data_8HT7 # _entry.id 8HT7 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8HT7 pdb_00008ht7 10.2210/pdb8ht7/pdb WWPDB D_1300032720 ? ? BMRB 36531 ? 10.13018/BMR36531 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-12-27 2 'Structure model' 1 1 2024-05-15 3 'Structure model' 1 2 2024-05-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' database_2 2 3 'Structure model' citation 3 3 'Structure model' citation_author # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_database_2.pdbx_DOI' 2 3 'Structure model' '_citation.country' 3 3 'Structure model' '_citation.journal_abbrev' 4 3 'Structure model' '_citation.journal_id_ASTM' 5 3 'Structure model' '_citation.journal_id_CSD' 6 3 'Structure model' '_citation.journal_id_ISSN' 7 3 'Structure model' '_citation.journal_volume' 8 3 'Structure model' '_citation.page_first' 9 3 'Structure model' '_citation.page_last' 10 3 'Structure model' '_citation.pdbx_database_id_DOI' 11 3 'Structure model' '_citation.pdbx_database_id_PubMed' 12 3 'Structure model' '_citation.title' 13 3 'Structure model' '_citation.year' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.entry_id 8HT7 _pdbx_database_status.recvd_initial_deposition_date 2022-12-20 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs REL _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name BMRB _pdbx_database_related.details 'The N-terminal region of Cdc6 specifically recognizes human DNA G-quadruplex' _pdbx_database_related.db_id 36531 _pdbx_database_related.content_type unspecified # loop_ _pdbx_contact_author.id _pdbx_contact_author.email _pdbx_contact_author.name_first _pdbx_contact_author.name_last _pdbx_contact_author.name_mi _pdbx_contact_author.role _pdbx_contact_author.identifier_ORCID 2 gzhu@ust.hk Guang ZHU ? 'principal investigator/group leader' 0000-0003-3802-3446 3 lcd@ust.hk Changdong LIU ? 'principal investigator/group leader' 0000-0001-7356-9765 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Liu, C.' 1 ? 'Zhu, G.' 2 ? 'Geng, Y.' 3 ? 'Xu, N.' 4 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Int.J.Biol.Macromol. _citation.journal_id_ASTM IJBMDR _citation.journal_id_CSD 0708 _citation.journal_id_ISSN 0141-8130 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 260 _citation.language ? _citation.page_first 129487 _citation.page_last 129487 _citation.title 'The N-terminal region of Cdc6 specifically recognizes human DNA G-quadruplex.' _citation.year 2024 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1016/j.ijbiomac.2024.129487 _citation.pdbx_database_id_PubMed 38237821 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Geng, Y.' 1 ? primary 'Liu, C.' 2 ? primary 'Xu, N.' 3 ? primary 'Shi, X.' 4 ? primary 'Suen, M.C.' 5 ? primary 'Zhou, B.' 6 ? primary 'Yan, B.' 7 ? primary 'Wu, C.' 8 ? primary 'Li, H.' 9 ? primary 'Song, Y.' 10 ? primary 'Chen, X.' 11 ? primary 'Wang, Z.' 12 ? primary 'Cai, Q.' 13 ? primary 'Zhu, G.' 14 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3') ; 6661.276 1 ? ? ? ? 2 polymer man GLN-ALA-GLN-ALA-THR-ILE-SER-PHE-PRO-LYS-ARG-LYS-LEU-SER-TRP 1764.055 1 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no no ;(DG)(DG)(DG)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DT)(DG)(DG) (DG) ; GGGTTAGGGTTAGGGTTTGGG A ? 2 'polypeptide(L)' no no QAQATISFPKRKLSW QAQATISFPKRKLSW B ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DG n 1 3 DG n 1 4 DT n 1 5 DT n 1 6 DA n 1 7 DG n 1 8 DG n 1 9 DG n 1 10 DT n 1 11 DT n 1 12 DA n 1 13 DG n 1 14 DG n 1 15 DG n 1 16 DT n 1 17 DT n 1 18 DT n 1 19 DG n 1 20 DG n 1 21 DG n 2 1 GLN n 2 2 ALA n 2 3 GLN n 2 4 ALA n 2 5 THR n 2 6 ILE n 2 7 SER n 2 8 PHE n 2 9 PRO n 2 10 LYS n 2 11 ARG n 2 12 LYS n 2 13 LEU n 2 14 SER n 2 15 TRP n # _entity_src_gen.entity_id 2 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 15 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Homo sapiens' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 9606 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'Escherichia coli' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 562 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 21 _pdbx_entity_src_syn.organism_scientific 'Homo sapiens' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 9606 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight ALA 'L-peptide linking' y ALANINE ? 'C3 H7 N O2' 89.093 ARG 'L-peptide linking' y ARGININE ? 'C6 H15 N4 O2 1' 175.209 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 GLN 'L-peptide linking' y GLUTAMINE ? 'C5 H10 N2 O3' 146.144 ILE 'L-peptide linking' y ISOLEUCINE ? 'C6 H13 N O2' 131.173 LEU 'L-peptide linking' y LEUCINE ? 'C6 H13 N O2' 131.173 LYS 'L-peptide linking' y LYSINE ? 'C6 H15 N2 O2 1' 147.195 PHE 'L-peptide linking' y PHENYLALANINE ? 'C9 H11 N O2' 165.189 PRO 'L-peptide linking' y PROLINE ? 'C5 H9 N O2' 115.130 SER 'L-peptide linking' y SERINE ? 'C3 H7 N O3' 105.093 THR 'L-peptide linking' y THREONINE ? 'C4 H9 N O3' 119.119 TRP 'L-peptide linking' y TRYPTOPHAN ? 'C11 H12 N2 O2' 204.225 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DG 2 2 2 DG DG A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DT 4 4 4 DT DT A . n A 1 5 DT 5 5 5 DT DT A . n A 1 6 DA 6 6 6 DA DA A . n A 1 7 DG 7 7 7 DG DG A . n A 1 8 DG 8 8 8 DG DG A . n A 1 9 DG 9 9 9 DG DG A . n A 1 10 DT 10 10 10 DT DT A . n A 1 11 DT 11 11 11 DT DT A . n A 1 12 DA 12 12 12 DA DA A . n A 1 13 DG 13 13 13 DG DG A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DT 16 16 16 DT DT A . n A 1 17 DT 17 17 17 DT DT A . n A 1 18 DT 18 18 18 DT DT A . n A 1 19 DG 19 19 19 DG DG A . n A 1 20 DG 20 20 20 DG DG A . n A 1 21 DG 21 21 21 DG DG A . n B 2 1 GLN 1 107 107 GLN GLN B . n B 2 2 ALA 2 108 108 ALA ALA B . n B 2 3 GLN 3 109 109 GLN GLN B . n B 2 4 ALA 4 110 110 ALA ALA B . n B 2 5 THR 5 111 111 THR THR B . n B 2 6 ILE 6 112 112 ILE ILE B . n B 2 7 SER 7 113 113 SER SER B . n B 2 8 PHE 8 114 114 PHE PHE B . n B 2 9 PRO 9 115 115 PRO PRO B . n B 2 10 LYS 10 116 116 LYS LYS B . n B 2 11 ARG 11 117 117 ARG ARG B . n B 2 12 LYS 12 118 118 LYS LYS B . n B 2 13 LEU 13 119 119 LEU LEU B . n B 2 14 SER 14 120 120 SER SER B . n B 2 15 TRP 15 121 121 TRP TRP B . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8HT7 _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 8HT7 _struct.title 'The N-terminal region of Cdc6 specifically recognizes human DNA G-quadruplex' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8HT7 _struct_keywords.text 'DNA replication, G-quadruplex, Intrinsically disordered region, DNA BINDING PROTEIN' _struct_keywords.pdbx_keywords 'DNA BINDING PROTEIN' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 8HT7 8HT7 ? 1 ? 1 2 PDB 8HT7 8HT7 ? 2 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 8HT7 A 1 ? 21 ? 8HT7 1 ? 21 ? 1 21 2 2 8HT7 B 1 ? 15 ? 8HT7 107 ? 121 ? 107 121 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 860 ? 1 MORE -5 ? 1 'SSA (A^2)' 4200 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'NMR Distance Restraints' _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DG 1 N1 ? ? ? 1_555 A DG 9 O6 ? ? A DG 1 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog2 hydrog ? ? A DG 1 N2 ? ? ? 1_555 A DG 9 N7 ? ? A DG 1 A DG 9 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog3 hydrog ? ? A DG 1 N7 ? ? ? 1_555 A DG 21 N2 ? ? A DG 1 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog4 hydrog ? ? A DG 1 O6 ? ? ? 1_555 A DG 21 N1 ? ? A DG 1 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog5 hydrog ? ? A DG 2 N7 ? ? ? 1_555 A DG 8 N2 ? ? A DG 2 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog6 hydrog ? ? A DG 2 O6 ? ? ? 1_555 A DG 8 N1 ? ? A DG 2 A DG 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A DG 2 N1 ? ? ? 1_555 A DG 20 O6 ? ? A DG 2 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A DG 2 N2 ? ? ? 1_555 A DG 20 N7 ? ? A DG 2 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A DG 3 N7 ? ? ? 1_555 A DG 7 N2 ? ? A DG 3 A DG 7 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog10 hydrog ? ? A DG 3 O6 ? ? ? 1_555 A DG 7 N1 ? ? A DG 3 A DG 7 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog11 hydrog ? ? A DG 3 N1 ? ? ? 1_555 A DG 19 O6 ? ? A DG 3 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog12 hydrog ? ? A DG 3 N2 ? ? ? 1_555 A DG 19 N7 ? ? A DG 3 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog13 hydrog ? ? A DT 5 N3 ? ? ? 1_555 A DT 18 O4 ? ? A DT 5 A DT 18 1_555 ? ? ? ? ? ? TYPE_12_PAIR ? ? ? hydrog14 hydrog ? ? A DT 5 O4 ? ? ? 1_555 A DT 18 N3 ? ? A DT 5 A DT 18 1_555 ? ? ? ? ? ? TYPE_12_PAIR ? ? ? hydrog15 hydrog ? ? A DA 6 N1 ? ? ? 1_555 A DT 18 N3 ? ? A DA 6 A DT 18 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog16 hydrog ? ? A DA 6 N6 ? ? ? 1_555 A DT 18 O2 ? ? A DA 6 A DT 18 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog17 hydrog ? ? A DG 7 N7 ? ? ? 1_555 A DG 15 N2 ? ? A DG 7 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog18 hydrog ? ? A DG 7 O6 ? ? ? 1_555 A DG 15 N1 ? ? A DG 7 A DG 15 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog19 hydrog ? ? A DG 8 N7 ? ? ? 1_555 A DG 14 N2 ? ? A DG 8 A DG 14 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog20 hydrog ? ? A DG 8 O6 ? ? ? 1_555 A DG 14 N1 ? ? A DG 8 A DG 14 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog21 hydrog ? ? A DG 9 N1 ? ? ? 1_555 A DG 13 O6 ? ? A DG 9 A DG 13 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog22 hydrog ? ? A DG 9 N2 ? ? ? 1_555 A DG 13 N7 ? ? A DG 9 A DG 13 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog23 hydrog ? ? A DG 13 N1 ? ? ? 1_555 A DG 21 O6 ? ? A DG 13 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog24 hydrog ? ? A DG 13 N2 ? ? ? 1_555 A DG 21 N7 ? ? A DG 13 A DG 21 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog25 hydrog ? ? A DG 14 N7 ? ? ? 1_555 A DG 20 N2 ? ? A DG 14 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog26 hydrog ? ? A DG 14 O6 ? ? ? 1_555 A DG 20 N1 ? ? A DG 14 A DG 20 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog27 hydrog ? ? A DG 15 N7 ? ? ? 1_555 A DG 19 N2 ? ? A DG 15 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog28 hydrog ? ? A DG 15 O6 ? ? ? 1_555 A DG 19 N1 ? ? A DG 15 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.48 2 2 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.48 3 2 O4 A DT 16 ? ? O4 A DT 18 ? ? 1.75 4 3 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.50 5 3 O4 A DT 16 ? ? O4 A DT 18 ? ? 2.18 6 4 H3 A DT 5 ? ? O4 A DT 16 ? ? 1.48 7 4 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.51 8 4 "H2''" A DT 5 ? ? "O4'" A DA 6 ? ? 1.59 9 4 O2 A DT 5 ? ? O B LYS 118 ? ? 2.07 10 4 O4 A DT 16 ? ? O B LYS 118 ? ? 2.19 11 5 H72 A DT 4 ? ? H62 A DA 6 ? ? 1.29 12 5 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.48 13 5 O4 A DT 16 ? ? O4 A DT 18 ? ? 2.09 14 6 H3 A DT 16 ? ? HB2 B ARG 117 ? ? 1.28 15 6 HD2 B LYS 116 ? ? H B ARG 117 ? ? 1.29 16 6 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.46 17 7 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.46 18 7 O4 A DT 16 ? ? O4 A DT 18 ? ? 1.88 19 7 "O5'" A DT 4 ? ? OP2 A DA 6 ? ? 2.18 20 7 C7 A DT 16 ? ? O4 A DT 18 ? ? 2.19 21 8 "H4'" A DA 12 ? ? "H5'" A DG 13 ? ? 1.25 22 8 O2 A DT 5 ? ? O B LYS 118 ? ? 1.94 23 8 O4 A DT 16 ? ? O4 A DT 18 ? ? 2.14 24 9 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.48 25 9 H3 A DT 5 ? ? O4 A DT 16 ? ? 1.51 26 9 "H2''" A DT 5 ? ? "O4'" A DA 6 ? ? 1.56 27 10 "O4'" A DA 12 ? ? "H5''" A DG 13 ? ? 1.46 28 10 O4 A DT 16 ? ? O4 A DT 18 ? ? 1.91 # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 "O4'" _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 DG _pdbx_validate_rmsd_angle.auth_seq_id_1 15 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 "C1'" _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 DG _pdbx_validate_rmsd_angle.auth_seq_id_2 15 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 N9 _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 DG _pdbx_validate_rmsd_angle.auth_seq_id_3 15 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 110.98 _pdbx_validate_rmsd_angle.angle_target_value 108.30 _pdbx_validate_rmsd_angle.angle_deviation 2.68 _pdbx_validate_rmsd_angle.angle_standard_deviation 0.30 _pdbx_validate_rmsd_angle.linker_flag N # loop_ _pdbx_validate_torsion.id _pdbx_validate_torsion.PDB_model_num _pdbx_validate_torsion.auth_comp_id _pdbx_validate_torsion.auth_asym_id _pdbx_validate_torsion.auth_seq_id _pdbx_validate_torsion.PDB_ins_code _pdbx_validate_torsion.label_alt_id _pdbx_validate_torsion.phi _pdbx_validate_torsion.psi 1 1 THR B 111 ? ? -62.10 -82.23 2 1 ILE B 112 ? ? 78.23 -53.60 3 1 SER B 113 ? ? 83.78 67.15 4 1 PHE B 114 ? ? -26.65 144.62 5 1 PRO B 115 ? ? -40.82 -169.70 6 1 LYS B 116 ? ? -47.06 86.45 7 1 LYS B 118 ? ? 75.17 -33.90 8 1 SER B 120 ? ? 17.06 66.62 9 2 THR B 111 ? ? -154.46 5.63 10 2 ILE B 112 ? ? -119.86 -88.15 11 2 SER B 113 ? ? 55.88 70.35 12 2 PHE B 114 ? ? -35.45 104.29 13 2 PRO B 115 ? ? -54.39 77.73 14 2 LYS B 116 ? ? -122.78 -114.45 15 2 ARG B 117 ? ? -82.50 -143.92 16 2 LYS B 118 ? ? -18.12 -48.91 17 2 LEU B 119 ? ? -18.27 123.55 18 2 SER B 120 ? ? 16.40 67.46 19 3 ILE B 112 ? ? 58.50 148.74 20 3 SER B 113 ? ? -111.65 63.72 21 3 PHE B 114 ? ? -13.68 126.36 22 3 LYS B 116 ? ? -156.39 -108.37 23 3 ARG B 117 ? ? -58.16 -169.76 24 3 LYS B 118 ? ? -17.69 -66.69 25 3 LEU B 119 ? ? 37.03 152.98 26 3 SER B 120 ? ? -41.48 89.95 27 4 ALA B 108 ? ? 165.31 -68.13 28 4 ALA B 110 ? ? -99.34 45.46 29 4 THR B 111 ? ? 164.07 -48.19 30 4 ILE B 112 ? ? 68.45 116.44 31 4 PHE B 114 ? ? -39.76 178.22 32 4 PRO B 115 ? ? -37.91 -165.62 33 4 LYS B 116 ? ? -96.84 58.42 34 4 LYS B 118 ? ? 110.95 94.97 35 4 LEU B 119 ? ? 177.99 133.54 36 4 SER B 120 ? ? 21.72 40.16 37 5 GLN B 109 ? ? -54.40 -97.55 38 5 ALA B 110 ? ? 87.72 50.35 39 5 THR B 111 ? ? 90.22 -21.35 40 5 ILE B 112 ? ? 73.67 -78.22 41 5 SER B 113 ? ? 45.49 70.51 42 5 PHE B 114 ? ? -13.25 143.66 43 5 PRO B 115 ? ? -35.50 -176.65 44 5 ARG B 117 ? ? -151.17 33.26 45 5 LYS B 118 ? ? 120.64 -29.66 46 5 SER B 120 ? ? 19.87 41.21 47 6 GLN B 109 ? ? -104.61 -77.20 48 6 ALA B 110 ? ? 75.38 -40.23 49 6 THR B 111 ? ? -92.51 -83.13 50 6 ILE B 112 ? ? 67.96 150.70 51 6 LYS B 116 ? ? 173.94 -115.55 52 6 ARG B 117 ? ? -53.11 -87.33 53 6 LYS B 118 ? ? -110.94 -99.70 54 6 LEU B 119 ? ? 63.96 121.27 55 6 SER B 120 ? ? 32.39 53.99 56 7 ALA B 108 ? ? -132.28 -76.76 57 7 GLN B 109 ? ? 18.30 -85.49 58 7 ALA B 110 ? ? 88.91 49.23 59 7 SER B 113 ? ? -73.47 20.96 60 7 PHE B 114 ? ? 94.52 -178.98 61 7 PRO B 115 ? ? -44.75 -125.21 62 7 ARG B 117 ? ? -29.09 -62.22 63 7 LYS B 118 ? ? -147.35 -49.23 64 7 LEU B 119 ? ? -1.36 120.72 65 7 SER B 120 ? ? 59.45 14.44 66 8 ALA B 108 ? ? 26.57 69.37 67 8 THR B 111 ? ? 166.47 47.64 68 8 ILE B 112 ? ? -111.22 -85.51 69 8 SER B 113 ? ? 38.18 73.01 70 8 PHE B 114 ? ? -26.04 156.88 71 8 PRO B 115 ? ? -36.26 169.75 72 8 LYS B 116 ? ? -24.80 -52.09 73 8 ARG B 117 ? ? -1.02 74.54 74 8 LYS B 118 ? ? 47.86 102.06 75 8 LEU B 119 ? ? 173.46 155.70 76 8 SER B 120 ? ? 23.41 46.17 77 9 ALA B 108 ? ? -177.99 40.09 78 9 THR B 111 ? ? -117.60 -72.32 79 9 ILE B 112 ? ? 46.97 174.07 80 9 PHE B 114 ? ? -44.03 179.88 81 9 PRO B 115 ? ? -29.32 -143.59 82 9 LYS B 118 ? ? 147.89 -28.93 83 9 SER B 120 ? ? -5.40 75.65 84 10 GLN B 109 ? ? 37.23 69.57 85 10 THR B 111 ? ? 171.42 -46.29 86 10 ILE B 112 ? ? 49.46 165.22 87 10 SER B 113 ? ? -174.85 48.76 88 10 PHE B 114 ? ? -30.97 133.02 89 10 LYS B 116 ? ? -162.11 -105.35 90 10 LYS B 118 ? ? 21.84 -91.47 91 10 LEU B 119 ? ? 40.33 102.73 # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 1 DG A 3 ? ? 0.061 'SIDE CHAIN' 2 1 DG A 15 ? ? 0.069 'SIDE CHAIN' 3 2 DG A 3 ? ? 0.079 'SIDE CHAIN' 4 3 DG A 3 ? ? 0.077 'SIDE CHAIN' 5 3 DA A 6 ? ? 0.060 'SIDE CHAIN' 6 3 DG A 15 ? ? 0.054 'SIDE CHAIN' 7 4 DG A 3 ? ? 0.077 'SIDE CHAIN' 8 4 DG A 9 ? ? 0.055 'SIDE CHAIN' 9 4 DG A 15 ? ? 0.055 'SIDE CHAIN' 10 5 DG A 3 ? ? 0.071 'SIDE CHAIN' 11 5 DG A 9 ? ? 0.050 'SIDE CHAIN' 12 6 DG A 3 ? ? 0.069 'SIDE CHAIN' 13 6 DA A 6 ? ? 0.054 'SIDE CHAIN' 14 6 DG A 15 ? ? 0.060 'SIDE CHAIN' 15 7 DG A 3 ? ? 0.055 'SIDE CHAIN' 16 7 DA A 6 ? ? 0.056 'SIDE CHAIN' 17 7 DG A 15 ? ? 0.050 'SIDE CHAIN' 18 8 DG A 3 ? ? 0.069 'SIDE CHAIN' 19 8 DG A 9 ? ? 0.072 'SIDE CHAIN' 20 8 DG A 15 ? ? 0.048 'SIDE CHAIN' 21 9 DG A 3 ? ? 0.071 'SIDE CHAIN' 22 9 DG A 15 ? ? 0.051 'SIDE CHAIN' 23 10 DG A 3 ? ? 0.078 'SIDE CHAIN' 24 10 DG A 9 ? ? 0.052 'SIDE CHAIN' 25 10 DG A 15 ? ? 0.052 'SIDE CHAIN' # _pdbx_nmr_ensemble.entry_id 8HT7 _pdbx_nmr_ensemble.conformers_calculated_total_number 200 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 8HT7 _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 ;20 mM potassium phosphate, 70 mM potassium chloride, 0.8 mM DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3'), 95% H2O/5% D2O ; '95% H2O/5% D2O' g4-1 solution 'the free DNA G4 sample' 2 ;20 mM potassium phosphate, 70 mM potassium chloride, 0.8 mM [U-100% 13C; U-100% 15N] GLN-ALA-GLN-ALA-THR-ILE-SER-PHE-PRO-LYS-ARG-LYS-LEU-SER-TRP, 95% H2O/5% D2O ; '95% H2O/5% D2O' pep-1 solution 'the free peptide sample' 3 ;20 mM potassium phosphate, 70 mM potassium chloride, 0.8 mM DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3'), 100% D2O ; '100% D2O' g4-2 solution 'the free DNA G4 sample' 4 ;20 mM potassium phosphate, 70 mM potassium chloride, 0.8 mM [U-100% 13C; U-100% 15N] GLN-ALA-GLN-ALA-THR-ILE-SER-PHE-PRO-LYS-ARG-LYS-LEU-SER-TRP, 100% D2O ; '100% D2O' pep-2 solution 'the free peptide sample' 5 ;20 mM potassium phosphate, 70 mM potassium chloride, 0.8 mM [U-100% 13C; U-100% 15N] GLN-ALA-GLN-ALA-THR-ILE-SER-PHE-PRO-LYS-ARG-LYS-LEU-SER-TRP, 0.8 mM DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3'), 100% D2O ; '100% D2O' complex solution 'the complex sample' # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 'potassium phosphate' 20 ? mM 'natural abundance' 1 'potassium chloride' 70 ? mM 'natural abundance' 1 ;DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3') ; 0.8 ? mM 'natural abundance' 2 'potassium phosphate' 20 ? mM 'natural abundance' 2 'potassium chloride' 70 ? mM 'natural abundance' 2 GLN-ALA-GLN-ALA-THR-ILE-SER-PHE-PRO-LYS-ARG-LYS-LEU-SER-TRP 0.8 ? mM '[U-100% 13C; U-100% 15N]' 3 'potassium phosphate' 20 ? mM 'natural abundance' 3 'potassium chloride' 70 ? mM 'natural abundance' 3 ;DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3') ; 0.8 ? mM 'natural abundance' 4 'potassium phosphate' 20 ? mM 'natural abundance' 4 'potassium chloride' 70 ? mM 'natural abundance' 4 GLN-ALA-GLN-ALA-THR-ILE-SER-PHE-PRO-LYS-ARG-LYS-LEU-SER-TRP 0.8 ? mM '[U-100% 13C; U-100% 15N]' 5 'potassium phosphate' 20 ? mM 'natural abundance' 5 'potassium chloride' 70 ? mM 'natural abundance' 5 GLN-ALA-GLN-ALA-THR-ILE-SER-PHE-PRO-LYS-ARG-LYS-LEU-SER-TRP 0.8 ? mM '[U-100% 13C; U-100% 15N]' 5 ;DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3') ; 0.8 ? mM 'natural abundance' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.details _pdbx_nmr_exptl_sample_conditions.ionic_strength_err _pdbx_nmr_exptl_sample_conditions.ionic_strength_units _pdbx_nmr_exptl_sample_conditions.label _pdbx_nmr_exptl_sample_conditions.pH_err _pdbx_nmr_exptl_sample_conditions.pH_units _pdbx_nmr_exptl_sample_conditions.pressure_err _pdbx_nmr_exptl_sample_conditions.temperature_err _pdbx_nmr_exptl_sample_conditions.temperature_units 1 283 atm 1 7 70 ? ? mM g4 ? pH ? ? K 2 283 atm 1 6 70 ? ? mM pep ? pH ? ? K 3 283 atm 1 7 70 'the complex sample' ? mM pep_13C15N_g4 ? pH ? ? K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 1H-1H NOESY' 1 isotropic 2 1 3 '2D 1H-1H NOESY' 1 isotropic 3 1 3 '2D 1H-1H TOCSY' 3 isotropic 4 2 2 '3D HNCO' 2 isotropic 5 2 2 '3D HNCACB' 2 isotropic 6 2 2 '3D CBCA(CO)NH' 2 isotropic 7 2 2 '3D 1H-15N NOESY' 1 isotropic 8 2 4 '3D 1H-13C NOESY' 1 isotropic 9 2 2 '3D H(CCO)NH' 3 isotropic 10 2 2 '3D C(CO)NH' 3 isotropic 11 3 5 '13C-edited, 13C/15N-filtered 3D NOESY' 1 isotropic 12 2 5 '13C/15N-filtered 2D NOESY' 1 isotropic 13 3 5 '3D 1H-13C NOESY' 1 isotropic # _pdbx_nmr_refine.entry_id 8HT7 _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 1 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 refinement 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' 2 'structure calculation' 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' 3 'chemical shift assignment' Sparky ? Goddard 4 'peak picking' Sparky ? Goddard 5 processing NMRPipe ? 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal ALA N N N N 1 ALA CA C N S 2 ALA C C N N 3 ALA O O N N 4 ALA CB C N N 5 ALA OXT O N N 6 ALA H H N N 7 ALA H2 H N N 8 ALA HA H N N 9 ALA HB1 H N N 10 ALA HB2 H N N 11 ALA HB3 H N N 12 ALA HXT H N N 13 ARG N N N N 14 ARG CA C N S 15 ARG C C N N 16 ARG O O N N 17 ARG CB C N N 18 ARG CG C N N 19 ARG CD C N N 20 ARG NE N N N 21 ARG CZ C N N 22 ARG NH1 N N N 23 ARG NH2 N N N 24 ARG OXT O N N 25 ARG H H N N 26 ARG H2 H N N 27 ARG HA H N N 28 ARG HB2 H N N 29 ARG HB3 H N N 30 ARG HG2 H N N 31 ARG HG3 H N N 32 ARG HD2 H N N 33 ARG HD3 H N N 34 ARG HE H N N 35 ARG HH11 H N N 36 ARG HH12 H N N 37 ARG HH21 H N N 38 ARG HH22 H N N 39 ARG HXT H N N 40 DA OP3 O N N 41 DA P P N N 42 DA OP1 O N N 43 DA OP2 O N N 44 DA "O5'" O N N 45 DA "C5'" C N N 46 DA "C4'" C N R 47 DA "O4'" O N N 48 DA "C3'" C N S 49 DA "O3'" O N N 50 DA "C2'" C N N 51 DA "C1'" C N R 52 DA N9 N Y N 53 DA C8 C Y N 54 DA N7 N Y N 55 DA C5 C Y N 56 DA C6 C Y N 57 DA N6 N N N 58 DA N1 N Y N 59 DA C2 C Y N 60 DA N3 N Y N 61 DA C4 C Y N 62 DA HOP3 H N N 63 DA HOP2 H N N 64 DA "H5'" H N N 65 DA "H5''" H N N 66 DA "H4'" H N N 67 DA "H3'" H N N 68 DA "HO3'" H N N 69 DA "H2'" H N N 70 DA "H2''" H N N 71 DA "H1'" H N N 72 DA H8 H N N 73 DA H61 H N N 74 DA H62 H N N 75 DA H2 H N N 76 DG OP3 O N N 77 DG P P N N 78 DG OP1 O N N 79 DG OP2 O N N 80 DG "O5'" O N N 81 DG "C5'" C N N 82 DG "C4'" C N R 83 DG "O4'" O N N 84 DG "C3'" C N S 85 DG "O3'" O N N 86 DG "C2'" C N N 87 DG "C1'" C N R 88 DG N9 N Y N 89 DG C8 C Y N 90 DG N7 N Y N 91 DG C5 C Y N 92 DG C6 C N N 93 DG O6 O N N 94 DG N1 N N N 95 DG C2 C N N 96 DG N2 N N N 97 DG N3 N N N 98 DG C4 C Y N 99 DG HOP3 H N N 100 DG HOP2 H N N 101 DG "H5'" H N N 102 DG "H5''" H N N 103 DG "H4'" H N N 104 DG "H3'" H N N 105 DG "HO3'" H N N 106 DG "H2'" H N N 107 DG "H2''" H N N 108 DG "H1'" H N N 109 DG H8 H N N 110 DG H1 H N N 111 DG H21 H N N 112 DG H22 H N N 113 DT OP3 O N N 114 DT P P N N 115 DT OP1 O N N 116 DT OP2 O N N 117 DT "O5'" O N N 118 DT "C5'" C N N 119 DT "C4'" C N R 120 DT "O4'" O N N 121 DT "C3'" C N S 122 DT "O3'" O N N 123 DT "C2'" C N N 124 DT "C1'" C N R 125 DT N1 N N N 126 DT C2 C N N 127 DT O2 O N N 128 DT N3 N N N 129 DT C4 C N N 130 DT O4 O N N 131 DT C5 C N N 132 DT C7 C N N 133 DT C6 C N N 134 DT HOP3 H N N 135 DT HOP2 H N N 136 DT "H5'" H N N 137 DT "H5''" H N N 138 DT "H4'" H N N 139 DT "H3'" H N N 140 DT "HO3'" H N N 141 DT "H2'" H N N 142 DT "H2''" H N N 143 DT "H1'" H N N 144 DT H3 H N N 145 DT H71 H N N 146 DT H72 H N N 147 DT H73 H N N 148 DT H6 H N N 149 GLN N N N N 150 GLN CA C N S 151 GLN C C N N 152 GLN O O N N 153 GLN CB C N N 154 GLN CG C N N 155 GLN CD C N N 156 GLN OE1 O N N 157 GLN NE2 N N N 158 GLN OXT O N N 159 GLN H H N N 160 GLN H2 H N N 161 GLN HA H N N 162 GLN HB2 H N N 163 GLN HB3 H N N 164 GLN HG2 H N N 165 GLN HG3 H N N 166 GLN HE21 H N N 167 GLN HE22 H N N 168 GLN HXT H N N 169 ILE N N N N 170 ILE CA C N S 171 ILE C C N N 172 ILE O O N N 173 ILE CB C N S 174 ILE CG1 C N N 175 ILE CG2 C N N 176 ILE CD1 C N N 177 ILE OXT O N N 178 ILE H H N N 179 ILE H2 H N N 180 ILE HA H N N 181 ILE HB H N N 182 ILE HG12 H N N 183 ILE HG13 H N N 184 ILE HG21 H N N 185 ILE HG22 H N N 186 ILE HG23 H N N 187 ILE HD11 H N N 188 ILE HD12 H N N 189 ILE HD13 H N N 190 ILE HXT H N N 191 LEU N N N N 192 LEU CA C N S 193 LEU C C N N 194 LEU O O N N 195 LEU CB C N N 196 LEU CG C N N 197 LEU CD1 C N N 198 LEU CD2 C N N 199 LEU OXT O N N 200 LEU H H N N 201 LEU H2 H N N 202 LEU HA H N N 203 LEU HB2 H N N 204 LEU HB3 H N N 205 LEU HG H N N 206 LEU HD11 H N N 207 LEU HD12 H N N 208 LEU HD13 H N N 209 LEU HD21 H N N 210 LEU HD22 H N N 211 LEU HD23 H N N 212 LEU HXT H N N 213 LYS N N N N 214 LYS CA C N S 215 LYS C C N N 216 LYS O O N N 217 LYS CB C N N 218 LYS CG C N N 219 LYS CD C N N 220 LYS CE C N N 221 LYS NZ N N N 222 LYS OXT O N N 223 LYS H H N N 224 LYS H2 H N N 225 LYS HA H N N 226 LYS HB2 H N N 227 LYS HB3 H N N 228 LYS HG2 H N N 229 LYS HG3 H N N 230 LYS HD2 H N N 231 LYS HD3 H N N 232 LYS HE2 H N N 233 LYS HE3 H N N 234 LYS HZ1 H N N 235 LYS HZ2 H N N 236 LYS HZ3 H N N 237 LYS HXT H N N 238 PHE N N N N 239 PHE CA C N S 240 PHE C C N N 241 PHE O O N N 242 PHE CB C N N 243 PHE CG C Y N 244 PHE CD1 C Y N 245 PHE CD2 C Y N 246 PHE CE1 C Y N 247 PHE CE2 C Y N 248 PHE CZ C Y N 249 PHE OXT O N N 250 PHE H H N N 251 PHE H2 H N N 252 PHE HA H N N 253 PHE HB2 H N N 254 PHE HB3 H N N 255 PHE HD1 H N N 256 PHE HD2 H N N 257 PHE HE1 H N N 258 PHE HE2 H N N 259 PHE HZ H N N 260 PHE HXT H N N 261 PRO N N N N 262 PRO CA C N S 263 PRO C C N N 264 PRO O O N N 265 PRO CB C N N 266 PRO CG C N N 267 PRO CD C N N 268 PRO OXT O N N 269 PRO H H N N 270 PRO HA H N N 271 PRO HB2 H N N 272 PRO HB3 H N N 273 PRO HG2 H N N 274 PRO HG3 H N N 275 PRO HD2 H N N 276 PRO HD3 H N N 277 PRO HXT H N N 278 SER N N N N 279 SER CA C N S 280 SER C C N N 281 SER O O N N 282 SER CB C N N 283 SER OG O N N 284 SER OXT O N N 285 SER H H N N 286 SER H2 H N N 287 SER HA H N N 288 SER HB2 H N N 289 SER HB3 H N N 290 SER HG H N N 291 SER HXT H N N 292 THR N N N N 293 THR CA C N S 294 THR C C N N 295 THR O O N N 296 THR CB C N R 297 THR OG1 O N N 298 THR CG2 C N N 299 THR OXT O N N 300 THR H H N N 301 THR H2 H N N 302 THR HA H N N 303 THR HB H N N 304 THR HG1 H N N 305 THR HG21 H N N 306 THR HG22 H N N 307 THR HG23 H N N 308 THR HXT H N N 309 TRP N N N N 310 TRP CA C N S 311 TRP C C N N 312 TRP O O N N 313 TRP CB C N N 314 TRP CG C Y N 315 TRP CD1 C Y N 316 TRP CD2 C Y N 317 TRP NE1 N Y N 318 TRP CE2 C Y N 319 TRP CE3 C Y N 320 TRP CZ2 C Y N 321 TRP CZ3 C Y N 322 TRP CH2 C Y N 323 TRP OXT O N N 324 TRP H H N N 325 TRP H2 H N N 326 TRP HA H N N 327 TRP HB2 H N N 328 TRP HB3 H N N 329 TRP HD1 H N N 330 TRP HE1 H N N 331 TRP HE3 H N N 332 TRP HZ2 H N N 333 TRP HZ3 H N N 334 TRP HH2 H N N 335 TRP HXT H N N 336 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal ALA N CA sing N N 1 ALA N H sing N N 2 ALA N H2 sing N N 3 ALA CA C sing N N 4 ALA CA CB sing N N 5 ALA CA HA sing N N 6 ALA C O doub N N 7 ALA C OXT sing N N 8 ALA CB HB1 sing N N 9 ALA CB HB2 sing N N 10 ALA CB HB3 sing N N 11 ALA OXT HXT sing N N 12 ARG N CA sing N N 13 ARG N H sing N N 14 ARG N H2 sing N N 15 ARG CA C sing N N 16 ARG CA CB sing N N 17 ARG CA HA sing N N 18 ARG C O doub N N 19 ARG C OXT sing N N 20 ARG CB CG sing N N 21 ARG CB HB2 sing N N 22 ARG CB HB3 sing N N 23 ARG CG CD sing N N 24 ARG CG HG2 sing N N 25 ARG CG HG3 sing N N 26 ARG CD NE sing N N 27 ARG CD HD2 sing N N 28 ARG CD HD3 sing N N 29 ARG NE CZ sing N N 30 ARG NE HE sing N N 31 ARG CZ NH1 sing N N 32 ARG CZ NH2 doub N N 33 ARG NH1 HH11 sing N N 34 ARG NH1 HH12 sing N N 35 ARG NH2 HH21 sing N N 36 ARG NH2 HH22 sing N N 37 ARG OXT HXT sing N N 38 DA OP3 P sing N N 39 DA OP3 HOP3 sing N N 40 DA P OP1 doub N N 41 DA P OP2 sing N N 42 DA P "O5'" sing N N 43 DA OP2 HOP2 sing N N 44 DA "O5'" "C5'" sing N N 45 DA "C5'" "C4'" sing N N 46 DA "C5'" "H5'" sing N N 47 DA "C5'" "H5''" sing N N 48 DA "C4'" "O4'" sing N N 49 DA "C4'" "C3'" sing N N 50 DA "C4'" "H4'" sing N N 51 DA "O4'" "C1'" sing N N 52 DA "C3'" "O3'" sing N N 53 DA "C3'" "C2'" sing N N 54 DA "C3'" "H3'" sing N N 55 DA "O3'" "HO3'" sing N N 56 DA "C2'" "C1'" sing N N 57 DA "C2'" "H2'" sing N N 58 DA "C2'" "H2''" sing N N 59 DA "C1'" N9 sing N N 60 DA "C1'" "H1'" sing N N 61 DA N9 C8 sing Y N 62 DA N9 C4 sing Y N 63 DA C8 N7 doub Y N 64 DA C8 H8 sing N N 65 DA N7 C5 sing Y N 66 DA C5 C6 sing Y N 67 DA C5 C4 doub Y N 68 DA C6 N6 sing N N 69 DA C6 N1 doub Y N 70 DA N6 H61 sing N N 71 DA N6 H62 sing N N 72 DA N1 C2 sing Y N 73 DA C2 N3 doub Y N 74 DA C2 H2 sing N N 75 DA N3 C4 sing Y N 76 DG OP3 P sing N N 77 DG OP3 HOP3 sing N N 78 DG P OP1 doub N N 79 DG P OP2 sing N N 80 DG P "O5'" sing N N 81 DG OP2 HOP2 sing N N 82 DG "O5'" "C5'" sing N N 83 DG "C5'" "C4'" sing N N 84 DG "C5'" "H5'" sing N N 85 DG "C5'" "H5''" sing N N 86 DG "C4'" "O4'" sing N N 87 DG "C4'" "C3'" sing N N 88 DG "C4'" "H4'" sing N N 89 DG "O4'" "C1'" sing N N 90 DG "C3'" "O3'" sing N N 91 DG "C3'" "C2'" sing N N 92 DG "C3'" "H3'" sing N N 93 DG "O3'" "HO3'" sing N N 94 DG "C2'" "C1'" sing N N 95 DG "C2'" "H2'" sing N N 96 DG "C2'" "H2''" sing N N 97 DG "C1'" N9 sing N N 98 DG "C1'" "H1'" sing N N 99 DG N9 C8 sing Y N 100 DG N9 C4 sing Y N 101 DG C8 N7 doub Y N 102 DG C8 H8 sing N N 103 DG N7 C5 sing Y N 104 DG C5 C6 sing N N 105 DG C5 C4 doub Y N 106 DG C6 O6 doub N N 107 DG C6 N1 sing N N 108 DG N1 C2 sing N N 109 DG N1 H1 sing N N 110 DG C2 N2 sing N N 111 DG C2 N3 doub N N 112 DG N2 H21 sing N N 113 DG N2 H22 sing N N 114 DG N3 C4 sing N N 115 DT OP3 P sing N N 116 DT OP3 HOP3 sing N N 117 DT P OP1 doub N N 118 DT P OP2 sing N N 119 DT P "O5'" sing N N 120 DT OP2 HOP2 sing N N 121 DT "O5'" "C5'" sing N N 122 DT "C5'" "C4'" sing N N 123 DT "C5'" "H5'" sing N N 124 DT "C5'" "H5''" sing N N 125 DT "C4'" "O4'" sing N N 126 DT "C4'" "C3'" sing N N 127 DT "C4'" "H4'" sing N N 128 DT "O4'" "C1'" sing N N 129 DT "C3'" "O3'" sing N N 130 DT "C3'" "C2'" sing N N 131 DT "C3'" "H3'" sing N N 132 DT "O3'" "HO3'" sing N N 133 DT "C2'" "C1'" sing N N 134 DT "C2'" "H2'" sing N N 135 DT "C2'" "H2''" sing N N 136 DT "C1'" N1 sing N N 137 DT "C1'" "H1'" sing N N 138 DT N1 C2 sing N N 139 DT N1 C6 sing N N 140 DT C2 O2 doub N N 141 DT C2 N3 sing N N 142 DT N3 C4 sing N N 143 DT N3 H3 sing N N 144 DT C4 O4 doub N N 145 DT C4 C5 sing N N 146 DT C5 C7 sing N N 147 DT C5 C6 doub N N 148 DT C7 H71 sing N N 149 DT C7 H72 sing N N 150 DT C7 H73 sing N N 151 DT C6 H6 sing N N 152 GLN N CA sing N N 153 GLN N H sing N N 154 GLN N H2 sing N N 155 GLN CA C sing N N 156 GLN CA CB sing N N 157 GLN CA HA sing N N 158 GLN C O doub N N 159 GLN C OXT sing N N 160 GLN CB CG sing N N 161 GLN CB HB2 sing N N 162 GLN CB HB3 sing N N 163 GLN CG CD sing N N 164 GLN CG HG2 sing N N 165 GLN CG HG3 sing N N 166 GLN CD OE1 doub N N 167 GLN CD NE2 sing N N 168 GLN NE2 HE21 sing N N 169 GLN NE2 HE22 sing N N 170 GLN OXT HXT sing N N 171 ILE N CA sing N N 172 ILE N H sing N N 173 ILE N H2 sing N N 174 ILE CA C sing N N 175 ILE CA CB sing N N 176 ILE CA HA sing N N 177 ILE C O doub N N 178 ILE C OXT sing N N 179 ILE CB CG1 sing N N 180 ILE CB CG2 sing N N 181 ILE CB HB sing N N 182 ILE CG1 CD1 sing N N 183 ILE CG1 HG12 sing N N 184 ILE CG1 HG13 sing N N 185 ILE CG2 HG21 sing N N 186 ILE CG2 HG22 sing N N 187 ILE CG2 HG23 sing N N 188 ILE CD1 HD11 sing N N 189 ILE CD1 HD12 sing N N 190 ILE CD1 HD13 sing N N 191 ILE OXT HXT sing N N 192 LEU N CA sing N N 193 LEU N H sing N N 194 LEU N H2 sing N N 195 LEU CA C sing N N 196 LEU CA CB sing N N 197 LEU CA HA sing N N 198 LEU C O doub N N 199 LEU C OXT sing N N 200 LEU CB CG sing N N 201 LEU CB HB2 sing N N 202 LEU CB HB3 sing N N 203 LEU CG CD1 sing N N 204 LEU CG CD2 sing N N 205 LEU CG HG sing N N 206 LEU CD1 HD11 sing N N 207 LEU CD1 HD12 sing N N 208 LEU CD1 HD13 sing N N 209 LEU CD2 HD21 sing N N 210 LEU CD2 HD22 sing N N 211 LEU CD2 HD23 sing N N 212 LEU OXT HXT sing N N 213 LYS N CA sing N N 214 LYS N H sing N N 215 LYS N H2 sing N N 216 LYS CA C sing N N 217 LYS CA CB sing N N 218 LYS CA HA sing N N 219 LYS C O doub N N 220 LYS C OXT sing N N 221 LYS CB CG sing N N 222 LYS CB HB2 sing N N 223 LYS CB HB3 sing N N 224 LYS CG CD sing N N 225 LYS CG HG2 sing N N 226 LYS CG HG3 sing N N 227 LYS CD CE sing N N 228 LYS CD HD2 sing N N 229 LYS CD HD3 sing N N 230 LYS CE NZ sing N N 231 LYS CE HE2 sing N N 232 LYS CE HE3 sing N N 233 LYS NZ HZ1 sing N N 234 LYS NZ HZ2 sing N N 235 LYS NZ HZ3 sing N N 236 LYS OXT HXT sing N N 237 PHE N CA sing N N 238 PHE N H sing N N 239 PHE N H2 sing N N 240 PHE CA C sing N N 241 PHE CA CB sing N N 242 PHE CA HA sing N N 243 PHE C O doub N N 244 PHE C OXT sing N N 245 PHE CB CG sing N N 246 PHE CB HB2 sing N N 247 PHE CB HB3 sing N N 248 PHE CG CD1 doub Y N 249 PHE CG CD2 sing Y N 250 PHE CD1 CE1 sing Y N 251 PHE CD1 HD1 sing N N 252 PHE CD2 CE2 doub Y N 253 PHE CD2 HD2 sing N N 254 PHE CE1 CZ doub Y N 255 PHE CE1 HE1 sing N N 256 PHE CE2 CZ sing Y N 257 PHE CE2 HE2 sing N N 258 PHE CZ HZ sing N N 259 PHE OXT HXT sing N N 260 PRO N CA sing N N 261 PRO N CD sing N N 262 PRO N H sing N N 263 PRO CA C sing N N 264 PRO CA CB sing N N 265 PRO CA HA sing N N 266 PRO C O doub N N 267 PRO C OXT sing N N 268 PRO CB CG sing N N 269 PRO CB HB2 sing N N 270 PRO CB HB3 sing N N 271 PRO CG CD sing N N 272 PRO CG HG2 sing N N 273 PRO CG HG3 sing N N 274 PRO CD HD2 sing N N 275 PRO CD HD3 sing N N 276 PRO OXT HXT sing N N 277 SER N CA sing N N 278 SER N H sing N N 279 SER N H2 sing N N 280 SER CA C sing N N 281 SER CA CB sing N N 282 SER CA HA sing N N 283 SER C O doub N N 284 SER C OXT sing N N 285 SER CB OG sing N N 286 SER CB HB2 sing N N 287 SER CB HB3 sing N N 288 SER OG HG sing N N 289 SER OXT HXT sing N N 290 THR N CA sing N N 291 THR N H sing N N 292 THR N H2 sing N N 293 THR CA C sing N N 294 THR CA CB sing N N 295 THR CA HA sing N N 296 THR C O doub N N 297 THR C OXT sing N N 298 THR CB OG1 sing N N 299 THR CB CG2 sing N N 300 THR CB HB sing N N 301 THR OG1 HG1 sing N N 302 THR CG2 HG21 sing N N 303 THR CG2 HG22 sing N N 304 THR CG2 HG23 sing N N 305 THR OXT HXT sing N N 306 TRP N CA sing N N 307 TRP N H sing N N 308 TRP N H2 sing N N 309 TRP CA C sing N N 310 TRP CA CB sing N N 311 TRP CA HA sing N N 312 TRP C O doub N N 313 TRP C OXT sing N N 314 TRP CB CG sing N N 315 TRP CB HB2 sing N N 316 TRP CB HB3 sing N N 317 TRP CG CD1 doub Y N 318 TRP CG CD2 sing Y N 319 TRP CD1 NE1 sing Y N 320 TRP CD1 HD1 sing N N 321 TRP CD2 CE2 doub Y N 322 TRP CD2 CE3 sing Y N 323 TRP NE1 CE2 sing Y N 324 TRP NE1 HE1 sing N N 325 TRP CE2 CZ2 sing Y N 326 TRP CE3 CZ3 doub Y N 327 TRP CE3 HE3 sing N N 328 TRP CZ2 CH2 doub Y N 329 TRP CZ2 HZ2 sing N N 330 TRP CZ3 CH2 sing Y N 331 TRP CZ3 HZ3 sing N N 332 TRP CH2 HH2 sing N N 333 TRP OXT HXT sing N N 334 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8HT7 'double helix' 8HT7 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DA 6 1_555 A DT 18 1_555 0.386 2.414 -0.205 3.705 -10.767 165.130 1 A_DA6:DT18_A A 6 ? A 18 ? 21 2 1 A DG 15 1_555 A DG 19 1_555 -0.859 -3.641 -0.406 -2.702 9.990 95.945 2 A_DG15:DG19_A A 15 ? A 19 ? 6 3 1 A DG 7 1_555 A DG 3 1_555 0.730 3.693 0.382 2.603 -11.703 -93.102 3 A_DG7:DG3_A A 7 ? A 3 ? 6 3 1 A DG 8 1_555 A DG 2 1_555 0.777 3.653 0.187 -2.053 -1.621 -98.179 4 A_DG8:DG2_A A 8 ? A 2 ? 6 3 1 A DG 20 1_555 A DG 14 1_555 0.895 3.737 0.076 -0.846 -0.495 -91.695 5 A_DG20:DG14_A A 20 ? A 14 ? 6 3 1 A DG 21 1_555 A DG 13 1_555 -0.911 -3.703 -0.028 -1.215 1.000 93.349 6 A_DG21:DG13_A A 21 ? A 13 ? 6 3 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DA 6 1_555 A DT 18 1_555 A DG 15 1_555 A DG 19 1_555 -2.362 2.765 -0.770 68.946 140.518 -122.406 -1.147 -1.306 -1.362 -71.533 35.098 -168.751 1 AA_DA6DG15:DG19DT18_AA A 6 ? A 18 ? A 15 ? A 19 ? 1 A DG 7 1_555 A DG 3 1_555 A DG 8 1_555 A DG 2 1_555 0.975 1.228 -3.408 2.112 -5.803 -21.790 -5.254 1.710 -3.061 14.968 5.448 -22.638 2 AA_DG7DG8:DG2DG3_AA A 7 ? A 3 ? A 8 ? A 2 ? 1 A DG 8 1_555 A DG 2 1_555 A DG 20 1_555 A DG 14 1_555 1.964 3.554 -0.039 0.086 1.735 -179.351 -1.777 0.982 -0.040 -0.868 0.043 -179.351 3 AA_DG8DG20:DG14DG2_AA A 8 ? A 2 ? A 20 ? A 14 ? 1 A DG 20 1_555 A DG 14 1_555 A DG 21 1_555 A DG 13 1_555 -4.017 1.060 -1.154 80.773 -159.096 -127.091 -0.630 -2.060 0.198 79.621 40.424 -179.299 4 AA_DG20DG21:DG13DG14_AA A 20 ? A 14 ? A 21 ? A 13 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'The University Grants Committee, Research Grants Council (RGC)' 'Hong Kong' ? 1 'National Natural Science Foundation of China (NSFC)' China ? 2 # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 INOVA ? Varian 800 ? 2 INOVA ? Varian 750 ? 3 INOVA ? Varian 500 ? # _atom_sites.entry_id 8HT7 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_ #