data_8HZF # _entry.id 8HZF # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8HZF pdb_00008hzf 10.2210/pdb8hzf/pdb WWPDB D_1300034645 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2024-06-19 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8HZF _pdbx_database_status.recvd_initial_deposition_date 2023-01-09 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 3 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Aiming _pdbx_contact_author.name_last Ren _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Huang, K.Y.' 1 ? 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Nat.Chem.Biol. _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 1552-4469 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Structural basis of a small monomeric Clivia fluorogenic RNA with a large Stokes shift.' _citation.year 2024 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41589-024-01633-1 _citation.pdbx_database_id_PubMed 38816645 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Huang, K.' 1 ? primary 'Song, Q.' 2 0000-0003-1990-4096 primary 'Fang, M.' 3 ? primary 'Yao, D.' 4 ? primary 'Shen, X.' 5 0009-0007-0384-2755 primary 'Xu, X.' 6 ? primary 'Chen, X.' 7 0000-0002-8475-332X primary 'Zhu, L.' 8 0000-0002-0398-7213 primary 'Yang, Y.' 9 0000-0001-7896-1184 primary 'Ren, A.' 10 0000-0002-5420-4899 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (36-MER)' 11274.813 2 ? ? ? ? 2 non-polymer syn "GUANOSINE-5'-TRIPHOSPHATE" 523.180 2 ? ? ? ? 3 non-polymer syn 'POTASSIUM ION' 39.098 2 ? ? ? ? 4 non-polymer syn 'MAGNESIUM ION' 24.305 4 ? ? ? ? 5 non-polymer syn '(5~{Z})-5-[[3,5-bis(fluoranyl)-4-oxidanyl-phenyl]methylidene]-2-[(~{E})-2-(4-hydroxyphenyl)ethenyl]-3-methyl-imidazol-4-one' 356.323 2 ? ? ? ? 6 water nat water 18.015 12 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GAAGAUUGUAAACAUGCCGAAAGGCAGACACUUCC _entity_poly.pdbx_seq_one_letter_code_can GAAGAUUGUAAACAUGCCGAAAGGCAGACACUUCC _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 "GUANOSINE-5'-TRIPHOSPHATE" GTP 3 'POTASSIUM ION' K 4 'MAGNESIUM ION' MG 5 '(5~{Z})-5-[[3,5-bis(fluoranyl)-4-oxidanyl-phenyl]methylidene]-2-[(~{E})-2-(4-hydroxyphenyl)ethenyl]-3-methyl-imidazol-4-one' NJL 6 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 A n 1 3 A n 1 4 G n 1 5 A n 1 6 U n 1 7 U n 1 8 G n 1 9 U n 1 10 A n 1 11 A n 1 12 A n 1 13 C n 1 14 A n 1 15 U n 1 16 G n 1 17 C n 1 18 C n 1 19 G n 1 20 A n 1 21 A n 1 22 A n 1 23 G n 1 24 G n 1 25 C n 1 26 A n 1 27 G n 1 28 A n 1 29 C n 1 30 A n 1 31 C n 1 32 U n 1 33 U n 1 34 C n 1 35 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 35 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'synthetic construct' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 32630 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 K non-polymer . 'POTASSIUM ION' ? 'K 1' 39.098 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 NJL non-polymer . '(5~{Z})-5-[[3,5-bis(fluoranyl)-4-oxidanyl-phenyl]methylidene]-2-[(~{E})-2-(4-hydroxyphenyl)ethenyl]-3-methyl-imidazol-4-one' ? 'C19 H14 F2 N2 O3' 356.323 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 2 2 G G A . n A 1 2 A 2 3 3 A A A . n A 1 3 A 3 4 4 A A A . n A 1 4 G 4 5 5 G G A . n A 1 5 A 5 6 6 A A A . n A 1 6 U 6 7 7 U U A . n A 1 7 U 7 8 8 U U A . n A 1 8 G 8 9 9 G G A . n A 1 9 U 9 10 10 U U A . n A 1 10 A 10 11 11 A A A . n A 1 11 A 11 12 12 A A A . n A 1 12 A 12 13 13 A A A . n A 1 13 C 13 14 14 C C A . n A 1 14 A 14 15 15 A A A . n A 1 15 U 15 16 16 U U A . n A 1 16 G 16 17 17 G G A . n A 1 17 C 17 18 18 C C A . n A 1 18 C 18 19 19 C C A . n A 1 19 G 19 20 20 G G A . n A 1 20 A 20 21 21 A A A . n A 1 21 A 21 22 22 A A A . n A 1 22 A 22 23 23 A A A . n A 1 23 G 23 24 24 G G A . n A 1 24 G 24 25 25 G G A . n A 1 25 C 25 26 26 C C A . n A 1 26 A 26 27 27 A A A . n A 1 27 G 27 28 28 G G A . n A 1 28 A 28 29 29 A A A . n A 1 29 C 29 30 30 C C A . n A 1 30 A 30 31 31 A A A . n A 1 31 C 31 32 32 C C A . n A 1 32 U 32 33 33 U U A . n A 1 33 U 33 34 34 U U A . n A 1 34 C 34 35 35 C C A . n A 1 35 C 35 36 36 C C A . n B 1 1 G 1 2 2 G G B . n B 1 2 A 2 3 3 A A B . n B 1 3 A 3 4 4 A A B . n B 1 4 G 4 5 5 G G B . n B 1 5 A 5 6 6 A A B . n B 1 6 U 6 7 7 U U B . n B 1 7 U 7 8 8 U U B . n B 1 8 G 8 9 9 G G B . n B 1 9 U 9 10 10 U U B . n B 1 10 A 10 11 11 A A B . n B 1 11 A 11 12 12 A A B . n B 1 12 A 12 13 13 A A B . n B 1 13 C 13 14 14 C C B . n B 1 14 A 14 15 15 A A B . n B 1 15 U 15 16 16 U U B . n B 1 16 G 16 17 17 G G B . n B 1 17 C 17 18 18 C C B . n B 1 18 C 18 19 19 C C B . n B 1 19 G 19 20 20 G G B . n B 1 20 A 20 21 21 A A B . n B 1 21 A 21 22 22 A A B . n B 1 22 A 22 23 23 A A B . n B 1 23 G 23 24 24 G G B . n B 1 24 G 24 25 25 G G B . n B 1 25 C 25 26 26 C C B . n B 1 26 A 26 27 27 A A B . n B 1 27 G 27 28 28 G G B . n B 1 28 A 28 29 29 A A B . n B 1 29 C 29 30 30 C C B . n B 1 30 A 30 31 31 A A B . n B 1 31 C 31 32 32 C C B . n B 1 32 U 32 33 33 U U B . n B 1 33 U 33 34 34 U U B . n B 1 34 C 34 35 35 C C B . n B 1 35 C 35 36 36 C C B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 GTP 1 101 1 GTP GTP A . D 3 K 1 102 2 K K A . E 4 MG 1 103 1 MG MG A . F 4 MG 1 104 4 MG MG A . G 5 NJL 1 105 1 NJL LIG A . H 2 GTP 1 101 1 GTP GTP B . I 3 K 1 102 1 K K B . J 4 MG 1 103 2 MG MG B . K 4 MG 1 104 3 MG MG B . L 5 NJL 1 105 2 NJL LIG B . M 6 HOH 1 201 3 HOH HOH A . M 6 HOH 2 202 6 HOH HOH A . M 6 HOH 3 203 12 HOH HOH A . N 6 HOH 1 201 1 HOH HOH B . N 6 HOH 2 202 10 HOH HOH B . N 6 HOH 3 203 4 HOH HOH B . N 6 HOH 4 204 11 HOH HOH B . N 6 HOH 5 205 9 HOH HOH B . N 6 HOH 6 206 2 HOH HOH B . N 6 HOH 7 207 7 HOH HOH B . N 6 HOH 8 208 5 HOH HOH B . N 6 HOH 9 209 8 HOH HOH B . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.18.2_3874: ???)' 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? 3.25 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-3000 ? ? ? . 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 5 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 115.26 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 8HZF _cell.details ? _cell.formula_units_Z ? _cell.length_a 84.634 _cell.length_a_esd ? _cell.length_b 47.237 _cell.length_b_esd ? _cell.length_c 56.170 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8HZF _symmetry.cell_setting ? _symmetry.Int_Tables_number 5 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'C 1 2 1' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8HZF _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.16 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 42.92 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '0.1 M Bicine pH8.5, 65%MPD' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2020-04-28 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.1020 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL19U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.1020 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL19U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 8HZF _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.70 _reflns.d_resolution_low 50.00 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 5579 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 98.9 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 6.7 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 2.8 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 0.565 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.169 _reflns.pdbx_Rpim_I_all 0.065 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half ? _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.156 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.percent_possible_all _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 2.70 2.80 ? ? ? ? ? ? 557 ? ? ? ? ? ? ? ? ? ? ? 6.7 0.444 ? ? 1.376 0.528 ? 1 1 0.735 0.921 ? 99.6 ? 1.268 ? ? ? ? ? ? ? ? ? 2.80 2.91 ? ? ? ? ? ? 544 ? ? ? ? ? ? ? ? ? ? ? 6.7 0.465 ? ? 1.062 0.407 ? 2 1 0.873 0.965 ? 99.8 ? 0.979 ? ? ? ? ? ? ? ? ? 2.91 3.04 ? ? ? ? ? ? 551 ? ? ? ? ? ? ? ? ? ? ? 6.6 0.482 ? ? 0.584 0.224 ? 3 1 0.959 0.990 ? 99.1 ? 0.538 ? ? ? ? ? ? ? ? ? 3.04 3.20 ? ? ? ? ? ? 558 ? ? ? ? ? ? ? ? ? ? ? 6.1 0.498 ? ? 0.315 0.125 ? 4 1 0.990 0.998 ? 97.0 ? 0.288 ? ? ? ? ? ? ? ? ? 3.20 3.40 ? ? ? ? ? ? 546 ? ? ? ? ? ? ? ? ? ? ? 6.9 0.566 ? ? 0.239 0.090 ? 5 1 0.989 0.997 ? 99.1 ? 0.221 ? ? ? ? ? ? ? ? ? 3.40 3.66 ? ? ? ? ? ? 565 ? ? ? ? ? ? ? ? ? ? ? 7.0 0.566 ? ? 0.205 0.076 ? 6 1 0.993 0.998 ? 99.8 ? 0.190 ? ? ? ? ? ? ? ? ? 3.66 4.03 ? ? ? ? ? ? 565 ? ? ? ? ? ? ? ? ? ? ? 6.9 0.564 ? ? 0.169 0.064 ? 7 1 0.996 0.999 ? 99.6 ? 0.157 ? ? ? ? ? ? ? ? ? 4.03 4.62 ? ? ? ? ? ? 547 ? ? ? ? ? ? ? ? ? ? ? 6.5 0.596 ? ? 0.146 0.056 ? 8 1 0.995 0.999 ? 97.3 ? 0.134 ? ? ? ? ? ? ? ? ? 4.62 5.81 ? ? ? ? ? ? 566 ? ? ? ? ? ? ? ? ? ? ? 6.8 0.588 ? ? 0.101 0.038 ? 9 1 0.994 0.998 ? 99.5 ? 0.093 ? ? ? ? ? ? ? ? ? 5.81 50.00 ? ? ? ? ? ? 580 ? ? ? ? ? ? ? ? ? ? ? 6.4 0.867 ? ? 0.079 0.031 ? 10 1 0.998 0.999 ? 98.1 ? 0.072 ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8HZF _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.70 _refine.ls_d_res_low 40.20 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 5526 _refine.ls_number_reflns_R_free 283 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 97.31 _refine.ls_percent_reflns_R_free 5.12 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.1860 _refine.ls_R_factor_R_free 0.2558 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1823 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.36 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 8HZE _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 19.71 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.41 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.70 _refine_hist.d_res_low 40.20 _refine_hist.number_atoms_solvent 12 _refine_hist.number_atoms_total 1634 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1564 _refine_hist.pdbx_number_atoms_ligand 58 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.006 ? 1804 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.370 ? 2802 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 16.572 ? 870 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.055 ? 358 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.008 ? 80 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.70 3.39 . . 147 2544 96.00 . . . . 0.2514 . . . . . . . . . . . 0.3650 'X-RAY DIFFRACTION' 3.39 10 . . 136 2699 98.00 . . . . 0.1568 . . . . . . . . . . . 0.2150 # _struct.entry_id 8HZF _struct.title 'A new fluorescent RNA aptamer bound with N565' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8HZF _struct_keywords.text 'Fluorescent RNA aptamer, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 3 ? E N N 4 ? F N N 4 ? G N N 5 ? H N N 2 ? I N N 3 ? J N N 4 ? K N N 4 ? L N N 5 ? M N N 6 ? N N N 6 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8HZF _struct_ref.pdbx_db_accession 8HZF _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 8HZF A 1 ? 35 ? 8HZF 2 ? 36 ? 2 36 2 1 8HZF B 1 ? 35 ? 8HZF 2 ? 36 ? 2 36 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 2890 ? 1 MORE -45 ? 1 'SSA (A^2)' 11070 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J,K,L,M,N # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0 _pdbx_struct_oper_list.matrix[1][2] 0.0 _pdbx_struct_oper_list.matrix[1][3] 0.0 _pdbx_struct_oper_list.vector[1] 0.0 _pdbx_struct_oper_list.matrix[2][1] 0.0 _pdbx_struct_oper_list.matrix[2][2] 1.0 _pdbx_struct_oper_list.matrix[2][3] 0.0 _pdbx_struct_oper_list.vector[2] 0.0 _pdbx_struct_oper_list.matrix[3][1] 0.0 _pdbx_struct_oper_list.matrix[3][2] 0.0 _pdbx_struct_oper_list.matrix[3][3] 1.0 _pdbx_struct_oper_list.vector[3] 0.0 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A G 1 P ? ? ? 1_555 C GTP . "O3'" ? ? A G 2 A GTP 101 1_555 ? ? ? ? ? ? ? 1.576 ? ? covale2 covale both ? B G 1 P ? ? ? 1_555 H GTP . "O3'" ? ? B G 2 B GTP 101 1_555 ? ? ? ? ? ? ? 1.570 ? ? metalc1 metalc ? ? A U 7 OP1 ? ? ? 1_555 I K . K ? ? A U 8 B K 102 1_555 ? ? ? ? ? ? ? 2.903 ? ? metalc2 metalc ? ? A G 19 "O3'" ? ? ? 1_555 D K . K ? ? A G 20 A K 102 1_555 ? ? ? ? ? ? ? 2.683 ? ? metalc3 metalc ? ? A G 19 "O2'" ? ? ? 1_555 D K . K ? ? A G 20 A K 102 1_555 ? ? ? ? ? ? ? 2.766 ? ? metalc4 metalc ? ? A G 19 OP2 ? ? ? 1_555 E MG . MG ? ? A G 20 A MG 103 1_555 ? ? ? ? ? ? ? 2.522 ? ? metalc5 metalc ? ? A A 20 OP1 ? ? ? 1_555 D K . K ? ? A A 21 A K 102 1_555 ? ? ? ? ? ? ? 3.448 ? ? metalc6 metalc ? ? D K . K ? ? ? 1_555 B U 7 OP1 ? ? A K 102 B U 8 1_555 ? ? ? ? ? ? ? 3.298 ? ? metalc7 metalc ? ? E MG . MG ? ? ? 1_555 M HOH . O ? ? A MG 103 A HOH 203 1_555 ? ? ? ? ? ? ? 2.329 ? ? metalc8 metalc ? ? F MG . MG ? ? ? 1_555 M HOH . O ? ? A MG 104 A HOH 202 1_555 ? ? ? ? ? ? ? 1.903 ? ? metalc9 metalc ? ? F MG . MG ? ? ? 1_555 N HOH . O ? ? A MG 104 B HOH 203 1_555 ? ? ? ? ? ? ? 2.148 ? ? metalc10 metalc ? ? F MG . MG ? ? ? 1_555 N HOH . O ? ? A MG 104 B HOH 204 1_555 ? ? ? ? ? ? ? 2.240 ? ? metalc11 metalc ? ? F MG . MG ? ? ? 1_555 N HOH . O ? ? A MG 104 B HOH 207 1_555 ? ? ? ? ? ? ? 2.117 ? ? metalc12 metalc ? ? F MG . MG ? ? ? 1_555 N HOH . O ? ? A MG 104 B HOH 208 1_555 ? ? ? ? ? ? ? 2.659 ? ? metalc13 metalc ? ? B G 19 "O3'" ? ? ? 1_555 I K . K ? ? B G 20 B K 102 1_555 ? ? ? ? ? ? ? 2.974 ? ? metalc14 metalc ? ? B G 19 "O2'" ? ? ? 1_555 I K . K ? ? B G 20 B K 102 1_555 ? ? ? ? ? ? ? 3.306 ? ? metalc15 metalc ? ? B G 19 OP2 ? ? ? 1_555 J MG . MG ? ? B G 20 B MG 103 1_555 ? ? ? ? ? ? ? 2.175 ? ? metalc16 metalc ? ? B C 29 OP2 ? ? ? 1_555 K MG . MG ? ? B C 30 B MG 104 1_555 ? ? ? ? ? ? ? 2.580 ? ? metalc17 metalc ? ? B A 30 OP2 ? ? ? 1_555 K MG . MG ? ? B A 31 B MG 104 1_555 ? ? ? ? ? ? ? 2.242 ? ? metalc18 metalc ? ? J MG . MG ? ? ? 1_555 N HOH . O ? ? B MG 103 B HOH 205 1_555 ? ? ? ? ? ? ? 2.397 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 2 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 2 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 2 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A A 2 N1 ? ? ? 1_555 A U 33 N3 ? ? A A 3 A U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A A 2 N6 ? ? ? 1_555 A U 33 O4 ? ? A A 3 A U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 32 N3 ? ? A A 4 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 32 O4 ? ? A A 4 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 4 N2 ? ? ? 1_555 A A 11 N1 ? ? A G 5 A A 12 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog9 hydrog ? ? A G 4 N3 ? ? ? 1_555 A A 11 N6 ? ? A G 5 A A 12 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog10 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 5 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 5 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 5 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 5 N6 ? ? ? 1_555 A A 12 N1 ? ? A A 6 A A 13 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog14 hydrog ? ? A A 5 N7 ? ? ? 1_555 A A 12 N6 ? ? A A 6 A A 13 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog15 hydrog ? ? A A 5 N1 ? ? ? 1_555 A A 30 N6 ? ? A A 6 A A 31 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog16 hydrog ? ? A A 5 N6 ? ? ? 1_555 A A 30 N1 ? ? A A 6 A A 31 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog17 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 28 N7 ? ? A U 8 A A 29 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog18 hydrog ? ? A U 7 O2 ? ? ? 1_555 A A 28 N6 ? ? A U 8 A A 29 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog19 hydrog ? ? A A 10 N6 ? ? ? 1_555 A U 32 O2 ? ? A A 11 A U 33 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog20 hydrog ? ? A C 13 N3 ? ? ? 1_555 A A 28 N6 ? ? A C 14 A A 29 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog21 hydrog ? ? A A 14 N7 ? ? ? 1_555 A G 27 N2 ? ? A A 15 A G 28 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog22 hydrog ? ? A U 15 N3 ? ? ? 1_555 A A 26 N1 ? ? A U 16 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A U 15 O4 ? ? ? 1_555 A A 26 N6 ? ? A U 16 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 16 N1 ? ? ? 1_555 A C 25 N3 ? ? A G 17 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 16 N2 ? ? ? 1_555 A C 25 O2 ? ? A G 17 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 16 O6 ? ? ? 1_555 A C 25 N4 ? ? A G 17 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 17 N3 ? ? ? 1_555 A G 24 N1 ? ? A C 18 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 17 N4 ? ? ? 1_555 A G 24 O6 ? ? A C 18 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 17 O2 ? ? ? 1_555 A G 24 N2 ? ? A C 18 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 18 N3 ? ? ? 1_555 A G 23 N1 ? ? A C 19 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 18 N4 ? ? ? 1_555 A G 23 O6 ? ? A C 19 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 18 O2 ? ? ? 1_555 A G 23 N2 ? ? A C 19 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 19 N2 ? ? ? 1_555 A A 22 N7 ? ? A G 20 A A 23 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog34 hydrog ? ? B G 1 N1 ? ? ? 1_555 B C 34 N3 ? ? B G 2 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? B G 1 N2 ? ? ? 1_555 B C 34 O2 ? ? B G 2 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? B G 1 O6 ? ? ? 1_555 B C 34 N4 ? ? B G 2 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? B A 2 N1 ? ? ? 1_555 B U 33 N3 ? ? B A 3 B U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? B A 2 N6 ? ? ? 1_555 B U 33 O4 ? ? B A 3 B U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? B A 3 N1 ? ? ? 1_555 B U 32 N3 ? ? B A 4 B U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? B A 3 N6 ? ? ? 1_555 B U 32 O4 ? ? B A 4 B U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? B G 4 N2 ? ? ? 1_555 B A 11 N1 ? ? B G 5 B A 12 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog42 hydrog ? ? B G 4 N3 ? ? ? 1_555 B A 11 N6 ? ? B G 5 B A 12 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog43 hydrog ? ? B G 4 N1 ? ? ? 1_555 B C 31 N3 ? ? B G 5 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? B G 4 N2 ? ? ? 1_555 B C 31 O2 ? ? B G 5 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? B G 4 O6 ? ? ? 1_555 B C 31 N4 ? ? B G 5 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? B A 5 N6 ? ? ? 1_555 B A 12 N1 ? ? B A 6 B A 13 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog47 hydrog ? ? B A 5 N7 ? ? ? 1_555 B A 12 N6 ? ? B A 6 B A 13 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog48 hydrog ? ? B A 5 N1 ? ? ? 1_555 B A 30 N6 ? ? B A 6 B A 31 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog49 hydrog ? ? B A 5 N6 ? ? ? 1_555 B A 30 N1 ? ? B A 6 B A 31 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog50 hydrog ? ? B U 7 N3 ? ? ? 1_555 B A 28 N7 ? ? B U 8 B A 29 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog51 hydrog ? ? B U 7 O2 ? ? ? 1_555 B A 28 N6 ? ? B U 8 B A 29 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog52 hydrog ? ? B A 10 N6 ? ? ? 1_555 B U 32 O2 ? ? B A 11 B U 33 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog53 hydrog ? ? B C 13 N3 ? ? ? 1_555 B A 28 N6 ? ? B C 14 B A 29 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog54 hydrog ? ? B U 15 N3 ? ? ? 1_555 B A 26 N1 ? ? B U 16 B A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? B U 15 O4 ? ? ? 1_555 B A 26 N6 ? ? B U 16 B A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? B G 16 N1 ? ? ? 1_555 B C 25 N3 ? ? B G 17 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? B G 16 N2 ? ? ? 1_555 B C 25 O2 ? ? B G 17 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? B G 16 O6 ? ? ? 1_555 B C 25 N4 ? ? B G 17 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? B C 17 N3 ? ? ? 1_555 B G 24 N1 ? ? B C 18 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? B C 17 N4 ? ? ? 1_555 B G 24 O6 ? ? B C 18 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? B C 17 O2 ? ? ? 1_555 B G 24 N2 ? ? B C 18 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? B C 18 N3 ? ? ? 1_555 B G 23 N1 ? ? B C 19 B G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? B C 18 N4 ? ? ? 1_555 B G 23 O6 ? ? B C 19 B G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? B C 18 O2 ? ? ? 1_555 B G 23 N2 ? ? B C 19 B G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? B G 19 N2 ? ? ? 1_555 B A 22 N7 ? ? B G 20 B A 23 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 OP1 ? A U 7 ? A U 8 ? 1_555 K ? I K . ? B K 102 ? 1_555 "O3'" ? B G 19 ? B G 20 ? 1_555 169.5 ? 2 OP1 ? A U 7 ? A U 8 ? 1_555 K ? I K . ? B K 102 ? 1_555 "O2'" ? B G 19 ? B G 20 ? 1_555 123.2 ? 3 "O3'" ? B G 19 ? B G 20 ? 1_555 K ? I K . ? B K 102 ? 1_555 "O2'" ? B G 19 ? B G 20 ? 1_555 53.3 ? 4 "O3'" ? A G 19 ? A G 20 ? 1_555 K ? D K . ? A K 102 ? 1_555 "O2'" ? A G 19 ? A G 20 ? 1_555 61.4 ? 5 "O3'" ? A G 19 ? A G 20 ? 1_555 K ? D K . ? A K 102 ? 1_555 OP1 ? A A 20 ? A A 21 ? 1_555 43.8 ? 6 "O2'" ? A G 19 ? A G 20 ? 1_555 K ? D K . ? A K 102 ? 1_555 OP1 ? A A 20 ? A A 21 ? 1_555 95.6 ? 7 "O3'" ? A G 19 ? A G 20 ? 1_555 K ? D K . ? A K 102 ? 1_555 OP1 ? B U 7 ? B U 8 ? 1_555 162.8 ? 8 "O2'" ? A G 19 ? A G 20 ? 1_555 K ? D K . ? A K 102 ? 1_555 OP1 ? B U 7 ? B U 8 ? 1_555 133.4 ? 9 OP1 ? A A 20 ? A A 21 ? 1_555 K ? D K . ? A K 102 ? 1_555 OP1 ? B U 7 ? B U 8 ? 1_555 119.5 ? 10 OP2 ? A G 19 ? A G 20 ? 1_555 MG ? E MG . ? A MG 103 ? 1_555 O ? M HOH . ? A HOH 203 ? 1_555 83.4 ? 11 O ? M HOH . ? A HOH 202 ? 1_555 MG ? F MG . ? A MG 104 ? 1_555 O ? N HOH . ? B HOH 203 ? 1_555 97.5 ? 12 O ? M HOH . ? A HOH 202 ? 1_555 MG ? F MG . ? A MG 104 ? 1_555 O ? N HOH . ? B HOH 204 ? 1_555 85.0 ? 13 O ? N HOH . ? B HOH 203 ? 1_555 MG ? F MG . ? A MG 104 ? 1_555 O ? N HOH . ? B HOH 204 ? 1_555 144.3 ? 14 O ? M HOH . ? A HOH 202 ? 1_555 MG ? F MG . ? A MG 104 ? 1_555 O ? N HOH . ? B HOH 207 ? 1_555 160.6 ? 15 O ? N HOH . ? B HOH 203 ? 1_555 MG ? F MG . ? A MG 104 ? 1_555 O ? N HOH . ? B HOH 207 ? 1_555 95.9 ? 16 O ? N HOH . ? B HOH 204 ? 1_555 MG ? F MG . ? A MG 104 ? 1_555 O ? N HOH . ? B HOH 207 ? 1_555 92.3 ? 17 O ? M HOH . ? A HOH 202 ? 1_555 MG ? F MG . ? A MG 104 ? 1_555 O ? N HOH . ? B HOH 208 ? 1_555 107.3 ? 18 O ? N HOH . ? B HOH 203 ? 1_555 MG ? F MG . ? A MG 104 ? 1_555 O ? N HOH . ? B HOH 208 ? 1_555 60.5 ? 19 O ? N HOH . ? B HOH 204 ? 1_555 MG ? F MG . ? A MG 104 ? 1_555 O ? N HOH . ? B HOH 208 ? 1_555 84.7 ? 20 O ? N HOH . ? B HOH 207 ? 1_555 MG ? F MG . ? A MG 104 ? 1_555 O ? N HOH . ? B HOH 208 ? 1_555 91.5 ? 21 OP2 ? B G 19 ? B G 20 ? 1_555 MG ? J MG . ? B MG 103 ? 1_555 O ? N HOH . ? B HOH 205 ? 1_555 95.6 ? 22 OP2 ? B C 29 ? B C 30 ? 1_555 MG ? K MG . ? B MG 104 ? 1_555 OP2 ? B A 30 ? B A 31 ? 1_555 88.5 ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "O3'" A C 36 ? ? O A HOH 201 ? ? 2.03 2 1 "O3'" B C 36 ? ? O B HOH 201 ? ? 2.10 3 1 OP2 B G 2 ? ? "O3'" B GTP 101 ? ? 2.11 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 C6 B G 28 ? ? C5 B G 28 ? ? N7 B G 28 ? ? 126.28 130.40 -4.12 0.60 N 2 1 N1 B G 28 ? ? C6 B G 28 ? ? O6 B G 28 ? ? 124.53 119.90 4.63 0.60 N 3 1 C5 B G 28 ? ? C6 B G 28 ? ? O6 B G 28 ? ? 124.96 128.60 -3.64 0.60 N # _pdbx_entry_details.entry_id 8HZF _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification ? # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GTP PG P N N 111 GTP O1G O N N 112 GTP O2G O N N 113 GTP O3G O N N 114 GTP O3B O N N 115 GTP PB P N N 116 GTP O1B O N N 117 GTP O2B O N N 118 GTP O3A O N N 119 GTP PA P N N 120 GTP O1A O N N 121 GTP O2A O N N 122 GTP "O5'" O N N 123 GTP "C5'" C N N 124 GTP "C4'" C N R 125 GTP "O4'" O N N 126 GTP "C3'" C N S 127 GTP "O3'" O N N 128 GTP "C2'" C N R 129 GTP "O2'" O N N 130 GTP "C1'" C N R 131 GTP N9 N Y N 132 GTP C8 C Y N 133 GTP N7 N Y N 134 GTP C5 C Y N 135 GTP C6 C N N 136 GTP O6 O N N 137 GTP N1 N N N 138 GTP C2 C N N 139 GTP N2 N N N 140 GTP N3 N N N 141 GTP C4 C Y N 142 GTP HOG2 H N N 143 GTP HOG3 H N N 144 GTP HOB2 H N N 145 GTP HOA2 H N N 146 GTP "H5'" H N N 147 GTP "H5''" H N N 148 GTP "H4'" H N N 149 GTP "H3'" H N N 150 GTP "HO3'" H N N 151 GTP "H2'" H N N 152 GTP "HO2'" H N N 153 GTP "H1'" H N N 154 GTP H8 H N N 155 GTP HN1 H N N 156 GTP HN21 H N N 157 GTP HN22 H N N 158 HOH O O N N 159 HOH H1 H N N 160 HOH H2 H N N 161 K K K N N 162 MG MG MG N N 163 NJL C10 C N N 164 NJL N12 N N N 165 NJL C15 C N N 166 NJL C17 C Y N 167 NJL C20 C Y N 168 NJL C21 C Y N 169 NJL C22 C Y N 170 NJL C01 C Y N 171 NJL C02 C Y N 172 NJL C03 C Y N 173 NJL C04 C Y N 174 NJL C05 C Y N 175 NJL C06 C Y N 176 NJL C07 C N N 177 NJL C08 C N N 178 NJL C09 C N N 179 NJL C14 C N N 180 NJL C16 C N N 181 NJL C18 C Y N 182 NJL C19 C Y N 183 NJL F23 F N N 184 NJL F24 F N N 185 NJL N11 N N N 186 NJL O13 O N N 187 NJL O25 O N N 188 NJL O26 O N N 189 NJL H1 H N N 190 NJL H2 H N N 191 NJL H3 H N N 192 NJL H4 H N N 193 NJL H5 H N N 194 NJL H6 H N N 195 NJL H7 H N N 196 NJL H8 H N N 197 NJL H9 H N N 198 NJL H10 H N N 199 NJL H11 H N N 200 NJL H12 H N N 201 NJL H13 H N N 202 NJL H14 H N N 203 U OP3 O N N 204 U P P N N 205 U OP1 O N N 206 U OP2 O N N 207 U "O5'" O N N 208 U "C5'" C N N 209 U "C4'" C N R 210 U "O4'" O N N 211 U "C3'" C N S 212 U "O3'" O N N 213 U "C2'" C N R 214 U "O2'" O N N 215 U "C1'" C N R 216 U N1 N N N 217 U C2 C N N 218 U O2 O N N 219 U N3 N N N 220 U C4 C N N 221 U O4 O N N 222 U C5 C N N 223 U C6 C N N 224 U HOP3 H N N 225 U HOP2 H N N 226 U "H5'" H N N 227 U "H5''" H N N 228 U "H4'" H N N 229 U "H3'" H N N 230 U "HO3'" H N N 231 U "H2'" H N N 232 U "HO2'" H N N 233 U "H1'" H N N 234 U H3 H N N 235 U H5 H N N 236 U H6 H N N 237 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GTP PG O1G doub N N 116 GTP PG O2G sing N N 117 GTP PG O3G sing N N 118 GTP PG O3B sing N N 119 GTP O2G HOG2 sing N N 120 GTP O3G HOG3 sing N N 121 GTP O3B PB sing N N 122 GTP PB O1B doub N N 123 GTP PB O2B sing N N 124 GTP PB O3A sing N N 125 GTP O2B HOB2 sing N N 126 GTP O3A PA sing N N 127 GTP PA O1A doub N N 128 GTP PA O2A sing N N 129 GTP PA "O5'" sing N N 130 GTP O2A HOA2 sing N N 131 GTP "O5'" "C5'" sing N N 132 GTP "C5'" "C4'" sing N N 133 GTP "C5'" "H5'" sing N N 134 GTP "C5'" "H5''" sing N N 135 GTP "C4'" "O4'" sing N N 136 GTP "C4'" "C3'" sing N N 137 GTP "C4'" "H4'" sing N N 138 GTP "O4'" "C1'" sing N N 139 GTP "C3'" "O3'" sing N N 140 GTP "C3'" "C2'" sing N N 141 GTP "C3'" "H3'" sing N N 142 GTP "O3'" "HO3'" sing N N 143 GTP "C2'" "O2'" sing N N 144 GTP "C2'" "C1'" sing N N 145 GTP "C2'" "H2'" sing N N 146 GTP "O2'" "HO2'" sing N N 147 GTP "C1'" N9 sing N N 148 GTP "C1'" "H1'" sing N N 149 GTP N9 C8 sing Y N 150 GTP N9 C4 sing Y N 151 GTP C8 N7 doub Y N 152 GTP C8 H8 sing N N 153 GTP N7 C5 sing Y N 154 GTP C5 C6 sing N N 155 GTP C5 C4 doub Y N 156 GTP C6 O6 doub N N 157 GTP C6 N1 sing N N 158 GTP N1 C2 sing N N 159 GTP N1 HN1 sing N N 160 GTP C2 N2 sing N N 161 GTP C2 N3 doub N N 162 GTP N2 HN21 sing N N 163 GTP N2 HN22 sing N N 164 GTP N3 C4 sing N N 165 HOH O H1 sing N N 166 HOH O H2 sing N N 167 NJL F24 C02 sing N N 168 NJL C02 C01 doub Y N 169 NJL C02 C03 sing Y N 170 NJL O25 C03 sing N N 171 NJL C01 C06 sing Y N 172 NJL C03 C04 doub Y N 173 NJL C06 C07 sing N N 174 NJL C06 C05 doub Y N 175 NJL O13 C09 doub N N 176 NJL C04 C05 sing Y N 177 NJL C04 F23 sing N N 178 NJL C07 C08 doub N Z 179 NJL C09 C08 sing N N 180 NJL C09 N12 sing N N 181 NJL C08 N11 sing N N 182 NJL N12 C14 sing N N 183 NJL N12 C10 sing N N 184 NJL N11 C10 doub N N 185 NJL C10 C15 sing N N 186 NJL C16 C15 doub N E 187 NJL C16 C17 sing N N 188 NJL C17 C22 doub Y N 189 NJL C17 C18 sing Y N 190 NJL C22 C21 sing Y N 191 NJL C18 C19 doub Y N 192 NJL C21 C20 doub Y N 193 NJL C19 C20 sing Y N 194 NJL C20 O26 sing N N 195 NJL C15 H1 sing N N 196 NJL C21 H2 sing N N 197 NJL C22 H3 sing N N 198 NJL C01 H4 sing N N 199 NJL C05 H5 sing N N 200 NJL C07 H6 sing N N 201 NJL C14 H7 sing N N 202 NJL C14 H8 sing N N 203 NJL C14 H9 sing N N 204 NJL C16 H10 sing N N 205 NJL C18 H11 sing N N 206 NJL C19 H12 sing N N 207 NJL O25 H13 sing N N 208 NJL O26 H14 sing N N 209 U OP3 P sing N N 210 U OP3 HOP3 sing N N 211 U P OP1 doub N N 212 U P OP2 sing N N 213 U P "O5'" sing N N 214 U OP2 HOP2 sing N N 215 U "O5'" "C5'" sing N N 216 U "C5'" "C4'" sing N N 217 U "C5'" "H5'" sing N N 218 U "C5'" "H5''" sing N N 219 U "C4'" "O4'" sing N N 220 U "C4'" "C3'" sing N N 221 U "C4'" "H4'" sing N N 222 U "O4'" "C1'" sing N N 223 U "C3'" "O3'" sing N N 224 U "C3'" "C2'" sing N N 225 U "C3'" "H3'" sing N N 226 U "O3'" "HO3'" sing N N 227 U "C2'" "O2'" sing N N 228 U "C2'" "C1'" sing N N 229 U "C2'" "H2'" sing N N 230 U "O2'" "HO2'" sing N N 231 U "C1'" N1 sing N N 232 U "C1'" "H1'" sing N N 233 U N1 C2 sing N N 234 U N1 C6 sing N N 235 U C2 O2 doub N N 236 U C2 N3 sing N N 237 U N3 C4 sing N N 238 U N3 H3 sing N N 239 U C4 O4 doub N N 240 U C4 C5 sing N N 241 U C5 C6 doub N N 242 U C5 H5 sing N N 243 U C6 H6 sing N N 244 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8HZF 'double helix' 8HZF 'a-form double helix' 8HZF tetraloop 8HZF 'mismatched base pair' 8HZF 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 34 1_555 0.083 0.045 0.030 -5.868 -5.613 -0.766 1 A_G2:C35_A A 2 ? A 35 ? 19 1 1 A A 2 1_555 A U 33 1_555 0.366 -0.185 -0.128 -1.787 -13.423 -2.803 2 A_A3:U34_A A 3 ? A 34 ? 20 1 1 A A 3 1_555 A U 32 1_555 0.064 -0.097 0.423 3.595 -8.936 -3.184 3 A_A4:U33_A A 4 ? A 33 ? 20 1 1 A G 4 1_555 A C 31 1_555 0.254 -0.107 0.353 -2.475 -17.206 2.242 4 A_G5:C32_A A 5 ? A 32 ? 19 1 1 A A 5 1_555 A A 30 1_555 1.179 2.006 0.069 -5.164 3.209 -174.651 5 A_A6:A31_A A 6 ? A 31 ? 1 2 1 A U 7 1_555 A A 28 1_555 3.989 -1.686 -1.348 16.607 -16.379 -99.770 6 A_U8:A29_A A 8 ? A 29 ? 24 4 1 A A 14 1_555 A G 27 1_555 -7.914 -5.456 0.037 -4.998 -9.484 -27.084 7 A_A15:G28_A A 15 ? A 28 ? ? ? 1 A U 15 1_555 A A 26 1_555 -0.509 -0.110 0.141 4.666 -3.540 -3.716 8 A_U16:A27_A A 16 ? A 27 ? 20 1 1 A G 16 1_555 A C 25 1_555 -0.136 -0.327 0.434 8.831 -6.189 2.959 9 A_G17:C26_A A 17 ? A 26 ? 19 1 1 A C 17 1_555 A G 24 1_555 -0.217 -0.210 0.041 5.753 -11.704 7.400 10 A_C18:G25_A A 18 ? A 25 ? 19 1 1 A C 18 1_555 A G 23 1_555 0.126 -0.327 -0.158 1.776 8.739 -9.939 11 A_C19:G24_A A 19 ? A 24 ? 19 1 1 A G 19 1_555 A A 22 1_555 7.521 -5.505 0.549 14.826 2.364 -15.247 12 A_G20:A23_A A 20 ? A 23 ? ? ? 1 B G 1 1_555 B C 34 1_555 -0.949 -0.225 0.848 0.371 -4.167 14.077 13 B_G2:C35_B B 2 ? B 35 ? 19 1 1 B A 2 1_555 B U 33 1_555 0.513 -0.358 0.111 -4.665 -15.046 -5.762 14 B_A3:U34_B B 3 ? B 34 ? 20 1 1 B A 3 1_555 B U 32 1_555 0.385 -0.005 0.997 -6.684 -6.587 1.071 15 B_A4:U33_B B 4 ? B 33 ? 20 1 1 B G 4 1_555 B C 31 1_555 -0.001 0.141 0.133 -8.937 -19.974 1.243 16 B_G5:C32_B B 5 ? B 32 ? 19 1 1 B A 5 1_555 B A 30 1_555 -1.676 -1.511 -0.113 12.171 -4.805 176.576 17 B_A6:A31_B B 6 ? B 31 ? 1 2 1 B U 7 1_555 B A 28 1_555 4.164 -2.082 -0.838 14.143 -16.725 -94.314 18 B_U8:A29_B B 8 ? B 29 ? 24 4 1 B U 15 1_555 B A 26 1_555 0.100 -0.012 -0.394 10.307 -3.341 7.309 19 B_U16:A27_B B 16 ? B 27 ? 20 1 1 B G 16 1_555 B C 25 1_555 -0.199 -0.295 -0.046 7.901 -3.399 1.726 20 B_G17:C26_B B 17 ? B 26 ? 19 1 1 B C 17 1_555 B G 24 1_555 0.738 -0.212 -0.485 13.457 -7.189 2.276 21 B_C18:G25_B B 18 ? B 25 ? 19 1 1 B C 18 1_555 B G 23 1_555 0.289 -0.186 -0.388 6.165 4.606 0.572 22 B_C19:G24_B B 19 ? B 24 ? 19 1 1 B G 19 1_555 B A 22 1_555 7.380 -5.228 0.737 8.805 1.429 -14.639 23 B_G20:A23_B B 20 ? B 23 ? ? 10 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 34 1_555 A A 2 1_555 A U 33 1_555 -0.367 -1.288 3.142 1.189 8.802 35.449 -3.168 0.736 2.742 14.182 -1.915 36.510 1 AA_G2A3:U34C35_AA A 2 ? A 35 ? A 3 ? A 34 ? 1 A A 2 1_555 A U 33 1_555 A A 3 1_555 A U 32 1_555 0.456 -1.315 3.019 -1.353 4.344 30.600 -3.216 -1.089 2.788 8.174 2.547 30.929 2 AA_A3A4:U33U34_AA A 3 ? A 34 ? A 4 ? A 33 ? 1 A A 3 1_555 A U 32 1_555 A G 4 1_555 A C 31 1_555 1.074 -1.848 3.243 8.948 10.746 34.585 -4.257 -0.549 2.753 17.229 -14.346 37.225 3 AA_A4G5:C32U33_AA A 4 ? A 33 ? A 5 ? A 32 ? 1 A G 4 1_555 A C 31 1_555 A A 5 1_555 A A 30 1_555 -3.455 0.578 0.462 86.358 148.691 153.239 0.257 1.746 0.165 74.440 -43.234 178.139 4 AA_G5A6:A31C32_AA A 5 ? A 32 ? A 6 ? A 31 ? 1 A A 5 1_555 A A 30 1_555 A U 7 1_555 A A 28 1_555 -1.967 1.627 -2.284 -132.988 -99.835 156.220 0.677 1.166 -2.114 -50.005 66.611 177.182 5 AA_A6U8:A29A31_AA A 6 ? A 31 ? A 8 ? A 29 ? 1 A A 14 1_555 A G 27 1_555 A U 15 1_555 A A 26 1_555 1.721 -1.415 3.261 -2.351 4.412 64.775 -1.498 -1.699 3.112 4.112 2.191 64.946 6 AA_A15U16:A27G28_AA A 15 ? A 28 ? A 16 ? A 27 ? 1 A U 15 1_555 A A 26 1_555 A G 16 1_555 A C 25 1_555 0.197 -1.816 2.940 -3.536 9.893 32.482 -4.382 -0.794 2.272 17.136 6.125 34.095 7 AA_U16G17:C26A27_AA A 16 ? A 27 ? A 17 ? A 26 ? 1 A G 16 1_555 A C 25 1_555 A C 17 1_555 A G 24 1_555 0.699 -2.217 3.230 3.898 3.306 29.847 -4.891 -0.579 3.037 6.359 -7.498 30.272 8 AA_G17C18:G25C26_AA A 17 ? A 26 ? A 18 ? A 25 ? 1 A C 17 1_555 A G 24 1_555 A C 18 1_555 A G 23 1_555 -1.200 -2.162 3.248 0.279 12.148 34.066 -5.005 1.970 2.356 19.964 -0.459 36.108 9 AA_C18C19:G24G25_AA A 18 ? A 25 ? A 19 ? A 24 ? 1 A C 18 1_555 A G 23 1_555 A G 19 1_555 A A 22 1_555 -1.476 -1.105 2.954 -0.123 6.946 56.844 -1.490 1.535 2.815 7.267 0.129 57.232 10 AA_C19G20:A23G24_AA A 19 ? A 24 ? A 20 ? A 23 ? 1 B G 1 1_555 B C 34 1_555 B A 2 1_555 B U 33 1_555 -0.788 -1.266 3.261 3.690 8.891 40.335 -2.690 1.488 2.851 12.677 -5.262 41.421 11 BB_G2A3:U34C35_BB B 2 ? B 35 ? B 3 ? B 34 ? 1 B A 2 1_555 B U 33 1_555 B A 3 1_555 B U 32 1_555 0.515 -1.317 3.002 -4.231 4.037 33.217 -2.851 -1.497 2.743 6.995 7.330 33.713 12 BB_A3A4:U33U34_BB B 3 ? B 34 ? B 4 ? B 33 ? 1 B A 3 1_555 B U 32 1_555 B G 4 1_555 B C 31 1_555 0.156 -2.099 3.224 12.288 11.738 33.235 -4.686 1.219 2.296 19.052 -19.944 37.218 13 BB_A4G5:C32U33_BB B 4 ? B 33 ? B 5 ? B 32 ? 1 B G 4 1_555 B C 31 1_555 B A 5 1_555 B A 30 1_555 -1.095 -3.110 1.063 -148.609 90.583 -82.384 1.287 -0.989 1.214 -45.820 -75.173 -175.516 14 BB_G5A6:A31C32_BB B 5 ? B 32 ? B 6 ? B 31 ? 1 B A 5 1_555 B A 30 1_555 B U 7 1_555 B A 28 1_555 1.995 2.063 -2.703 -95.477 138.715 -49.838 0.113 1.792 -1.658 -72.117 -49.638 -169.481 15 BB_A6U8:A29A31_BB B 6 ? B 31 ? B 8 ? B 29 ? 1 B U 15 1_555 B A 26 1_555 B G 16 1_555 B C 25 1_555 -0.821 -1.968 3.365 -4.592 4.514 27.034 -5.187 0.603 3.096 9.487 9.649 27.776 16 BB_U16G17:C26A27_BB B 16 ? B 27 ? B 17 ? B 26 ? 1 B G 16 1_555 B C 25 1_555 B C 17 1_555 B G 24 1_555 0.416 -1.727 3.206 3.214 -0.488 34.943 -2.792 -0.214 3.253 -0.811 -5.339 35.090 17 BB_G17C18:G25C26_BB B 17 ? B 26 ? B 18 ? B 25 ? 1 B C 17 1_555 B G 24 1_555 B C 18 1_555 B G 23 1_555 -0.896 -1.939 3.378 -0.179 14.131 31.081 -5.361 1.503 2.310 24.826 0.314 34.071 18 BB_C18C19:G24G25_BB B 18 ? B 25 ? B 19 ? B 24 ? 1 B C 18 1_555 B G 23 1_555 B G 19 1_555 B A 22 1_555 -2.244 -1.280 3.239 -2.011 12.827 52.436 -2.177 2.355 2.951 14.270 2.237 53.909 19 BB_C19G20:A23G24_BB B 19 ? B 24 ? B 20 ? B 23 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id NJL _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id NJL _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type other _pdbx_initial_refinement_model.source_name Other _pdbx_initial_refinement_model.accession_code 8HZE _pdbx_initial_refinement_model.details MR # _atom_sites.entry_id 8HZF _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.011816 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.005574 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.021170 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.019685 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C F K MG N O P # loop_