ? A DA 118 D DT 206 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DA 18 N6 ? ? ? 1_555 D DT 6 O4 ? ? A DA 118 D DT 206 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DT 19 N3 ? ? ? 1_555 D DA 5 N1 ? ? A DT 119 D DA 205 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DT 19 O4 ? ? ? 1_555 D DA 5 N6 ? ? A DT 119 D DA 205 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DC 20 N3 ? ? ? 1_555 D DG 4 N1 ? ? A DC 120 D DG 204 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DC 20 N4 ? ? ? 1_555 D DG 4 O6 ? ? A DC 120 D DG 204 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DC 20 O2 ? ? ? 1_555 D DG 4 N2 ? ? A DC 120 D DG 204 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DA 21 N1 ? ? ? 1_555 D DT 3 N3 ? ? A DA 121 D DT 203 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A DA 21 N6 ? ? ? 1_555 D DT 3 O4 ? ? A DA 121 D DT 203 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A DA 21 N1 ? ? ? 1_555 D DG 4 N1 ? ? A DA 121 D DG 204 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog47 hydrog ? ? A DA 21 N6 ? ? ? 1_555 D DG 4 O6 ? ? A DA 121 D DG 204 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _atom_sites.entry_id 8CS2 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.008066 _atom_sites.fract_transf_matrix[1][2] 0.004657 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.009314 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.015588 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source C ? ? 5.96793 ? ? ? 14.89577 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 6.96715 ? ? ? 11.43723 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 7.96527 ? ? ? 9.05267 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 14.90797 ? ? ? 11.91318 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 1AP 1 101 101 1AP 1AP A . n A 1 2 DG 2 102 102 DG DG A . n A 1 3 DG 3 103 103 DG DG A . n A 1 4 DC 4 104 104 DC DC A . n A 1 5 DA 5 105 105 DA DA A . n A 1 6 DG 6 106 106 DG DG A . n A 1 7 DC 7 107 107 DC DC A . n A 1 8 DC 8 108 108 DC DC A . n A 1 9 DT 9 109 109 DT DT A . n A 1 10 DG 10 110 110 DG DG A . n A 1 11 DT 11 111 111 DT DT A . n A 1 12 DA 12 112 112 DA DA A . n A 1 13 DC 13 113 113 DC DC A . n A 1 14 DG 14 114 114 DG DG A . n A 1 15 DG 15 115 115 DG DG A . n A 1 16 DA 16 116 116 DA DA A . n A 1 17 DC 17 117 117 DC DC A . n A 1 18 DA 18 118 118 DA DA A . n A 1 19 DT 19 119 119 DT DT A . n A 1 20 DC 20 120 120 DC DC A . n A 1 21 DA 21 121 121 DA DA A . n B 2 1 DC 1 119 119 DC DC B . n B 2 2 DC 2 120 120 DC DC B . n B 2 3 DG 3 121 121 DG DG B . n B 2 4 DT 4 122 122 DT DT B . n B 2 5 DA 5 123 123 DA DA B . n B 2 6 DC 6 124 124 DC DC B . n B 2 7 DA 7 125 125 DA DA B . n C 3 1 DG 1 209 209 DG DG C . n C 3 2 DG 2 210 210 DG DG C . n C 3 3 DC 3 211 211 DC DC C . n C 3 4 DT 4 212 212 DT DT C . n C 3 5 DG 5 213 213 DG DG C . n C 3 6 DC 6 214 214 DC DC C . n D 4 1 DT 1 201 201 DT DT D . n D 4 2 DC 2 202 202 DC DC D . n D 4 3 DT 3 203 203 DT DT D . n D 4 4 DG 4 204 204 DG DG D . n D 4 5 DA 5 205 205 DA DA D . n D 4 6 DT 6 206 206 DT DT D . n D 4 7 DG 7 207 207 DG DG D . n D 4 8 DT 8 208 208 DT DT D . n # _pdbx_contact_author.id 2 _pdbx_contact_author.email ruojie.sha@nyu.edu _pdbx_contact_author.name_first Ruojie _pdbx_contact_author.name_last Sha _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-0807-734X # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dodecameric _pdbx_struct_assembly.oligomeric_count 12 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1,2,3 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D # loop_ _pdbx_struct_oper_list.id _pdbx_struct_oper_list.type _pdbx_struct_oper_list.name _pdbx_struct_oper_list.symmetry_operation _pdbx_struct_oper_list.matrix[1][1] _pdbx_struct_oper_list.matrix[1][2] _pdbx_struct_oper_list.matrix[1][3] _pdbx_struct_oper_list.vector[1] _pdbx_struct_oper_list.matrix[2][1] _pdbx_struct_oper_list.matrix[2][2] _pdbx_struct_oper_list.matrix[2][3] _pdbx_struct_oper_list.vector[2] _pdbx_struct_oper_list.matrix[3][1] _pdbx_struct_oper_list.matrix[3][2] _pdbx_struct_oper_list.matrix[3][3] _pdbx_struct_oper_list.vector[3] 1 'identity operation' 1_555 x,y,z 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 2 'crystal symmetry operation' 2_545 -y,x-y-1,z -0.5000000000 -0.8660254038 0.0000000000 61.9865000000 0.8660254038 -0.5000000000 0.0000000000 -107.3637673834 0.0000000000 0.0000000000 1.0000000000 0.0000000000 3 'crystal symmetry operation' 3_655 -x+y+1,-x,z -0.5000000000 0.8660254038 0.0000000000 123.9730000000 -0.8660254038 -0.5000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-01-11 2 'Structure model' 1 1 2023-01-18 3 'Structure model' 1 2 2023-02-08 4 'Structure model' 1 3 2023-10-25 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' 3 4 'Structure model' 'Data collection' 4 4 'Structure model' 'Refinement description' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' citation 4 4 'Structure model' chem_comp_atom 5 4 'Structure model' chem_comp_bond 6 4 'Structure model' pdbx_initial_refinement_model # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.page_first' 2 2 'Structure model' '_citation.page_last' 3 2 'Structure model' '_citation_author.identifier_ORCID' 4 3 'Structure model' '_citation.journal_volume' 5 3 'Structure model' '_citation.year' # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 x-y,x,z+1/2 3 y,-x+y,z+1/2 4 -y,x-y,z 5 -x+y,-x,z 6 -x,-y,z+1/2 # loop_ _pdbx_refine_tls.id _pdbx_refine_tls.pdbx_refine_id _pdbx_refine_tls.details _pdbx_refine_tls.method _pdbx_refine_tls.origin_x _pdbx_refine_tls.origin_y _pdbx_refine_tls.origin_z _pdbx_refine_tls.T[1][1] _pdbx_refine_tls.T[1][1]_esd _pdbx_refine_tls.T[1][2] _pdbx_refine_tls.T[1][2]_esd _pdbx_refine_tls.T[1][3] _pdbx_refine_tls.T[1][3]_esd _pdbx_refine_tls.T[2][2] _pdbx_refine_tls.T[2][2]_esd _pdbx_refine_tls.T[2][3] _pdbx_refine_tls.T[2][3]_esd _pdbx_refine_tls.T[3][3] _pdbx_refine_tls.T[3][3]_esd _pdbx_refine_tls.L[1][1] _pdbx_refine_tls.L[1][1]_esd _pdbx_refine_tls.L[1][2] _pdbx_refine_tls.L[1][2]_esd _pdbx_refine_tls.L[1][3] _pdbx_refine_tls.L[1][3]_esd _pdbx_refine_tls.L[2][2] _pdbx_refine_tls.L[2][2]_esd _pdbx_refine_tls.L[2][3] _pdbx_refine_tls.L[2][3]_esd _pdbx_refine_tls.L[3][3] _pdbx_refine_tls.L[3][3]_esd _pdbx_refine_tls.S[1][1] _pdbx_refine_tls.S[1][1]_esd _pdbx_refine_tls.S[1][2] _pdbx_refine_tls.S[1][2]_esd _pdbx_refine_tls.S[1][3] _pdbx_refine_tls.S[1][3]_esd _pdbx_refine_tls.S[2][1] _pdbx_refine_tls.S[2][1]_esd _pdbx_refine_tls.S[2][2] _pdbx_refine_tls.S[2][2]_esd _pdbx_refine_tls.S[2][3] _pdbx_refine_tls.S[2][3]_esd _pdbx_refine_tls.S[3][1] _pdbx_refine_tls.S[3][1]_esd _pdbx_refine_tls.S[3][2] _pdbx_refine_tls.S[3][2]_esd _pdbx_refine_tls.S[3][3] _pdbx_refine_tls.S[3][3]_esd 1 'X-RAY DIFFRACTION' ? refined 49.9485452656 -25.4371264828 -13.7896613143 6.98817669204 ? -0.0867378204156 ? 0.11742680943 ? 7.04302095026 ? 0.512380061073 ? 6.00504779536 ? 1.38868322441 ? 0.135638923615 ? -1.2006325237 ? 1.49489387888 ? 2.46371239593 ? 2.92391578793 ? -1.09272066494 ? 0.340988976298 ? 1.92221755016 ? -2.01266430131 ? 2.83168448422 ? 4.70882798915 ? 0.312621507983 ? -1.25742483994 ? 0.00122762161054 ? 2 'X-RAY DIFFRACTION' ? refined 49.9934563944 -28.7826474908 -11.4694449384 5.86401829083 ? 0.717097924661 ? 0.689080696577 ? 7.57702496261 ? -0.193270568788 ? 8.67961428713 ? -0.0377404949332 ? 0.0413092948495 ? -0.204179465238 ? 0.193492547128 ? 0.116190134863 ? 0.0210179962275 ? 0.0174184235097 ? -2.62275695707 ? 0.41359061327 ? -0.34139399857 ? -0.566511639342 ? -2.59827903255 ? -1.89840988346 ? 0.393555841952 ? 0.00827134183995 ? 3 'X-RAY DIFFRACTION' ? refined 56.793236651 -12.5340600865 -24.719057546 7.78084772345 ? -0.16938374346 ? -0.719378849938 ? 9.25252516119 ? 0.225008776706 ? 8.10555301297 ? 0.851870648924 ? -1.12327272968 ? 0.734021010908 ? 2.41088759839 ? -1.57428891748 ? 1.11689980265 ? 5.34606423476 ? 3.56752500981 ? -0.621660422287 ? 0.492278532051 ? -0.805970058652 ? 3.27034091511 ? 2.68172624783 ? -5.27709402517 ? -0.027898900153 ? 4 'X-RAY DIFFRACTION' ? refined 38.7648484866 -46.0522695074 0.266484078335 6.8489218485 ? -0.409251999536 ? -0.839815531994 ? 8.32810688693 ? 1.01343465569 ? 6.66411828294 ? 0.908062933053 ? 0.88811988238 ? 0.884606488462 ? 1.1016014649 ? 0.581812060591 ? 0.623508776035 ? 2.51676879053 ? 4.47146428858 ? -7.54522981852 ? 2.12025889309 ? 6.19519712493 ? 11.8203913659 ? 3.47580521005 ? -0.161768736411 ? 0.596003539697 ? # loop_ _pdbx_refine_tls_group.id _pdbx_refine_tls_group.pdbx_refine_id _pdbx_refine_tls_group.refine_tls_id _pdbx_refine_tls_group.beg_label_asym_id _pdbx_refine_tls_group.beg_label_seq_id _pdbx_refine_tls_group.beg_auth_asym_id _pdbx_refine_tls_group.beg_auth_seq_id _pdbx_refine_tls_group.beg_PDB_ins_code _pdbx_refine_tls_group.end_label_asym_id _pdbx_refine_tls_group.end_label_seq_id _pdbx_refine_tls_group.end_auth_asym_id _pdbx_refine_tls_group.end_auth_seq_id _pdbx_refine_tls_group.end_PDB_ins_code _pdbx_refine_tls_group.selection _pdbx_refine_tls_group.selection_details 1 'X-RAY DIFFRACTION' 1 A ? A 101 ? A ? A 121 ? ? ;(chain 'A' and resid 101 through 121) ; 2 'X-RAY DIFFRACTION' 2 B ? B 119 ? B ? B 125 ? ? ;(chain 'B' and resid 119 through 125) ; 3 'X-RAY DIFFRACTION' 3 C ? C 209 ? C ? C 214 ? ? ;(chain 'C' and resid 209 through 214) ; 4 'X-RAY DIFFRACTION' 4 D ? D 201 ? D ? D 208 ? ? ;(chain 'D' and resid 201 through 208) ; # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.19.2_4158 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? autoPROC ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? STARANISO ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _pdbx_entry_details.entry_id 8CS2 _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # _pdbx_validate_symm_contact.id 1 _pdbx_validate_symm_contact.PDB_model_num 1 _pdbx_validate_symm_contact.auth_atom_id_1 N6 _pdbx_validate_symm_contact.auth_asym_id_1 A _pdbx_validate_symm_contact.auth_comp_id_1 1AP _pdbx_validate_symm_contact.auth_seq_id_1 101 _pdbx_validate_symm_contact.PDB_ins_code_1 ? _pdbx_validate_symm_contact.label_alt_id_1 ? _pdbx_validate_symm_contact.site_symmetry_1 1_555 _pdbx_validate_symm_contact.auth_atom_id_2 C2 _pdbx_validate_symm_contact.auth_asym_id_2 D _pdbx_validate_symm_contact.auth_comp_id_2 DC _pdbx_validate_symm_contact.auth_seq_id_2 202 _pdbx_validate_symm_contact.PDB_ins_code_2 ? _pdbx_validate_symm_contact.label_alt_id_2 ? _pdbx_validate_symm_contact.site_symmetry_2 6_554 _pdbx_validate_symm_contact.dist 2.16 # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 "O3'" A DG 102 ? ? "C3'" A DG 102 ? ? 1.367 1.419 -0.052 0.006 N 2 1 "C5'" A DG 106 ? ? "C4'" A DG 106 ? ? 1.557 1.512 0.045 0.007 N 3 1 "C1'" A DC 107 ? ? N1 A DC 107 ? ? 1.588 1.488 0.100 0.013 N 4 1 "O3'" A DC 108 ? ? "C3'" A DC 108 ? ? 1.340 1.419 -0.079 0.006 N 5 1 "O3'" A DA 112 ? ? "C3'" A DA 112 ? ? 1.524 1.435 0.089 0.013 N 6 1 "O3'" A DC 113 ? ? "C3'" A DC 113 ? ? 1.340 1.419 -0.079 0.006 N 7 1 "C1'" A DC 113 ? ? N1 A DC 113 ? ? 1.339 1.468 -0.129 0.014 N 8 1 "O3'" A DG 115 ? ? "C3'" A DG 115 ? ? 1.522 1.435 0.087 0.013 N 9 1 "C5'" A DA 116 ? ? "C4'" A DA 116 ? ? 1.571 1.512 0.059 0.007 N 10 1 "O3'" A DA 116 ? ? "C3'" A DA 116 ? ? 1.529 1.435 0.094 0.013 N 11 1 "C1'" A DC 117 ? ? N1 A DC 117 ? ? 1.577 1.488 0.089 0.013 N 12 1 "O3'" A DC 120 ? ? "C3'" A DC 120 ? ? 1.383 1.419 -0.036 0.006 N 13 1 N9 A DA 121 ? ? C4 A DA 121 ? ? 1.332 1.374 -0.042 0.006 N 14 1 "O3'" B DC 119 ? ? "C3'" B DC 119 ? ? 1.352 1.419 -0.067 0.006 N 15 1 "O3'" B DC 120 ? ? "C3'" B DC 120 ? ? 1.352 1.419 -0.067 0.006 N 16 1 "O3'" B DT 122 ? ? "C3'" B DT 122 ? ? 1.366 1.419 -0.053 0.006 N 17 1 N9 B DA 123 ? ? C4 B DA 123 ? ? 1.324 1.374 -0.050 0.006 N 18 1 "O3'" B DA 125 ? ? "C3'" B DA 125 ? ? 1.378 1.419 -0.041 0.006 N 19 1 C4 C DG 209 ? ? C5 C DG 209 ? ? 1.430 1.379 0.051 0.007 N 20 1 "O3'" C DG 210 ? ? "C3'" C DG 210 ? ? 1.372 1.419 -0.047 0.006 N 21 1 "O3'" C DG 213 ? ? "C3'" C DG 213 ? ? 1.382 1.419 -0.037 0.006 N 22 1 "C1'" D DC 202 ? ? N1 D DC 202 ? ? 1.601 1.488 0.113 0.013 N 23 1 "C5'" D DT 203 ? ? "C4'" D DT 203 ? ? 1.565 1.512 0.053 0.007 N 24 1 "O3'" D DG 204 ? ? "C3'" D DG 204 ? ? 1.332 1.419 -0.087 0.006 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A DT 109 ? ? "C1'" A DT 109 ? ? N1 A DT 109 ? ? 110.24 108.30 1.94 0.30 N 2 1 "O4'" A DC 117 ? ? "C1'" A DC 117 ? ? N1 A DC 117 ? ? 111.14 108.30 2.84 0.30 N 3 1 "C3'" A DC 120 ? ? "C2'" A DC 120 ? ? "C1'" A DC 120 ? ? 93.96 102.40 -8.44 0.80 N 4 1 "O4'" A DC 120 ? ? "C1'" A DC 120 ? ? N1 A DC 120 ? ? 110.67 108.30 2.37 0.30 N 5 1 "C3'" B DC 120 ? ? "C2'" B DC 120 ? ? "C1'" B DC 120 ? ? 97.36 102.40 -5.04 0.80 N 6 1 "O4'" B DA 125 ? ? "C1'" B DA 125 ? ? N9 B DA 125 ? ? 110.22 108.30 1.92 0.30 N 7 1 N3 C DG 209 ? ? C4 C DG 209 ? ? C5 C DG 209 ? ? 125.34 128.60 -3.26 0.50 N 8 1 C4 C DG 209 ? ? C5 C DG 209 ? ? N7 C DG 209 ? ? 108.27 110.80 -2.53 0.40 N 9 1 "O4'" C DG 213 ? ? "C1'" C DG 213 ? ? N9 C DG 213 ? ? 111.76 108.30 3.46 0.30 N 10 1 "O4'" D DT 201 ? ? "C1'" D DT 201 ? ? N1 D DT 201 ? ? 110.81 108.30 2.51 0.30 N 11 1 "O4'" D DT 203 ? ? "C1'" D DT 203 ? ? N1 D DT 203 ? ? 111.61 108.30 3.31 0.30 N 12 1 "C1'" D DA 205 ? ? "O4'" D DA 205 ? ? "C4'" D DA 205 ? ? 103.84 110.10 -6.26 1.00 N 13 1 "C3'" D DT 206 ? ? "C2'" D DT 206 ? ? "C1'" D DT 206 ? ? 94.54 102.40 -7.86 0.80 N 14 1 "O5'" D DG 207 ? ? P D DG 207 ? ? OP1 D DG 207 ? ? 99.69 105.70 -6.01 0.90 N 15 1 "O4'" D DG 207 ? ? "C1'" D DG 207 ? ? N9 D DG 207 ? ? 110.29 108.30 1.99 0.30 N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 1AP N1 N Y N 1 1AP C2 C Y N 2 1AP C4 C Y N 3 1AP C5 C Y N 4 1AP C6 C Y N 5 1AP C8 C Y N 6 1AP N2 N N N 7 1AP N3 N Y N 8 1AP N9 N Y N 9 1AP N7 N Y N 10 1AP N6 N N N 11 1AP P P N N 12 1AP OP1 O N N 13 1AP OP2 O N N 14 1AP "O5'" O N N 15 1AP "C5'" C N N 16 1AP "C4'" C N R 17 1AP "O4'" O N N 18 1AP "C1'" C N R 19 1AP "C2'" C N N 20 1AP "C3'" C N S 21 1AP "O3'" O N N 22 1AP OP3 O N N 23 1AP H81 H N N 24 1AP HN21 H N N 25 1AP HN22 H N N 26 1AP HN61 H N N 27 1AP HN62 H N N 28 1AP H1P H N N 29 1AP H52 H N N 30 1AP H51 H N N 31 1AP H4 H N N 32 1AP H11 H N N 33 1AP H21 H N N 34 1AP H22 H N N 35 1AP H31 H N N 36 1AP HO31 H N N 37 1AP H3P H N N 38 DA OP3 O N N 39 DA P P N N 40 DA OP1 O N N 41 DA OP2 O N N 42 DA "O5'" O N N 43 DA "C5'" C N N 44 DA "C4'" C N R 45 DA "O4'" O N N 46 DA "C3'" C N S 47 DA "O3'" O N N 48 DA "C2'" C N N 49 DA "C1'" C N R 50 DA N9 N Y N 51 DA C8 C Y N 52 DA N7 N Y N 53 DA C5 C Y N 54 DA C6 C Y N 55 DA N6 N N N 56 DA N1 N Y N 57 DA C2 C Y N 58 DA N3 N Y N 59 DA C4 C Y N 60 DA HOP3 H N N 61 DA HOP2 H N N 62 DA "H5'" H N N 63 DA "H5''" H N N 64 DA "H4'" H N N 65 DA "H3'" H N N 66 DA "HO3'" H N N 67 DA "H2'" H N N 68 DA "H2''" H N N 69 DA "H1'" H N N 70 DA H8 H N N 71 DA H61 H N N 72 DA H62 H N N 73 DA H2 H N N 74 DC OP3 O N N 75 DC P P N N 76 DC OP1 O N N 77 DC OP2 O N N 78 DC "O5'" O N N 79 DC "C5'" C N N 80 DC "C4'" C N R 81 DC "O4'" O N N 82 DC "C3'" C N S 83 DC "O3'" O N N 84 DC "C2'" C N N 85 DC "C1'" C N R 86 DC N1 N N N 87 DC C2 C N N 88 DC O2 O N N 89 DC N3 N N N 90 DC C4 C N N 91 DC N4 N N N 92 DC C5 C N N 93 DC C6 C N N 94 DC HOP3 H N N 95 DC HOP2 H N N 96 DC "H5'" H N N 97 DC "H5''" H N N 98 DC "H4'" H N N 99 DC "H3'" H N N 100 DC "HO3'" H N N 101 DC "H2'" H N N 102 DC "H2''" H N N 103 DC "H1'" H N N 104 DC H41 H N N 105 DC H42 H N N 106 DC H5 H N N 107 DC H6 H N N 108 DG OP3 O N N 109 DG P P N N 110 DG OP1 O N N 111 DG OP2 O N N 112 DG "O5'" O N N 113 DG "C5'" C N N 114 DG "C4'" C N R 115 DG "O4'" O N N 116 DG "C3'" C N S 117 DG "O3'" O N N 118 DG "C2'" C N N 119 DG "C1'" C N R 120 DG N9 N Y N 121 DG C8 C Y N 122 DG N7 N Y N 123 DG C5 C Y N 124 DG C6 C N N 125 DG O6 O N N 126 DG N1 N N N 127 DG C2 C N N 128 DG N2 N N N 129 DG N3 N N N 130 DG C4 C Y N 131 DG HOP3 H N N 132 DG HOP2 H N N 133 DG "H5'" H N N 134 DG "H5''" H N N 135 DG "H4'" H N N 136 DG "H3'" H N N 137 DG "HO3'" H N N 138 DG "H2'" H N N 139 DG "H2''" H N N 140 DG "H1'" H N N 141 DG H8 H N N 142 DG H1 H N N 143 DG H21 H N N 144 DG H22 H N N 145 DT OP3 O N N 146 DT P P N N 147 DT OP1 O N N 148 DT OP2 O N N 149 DT "O5'" O N N 150 DT "C5'" C N N 151 DT "C4'" C N R 152 DT "O4'" O N N 153 DT "C3'" C N S 154 DT "O3'" O N N 155 DT "C2'" C N N 156 DT "C1'" C N R 157 DT N1 N N N 158 DT C2 C N N 159 DT O2 O N N 160 DT N3 N N N 161 DT C4 C N N 162 DT O4 O N N 163 DT C5 C N N 164 DT C7 C N N 165 DT C6 C N N 166 DT HOP3 H N N 167 DT HOP2 H N N 168 DT "H5'" H N N 169 DT "H5''" H N N 170 DT "H4'" H N N 171 DT "H3'" H N N 172 DT "HO3'" H N N 173 DT "H2'" H N N 174 DT "H2''" H N N 175 DT "H1'" H N N 176 DT H3 H N N 177 DT H71 H N N 178 DT H72 H N N 179 DT H73 H N N 180 DT H6 H N N 181 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 1AP N1 C2 sing Y N 1 1AP N1 C6 doub Y N 2 1AP C2 N2 sing N N 3 1AP C2 N3 doub Y N 4 1AP C4 C5 doub Y N 5 1AP C4 N3 sing Y N 6 1AP C4 N9 sing Y N 7 1AP C5 C6 sing Y N 8 1AP C5 N7 sing Y N 9 1AP C6 N6 sing N N 10 1AP C8 N9 sing Y N 11 1AP C8 N7 doub Y N 12 1AP C8 H81 sing N N 13 1AP N2 HN21 sing N N 14 1AP N2 HN22 sing N N 15 1AP N9 "C1'" sing N N 16 1AP N6 HN61 sing N N 17 1AP N6 HN62 sing N N 18 1AP P OP1 sing N N 19 1AP P OP2 doub N N 20 1AP P "O5'" sing N N 21 1AP P OP3 sing N N 22 1AP OP1 H1P sing N N 23 1AP "O5'" "C5'" sing N N 24 1AP "C5'" "C4'" sing N N 25 1AP "C5'" H52 sing N N 26 1AP "C5'" H51 sing N N 27 1AP "C4'" "O4'" sing N N 28 1AP "C4'" "C3'" sing N N 29 1AP "C4'" H4 sing N N 30 1AP "O4'" "C1'" sing N N 31 1AP "C1'" "C2'" sing N N 32 1AP "C1'" H11 sing N N 33 1AP "C2'" "C3'" sing N N 34 1AP "C2'" H21 sing N N 35 1AP "C2'" H22 sing N N 36 1AP "C3'" "O3'" sing N N 37 1AP "C3'" H31 sing N N 38 1AP "O3'" HO31 sing N N 39 1AP OP3 H3P sing N N 40 DA OP3 P sing N N 41 DA OP3 HOP3 sing N N 42 DA P OP1 doub N N 43 DA P OP2 sing N N 44 DA P "O5'" sing N N 45 DA OP2 HOP2 sing N N 46 DA "O5'" "C5'" sing N N 47 DA "C5'" "C4'" sing N N 48 DA "C5'" "H5'" sing N N 49 DA "C5'" "H5''" sing N N 50 DA "C4'" "O4'" sing N N 51 DA "C4'" "C3'" sing N N 52 DA "C4'" "H4'" sing N N 53 DA "O4'" "C1'" sing N N 54 DA "C3'" "O3'" sing N N 55 DA "C3'" "C2'" sing N N 56 DA "C3'" "H3'" sing N N 57 DA "O3'" "HO3'" sing N N 58 DA "C2'" "C1'" sing N N 59 DA "C2'" "H2'" sing N N 60 DA "C2'" "H2''" sing N N 61 DA "C1'" N9 sing N N 62 DA "C1'" "H1'" sing N N 63 DA N9 C8 sing Y N 64 DA N9 C4 sing Y N 65 DA C8 N7 doub Y N 66 DA C8 H8 sing N N 67 DA N7 C5 sing Y N 68 DA C5 C6 sing Y N 69 DA C5 C4 doub Y N 70 DA C6 N6 sing N N 71 DA C6 N1 doub Y N 72 DA N6 H61 sing N N 73 DA N6 H62 sing N N 74 DA N1 C2 sing Y N 75 DA C2 N3 doub Y N 76 DA C2 H2 sing N N 77 DA N3 C4 sing Y N 78 DC OP3 P sing N N 79 DC OP3 HOP3 sing N N 80 DC P OP1 doub N N 81 DC P OP2 sing N N 82 DC P "O5'" sing N N 83 DC OP2 HOP2 sing N N 84 DC "O5'" "C5'" sing N N 85 DC "C5'" "C4'" sing N N 86 DC "C5'" "H5'" sing N N 87 DC "C5'" "H5''" sing N N 88 DC "C4'" "O4'" sing N N 89 DC "C4'" "C3'" sing N N 90 DC "C4'" "H4'" sing N N 91 DC "O4'" "C1'" sing N N 92 DC "C3'" "O3'" sing N N 93 DC "C3'" "C2'" sing N N 94 DC "C3'" "H3'" sing N N 95 DC "O3'" "HO3'" sing N N 96 DC "C2'" "C1'" sing N N 97 DC "C2'" "H2'" sing N N 98 DC "C2'" "H2''" sing N N 99 DC "C1'" N1 sing N N 100 DC "C1'" "H1'" sing N N 101 DC N1 C2 sing N N 102 DC N1 C6 sing N N 103 DC C2 O2 doub N N 104 DC C2 N3 sing N N 105 DC N3 C4 doub N N 106 DC C4 N4 sing N N 107 DC C4 C5 sing N N 108 DC N4 H41 sing N N 109 DC N4 H42 sing N N 110 DC C5 C6 doub N N 111 DC C5 H5 sing N N 112 DC C6 H6 sing N N 113 DG OP3 P sing N N 114 DG OP3 HOP3 sing N N 115 DG P OP1 doub N N 116 DG P OP2 sing N N 117 DG P "O5'" sing N N 118 DG OP2 HOP2 sing N N 119 DG "O5'" "C5'" sing N N 120 DG "C5'" "C4'" sing N N 121 DG "C5'" "H5'" sing N N 122 DG "C5'" "H5''" sing N N 123 DG "C4'" "O4'" sing N N 124 DG "C4'" "C3'" sing N N 125 DG "C4'" "H4'" sing N N 126 DG "O4'" "C1'" sing N N 127 DG "C3'" "O3'" sing N N 128 DG "C3'" "C2'" sing N N 129 DG "C3'" "H3'" sing N N 130 DG "O3'" "HO3'" sing N N 131 DG "C2'" "C1'" sing N N 132 DG "C2'" "H2'" sing N N 133 DG "C2'" "H2''" sing N N 134 DG "C1'" N9 sing N N 135 DG "C1'" "H1'" sing N N 136 DG N9 C8 sing Y N 137 DG N9 C4 sing Y N 138 DG C8 N7 doub Y N 139 DG C8 H8 sing N N 140 DG N7 C5 sing Y N 141 DG C5 C6 sing N N 142 DG C5 C4 doub Y N 143 DG C6 O6 doub N N 144 DG C6 N1 sing N N 145 DG N1 C2 sing N N 146 DG N1 H1 sing N N 147 DG C2 N2 sing N N 148 DG C2 N3 doub N N 149 DG N2 H21 sing N N 150 DG N2 H22 sing N N 151 DG N3 C4 sing N N 152 DT OP3 P sing N N 153 DT OP3 HOP3 sing N N 154 DT P OP1 doub N N 155 DT P OP2 sing N N 156 DT P "O5'" sing N N 157 DT OP2 HOP2 sing N N 158 DT "O5'" "C5'" sing N N 159 DT "C5'" "C4'" sing N N 160 DT "C5'" "H5'" sing N N 161 DT "C5'" "H5''" sing N N 162 DT "C4'" "O4'" sing N N 163 DT "C4'" "C3'" sing N N 164 DT "C4'" "H4'" sing N N 165 DT "O4'" "C1'" sing N N 166 DT "C3'" "O3'" sing N N 167 DT "C3'" "C2'" sing N N 168 DT "C3'" "H3'" sing N N 169 DT "O3'" "HO3'" sing N N 170 DT "C2'" "C1'" sing N N 171 DT "C2'" "H2'" sing N N 172 DT "C2'" "H2''" sing N N 173 DT "C1'" N1 sing N N 174 DT "C1'" "H1'" sing N N 175 DT N1 C2 sing N N 176 DT N1 C6 sing N N 177 DT C2 O2 doub N N 178 DT C2 N3 sing N N 179 DT N3 C4 sing N N 180 DT N3 H3 sing N N 181 DT C4 O4 doub N N 182 DT C4 C5 sing N N 183 DT C5 C7 sing N N 184 DT C5 C6 doub N N 185 DT C7 H71 sing N N 186 DT C7 H72 sing N N 187 DT C7 H73 sing N N 188 DT C6 H6 sing N N 189 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8CS2 'double helix' 8CS2 'a-form double helix' 8CS2 'b-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 3 1_555 C DC 6 1_555 -0.117 -0.412 -0.112 19.716 -10.956 5.597 1 A_DG103:DC214_C A 103 ? C 214 ? 19 1 1 A DC 4 1_555 C DG 5 1_555 -0.296 -0.049 -0.663 0.661 -0.937 4.399 2 A_DC104:DG213_C A 104 ? C 213 ? 19 1 1 A DA 5 1_555 C DT 4 1_555 0.267 -0.117 -0.999 -14.625 -16.620 -10.260 3 A_DA105:DT212_C A 105 ? C 212 ? 20 1 1 A DG 6 1_555 C DC 3 1_555 -0.276 -0.265 -0.344 -18.392 -9.171 -7.396 4 A_DG106:DC211_C A 106 ? C 211 ? 19 1 1 A DC 7 1_555 C DG 2 1_555 0.991 0.573 2.247 -13.907 -3.555 42.033 5 A_DC107:DG210_C A 107 ? C 210 ? 22 1 1 A DC 8 1_555 C DG 1 1_555 -2.638 -0.010 -0.227 -7.287 -16.469 12.371 6 A_DC108:DG209_C A 108 ? C 209 ? ? 1 1 A DT 9 1_555 B DA 7 1_555 0.448 -0.712 -1.167 -16.035 1.191 4.744 7 A_DT109:DA125_B A 109 ? B 125 ? 20 1 1 A DG 10 1_555 B DC 6 1_555 -0.602 -0.289 -1.150 0.284 -7.883 10.067 8 A_DG110:DC124_B A 110 ? B 124 ? 19 1 1 A DT 11 1_555 B DA 5 1_555 -0.915 -0.304 -1.290 7.378 -10.372 -2.755 9 A_DT111:DA123_B A 111 ? B 123 ? 20 1 1 A DA 12 1_555 B DT 4 1_555 -0.041 -0.062 -0.337 6.336 -2.880 9.277 10 A_DA112:DT122_B A 112 ? B 122 ? 20 1 1 A DC 13 1_555 B DG 3 1_555 0.076 -0.253 0.232 5.703 -9.242 -1.107 11 A_DC113:DG121_B A 113 ? B 121 ? 19 1 1 A DG 15 1_555 B DC 1 1_555 -0.135 -0.093 0.774 23.703 -24.330 0.308 12 A_DG115:DC119_B A 115 ? B 119 ? 19 1 1 A DA 16 1_555 D DT 8 1_555 0.122 -0.437 0.041 4.826 -28.484 0.362 13 A_DA116:DT208_D A 116 ? D 208 ? 20 1 1 A DC 17 1_555 D DG 7 1_555 0.493 -0.114 -0.137 3.635 -7.418 14.849 14 A_DC117:DG207_D A 117 ? D 207 ? 19 1 1 A DA 18 1_555 D DT 6 1_555 0.047 -0.221 0.749 -21.504 -11.290 -3.908 15 A_DA118:DT206_D A 118 ? D 206 ? 20 1 1 A DT 19 1_555 D DA 5 1_555 -0.547 -0.556 0.014 -18.921 5.868 3.635 16 A_DT119:DA205_D A 119 ? D 205 ? 20 1 1 A DC 20 1_555 D DG 4 1_555 0.160 -0.636 -0.607 -9.524 -3.371 4.873 17 A_DC120:DG204_D A 120 ? D 204 ? 19 1 1 A DA 21 1_555 D DT 3 1_555 0.387 -0.985 -1.510 -12.801 -21.753 -1.089 18 A_DA121:DT203_D A 121 ? D 203 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 3 1_555 C DC 6 1_555 A DC 4 1_555 C DG 5 1_555 -0.543 -1.377 3.643 2.039 0.412 36.558 -2.254 1.174 3.593 0.656 -3.247 36.615 1 AA_DG103DC104:DG213DC214_CC A 103 ? C 214 ? A 104 ? C 213 ? 1 A DC 4 1_555 C DG 5 1_555 A DA 5 1_555 C DT 4 1_555 -2.016 0.815 3.885 -8.812 -2.172 36.484 1.621 1.690 4.189 -3.405 13.814 37.558 2 AA_DC104DA105:DT212DG213_CC A 104 ? C 213 ? A 105 ? C 212 ? 1 A DA 5 1_555 C DT 4 1_555 A DG 6 1_555 C DC 3 1_555 0.520 -0.522 3.367 -10.686 3.935 31.470 -1.557 -2.668 2.954 6.975 18.942 33.418 3 AA_DA105DG106:DC211DT212_CC A 105 ? C 212 ? A 106 ? C 211 ? 1 A DG 6 1_555 C DC 3 1_555 A DC 7 1_555 C DG 2 1_555 3.099 -0.353 2.993 -16.095 6.127 31.131 -1.197 -6.707 1.206 10.474 27.512 35.474 4 AA_DG106DC107:DG210DC211_CC A 106 ? C 211 ? A 107 ? C 210 ? 1 A DC 7 1_555 C DG 2 1_555 A DC 8 1_555 C DG 1 1_555 -2.937 -0.923 2.525 -2.988 -14.295 33.810 0.230 4.306 2.910 -23.278 4.866 36.744 5 AA_DC107DC108:DG209DG210_CC A 107 ? C 210 ? A 108 ? C 209 ? 1 A DC 8 1_555 C DG 1 1_555 A DT 9 1_555 B DA 7 1_555 -1.269 -1.113 3.972 6.032 -2.703 33.117 -1.393 3.353 3.765 -4.684 -10.453 33.752 6 AA_DC108DT109:DA125DG209_BC A 108 ? C 209 ? A 109 ? B 125 ? 1 A DT 9 1_555 B DA 7 1_555 A DG 10 1_555 B DC 6 1_555 0.380 0.972 3.159 0.048 25.978 21.707 -3.055 -0.646 2.790 50.774 -0.095 33.734 7 AA_DT109DG110:DC124DA125_BB A 109 ? B 125 ? A 110 ? B 124 ? 1 A DG 10 1_555 B DC 6 1_555 A DT 11 1_555 B DA 5 1_555 -1.494 -0.455 2.983 -1.895 -1.553 29.951 -0.582 2.520 3.088 -2.998 3.660 30.049 8 AA_DG110DT111:DA123DC124_BB A 110 ? B 124 ? A 111 ? B 123 ? 1 A DT 11 1_555 B DA 5 1_555 A DA 12 1_555 B DT 4 1_555 0.471 1.379 3.497 -3.060 4.355 45.528 1.362 -0.893 3.570 5.605 3.938 45.822 9 AA_DT111DA112:DT122DA123_BB A 111 ? B 123 ? A 112 ? B 122 ? 1 A DA 12 1_555 B DT 4 1_555 A DC 13 1_555 B DG 3 1_555 -0.789 0.014 3.469 -0.296 -0.272 28.878 0.092 1.512 3.476 -0.545 0.594 28.881 10 AA_DA112DC113:DG121DT122_BB A 112 ? B 122 ? A 113 ? B 121 ? 1 A DC 13 1_555 B DG 3 1_555 A DG 15 1_555 B DC 1 1_555 1.743 2.984 5.866 -3.169 -4.482 76.070 2.650 -1.576 5.645 -3.632 2.568 76.238 11 AA_DC113DG115:DC119DG121_BB A 113 ? B 121 ? A 115 ? B 119 ? 1 A DG 15 1_555 B DC 1 1_555 A DA 16 1_555 D DT 8 1_555 -2.214 -1.194 3.336 -14.642 0.822 25.747 -2.547 0.624 3.957 1.683 29.961 29.569 12 AA_DG115DA116:DT208DC119_DB A 115 ? B 119 ? A 116 ? D 208 ? 1 A DA 16 1_555 D DT 8 1_555 A DC 17 1_555 D DG 7 1_555 1.625 -0.633 2.932 4.608 3.283 33.098 -1.591 -2.118 3.049 5.710 -8.015 33.565 13 AA_DA116DC117:DG207DT208_DD A 116 ? D 208 ? A 117 ? D 207 ? 1 A DC 17 1_555 D DG 7 1_555 A DA 18 1_555 D DT 6 1_555 -1.889 0.765 4.401 -11.631 -11.223 44.357 2.244 1.031 4.431 -14.313 14.834 47.070 14 AA_DC117DA118:DT206DG207_DD A 117 ? D 207 ? A 118 ? D 206 ? 1 A DA 18 1_555 D DT 6 1_555 A DT 19 1_555 D DA 5 1_555 0.373 -0.755 3.266 4.287 -0.673 32.496 -1.222 0.083 3.301 -1.196 -7.619 32.776 15 AA_DA118DT119:DA205DT206_DD A 118 ? D 206 ? A 119 ? D 205 ? 1 A DT 19 1_555 D DA 5 1_555 A DC 20 1_555 D DG 4 1_555 -0.652 0.208 2.741 5.424 6.952 28.218 -0.815 2.233 2.552 13.838 -10.796 29.537 16 AA_DT119DC120:DG204DA205_DD A 119 ? D 205 ? A 120 ? D 204 ? 1 A DC 20 1_555 D DG 4 1_555 A DA 21 1_555 D DT 3 1_555 -0.388 0.500 3.420 4.019 29.758 24.393 -3.427 1.154 2.532 51.307 -6.930 38.510 17 AA_DC120DA121:DT203DG204_DD A 120 ? D 204 ? A 121 ? D 203 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Science Foundation (NSF, United States)' 'United States' CTS1120890 1 'National Science Foundation (NSF, United States)' 'United States' CCF-1117210 2 'National Science Foundation (NSF, United States)' 'United States' EFRI-1332411 3 'National Science Foundation (NSF, United States)' 'United States' CHE-1708776 4 'Office of Naval Research (ONR)' 'United States' N000141110729 5 'Office of Naval Research (ONR)' 'United States' N000140911118 6 'Department of Energy (DOE, United States)' 'United States' DESC0007991 7 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id 1AP _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id 1AP _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 7R96 _pdbx_initial_refinement_model.details ? # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details ? # _space_group.name_H-M_alt 'P 63' _space_group.name_Hall 'P 6c' _space_group.IT_number 173 _space_group.crystal_system hexagonal _space_group.id 1 #