data_8HZM # _entry.id 8HZM # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8HZM pdb_00008hzm 10.2210/pdb8hzm/pdb WWPDB D_1300034653 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2024-06-19 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8HZM _pdbx_database_status.recvd_initial_deposition_date 2023-01-09 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 3 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Aiming _pdbx_contact_author.name_last Ren _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Huang, K.Y.' 1 ? 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Nat.Chem.Biol. _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 1552-4469 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Structural basis of a small monomeric Clivia fluorogenic RNA with a large Stokes shift.' _citation.year 2024 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41589-024-01633-1 _citation.pdbx_database_id_PubMed 38816645 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Huang, K.' 1 ? primary 'Song, Q.' 2 0000-0003-1990-4096 primary 'Fang, M.' 3 ? primary 'Yao, D.' 4 ? primary 'Shen, X.' 5 0009-0007-0384-2755 primary 'Xu, X.' 6 ? primary 'Chen, X.' 7 0000-0002-8475-332X primary 'Zhu, L.' 8 0000-0002-0398-7213 primary 'Yang, Y.' 9 0000-0001-7896-1184 primary 'Ren, A.' 10 0000-0002-5420-4899 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (36-MER)' 11274.813 2 ? ? ? ? 2 non-polymer syn "GUANOSINE-5'-TRIPHOSPHATE" 523.180 2 ? ? ? ? 3 non-polymer syn 'MANGANESE (II) ION' 54.938 11 ? ? ? ? 4 non-polymer syn 'POTASSIUM ION' 39.098 2 ? ? ? ? 5 non-polymer syn 'MAGNESIUM ION' 24.305 5 ? ? ? ? 6 non-polymer syn '(5~{Z})-5-[[4-[2-hydroxyethyl(methyl)amino]phenyl]methylidene]-3-methyl-2-[(~{E})-2-phenylethenyl]imidazol-4-one' 361.437 2 ? ? ? ? 7 water nat water 18.015 42 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GAAGAUUGUAAACAUGCCGAAAGGCAGACACUUCC _entity_poly.pdbx_seq_one_letter_code_can GAAGAUUGUAAACAUGCCGAAAGGCAGACACUUCC _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 "GUANOSINE-5'-TRIPHOSPHATE" GTP 3 'MANGANESE (II) ION' MN 4 'POTASSIUM ION' K 5 'MAGNESIUM ION' MG 6 '(5~{Z})-5-[[4-[2-hydroxyethyl(methyl)amino]phenyl]methylidene]-3-methyl-2-[(~{E})-2-phenylethenyl]imidazol-4-one' NI4 7 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 A n 1 3 A n 1 4 G n 1 5 A n 1 6 U n 1 7 U n 1 8 G n 1 9 U n 1 10 A n 1 11 A n 1 12 A n 1 13 C n 1 14 A n 1 15 U n 1 16 G n 1 17 C n 1 18 C n 1 19 G n 1 20 A n 1 21 A n 1 22 A n 1 23 G n 1 24 G n 1 25 C n 1 26 A n 1 27 G n 1 28 A n 1 29 C n 1 30 A n 1 31 C n 1 32 U n 1 33 U n 1 34 C n 1 35 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 35 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'synthetic construct' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 32630 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 K non-polymer . 'POTASSIUM ION' ? 'K 1' 39.098 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 MN non-polymer . 'MANGANESE (II) ION' ? 'Mn 2' 54.938 NI4 non-polymer . '(5~{Z})-5-[[4-[2-hydroxyethyl(methyl)amino]phenyl]methylidene]-3-methyl-2-[(~{E})-2-phenylethenyl]imidazol-4-one' ? 'C22 H23 N3 O2' 361.437 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 2 2 G G A . n A 1 2 A 2 3 3 A A A . n A 1 3 A 3 4 4 A A A . n A 1 4 G 4 5 5 G G A . n A 1 5 A 5 6 6 A A A . n A 1 6 U 6 7 7 U U A . n A 1 7 U 7 8 8 U U A . n A 1 8 G 8 9 9 G G A . n A 1 9 U 9 10 10 U U A . n A 1 10 A 10 11 11 A A A . n A 1 11 A 11 12 12 A A A . n A 1 12 A 12 13 13 A A A . n A 1 13 C 13 14 14 C C A . n A 1 14 A 14 15 15 A A A . n A 1 15 U 15 16 16 U U A . n A 1 16 G 16 17 17 G G A . n A 1 17 C 17 18 18 C C A . n A 1 18 C 18 19 19 C C A . n A 1 19 G 19 20 20 G G A . n A 1 20 A 20 21 21 A A A . n A 1 21 A 21 22 22 A A A . n A 1 22 A 22 23 23 A A A . n A 1 23 G 23 24 24 G G A . n A 1 24 G 24 25 25 G G A . n A 1 25 C 25 26 26 C C A . n A 1 26 A 26 27 27 A A A . n A 1 27 G 27 28 28 G G A . n A 1 28 A 28 29 29 A A A . n A 1 29 C 29 30 30 C C A . n A 1 30 A 30 31 31 A A A . n A 1 31 C 31 32 32 C C A . n A 1 32 U 32 33 33 U U A . n A 1 33 U 33 34 34 U U A . n A 1 34 C 34 35 35 C C A . n A 1 35 C 35 36 36 C C A . n B 1 1 G 1 2 2 G G B . n B 1 2 A 2 3 3 A A B . n B 1 3 A 3 4 4 A A B . n B 1 4 G 4 5 5 G G B . n B 1 5 A 5 6 6 A A B . n B 1 6 U 6 7 7 U U B . n B 1 7 U 7 8 8 U U B . n B 1 8 G 8 9 9 G G B . n B 1 9 U 9 10 10 U U B . n B 1 10 A 10 11 11 A A B . n B 1 11 A 11 12 12 A A B . n B 1 12 A 12 13 13 A A B . n B 1 13 C 13 14 14 C C B . n B 1 14 A 14 15 15 A A B . n B 1 15 U 15 16 16 U U B . n B 1 16 G 16 17 17 G G B . n B 1 17 C 17 18 18 C C B . n B 1 18 C 18 19 19 C C B . n B 1 19 G 19 20 20 G G B . n B 1 20 A 20 21 21 A A B . n B 1 21 A 21 22 22 A A B . n B 1 22 A 22 23 23 A A B . n B 1 23 G 23 24 24 G G B . n B 1 24 G 24 25 25 G G B . n B 1 25 C 25 26 26 C C B . n B 1 26 A 26 27 27 A A B . n B 1 27 G 27 28 28 G G B . n B 1 28 A 28 29 29 A A B . n B 1 29 C 29 30 30 C C B . n B 1 30 A 30 31 31 A A B . n B 1 31 C 31 32 32 C C B . n B 1 32 U 32 33 33 U U B . n B 1 33 U 33 34 34 U U B . n B 1 34 C 34 35 35 C C B . n B 1 35 C 35 36 36 C C B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 GTP 1 101 1 GTP GTP A . D 3 MN 1 102 2 MN MN A . E 3 MN 1 103 5 MN MN A . F 3 MN 1 104 6 MN MN A . G 3 MN 1 105 7 MN MN A . H 3 MN 1 106 8 MN MN A . I 3 MN 1 107 11 MN MN A . J 4 K 1 108 1 K K A . K 4 K 1 109 2 K K A . L 5 MG 1 110 3 MG MG A . M 5 MG 1 111 5 MG MG A . N 6 NI4 1 112 1 NI4 LIG A . O 2 GTP 1 101 1 GTP GTP B . P 3 MN 1 102 1 MN MN B . Q 3 MN 1 103 3 MN MN B . R 3 MN 1 104 4 MN MN B . S 3 MN 1 105 9 MN MN B . T 3 MN 1 106 10 MN MN B . U 5 MG 1 107 1 MG MG B . V 5 MG 1 108 2 MG MG B . W 5 MG 1 109 4 MG MG B . X 6 NI4 1 110 1 NI4 LIG B . Y 7 HOH 1 201 6 HOH HOH A . Y 7 HOH 2 202 1 HOH HOH A . Y 7 HOH 3 203 28 HOH HOH A . Y 7 HOH 4 204 17 HOH HOH A . Y 7 HOH 5 205 23 HOH HOH A . Y 7 HOH 6 206 9 HOH HOH A . Y 7 HOH 7 207 4 HOH HOH A . Y 7 HOH 8 208 18 HOH HOH A . Y 7 HOH 9 209 20 HOH HOH A . Y 7 HOH 10 210 21 HOH HOH A . Y 7 HOH 11 211 3 HOH HOH A . Y 7 HOH 12 212 5 HOH HOH A . Y 7 HOH 13 213 24 HOH HOH A . Y 7 HOH 14 214 26 HOH HOH A . Y 7 HOH 15 215 32 HOH HOH A . Y 7 HOH 16 216 2 HOH HOH A . Y 7 HOH 17 217 19 HOH HOH A . Y 7 HOH 18 218 22 HOH HOH A . Y 7 HOH 19 219 39 HOH HOH A . Z 7 HOH 1 201 31 HOH HOH B . Z 7 HOH 2 202 42 HOH HOH B . Z 7 HOH 3 203 12 HOH HOH B . Z 7 HOH 4 204 7 HOH HOH B . Z 7 HOH 5 205 35 HOH HOH B . Z 7 HOH 6 206 40 HOH HOH B . Z 7 HOH 7 207 10 HOH HOH B . Z 7 HOH 8 208 29 HOH HOH B . Z 7 HOH 9 209 30 HOH HOH B . Z 7 HOH 10 210 13 HOH HOH B . Z 7 HOH 11 211 38 HOH HOH B . Z 7 HOH 12 212 14 HOH HOH B . Z 7 HOH 13 213 16 HOH HOH B . Z 7 HOH 14 214 34 HOH HOH B . Z 7 HOH 15 215 11 HOH HOH B . Z 7 HOH 16 216 36 HOH HOH B . Z 7 HOH 17 217 15 HOH HOH B . Z 7 HOH 18 218 37 HOH HOH B . Z 7 HOH 19 219 25 HOH HOH B . Z 7 HOH 20 220 41 HOH HOH B . Z 7 HOH 21 221 33 HOH HOH B . Z 7 HOH 22 222 8 HOH HOH B . Z 7 HOH 23 223 27 HOH HOH B . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.18.2_3874: ???)' 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? 3.25 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-3000 ? ? ? . 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 5 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 113.70 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 8HZM _cell.details ? _cell.formula_units_Z ? _cell.length_a 77.694 _cell.length_a_esd ? _cell.length_b 46.871 _cell.length_b_esd ? _cell.length_c 56.722 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8HZM _symmetry.cell_setting ? _symmetry.Int_Tables_number 5 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'C 1 2 1' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8HZM _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.01 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 38.71 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '0.05 M Magnesium Chloride, 0.1 M HEPES pH7.5, 30%polyethylene glycol monomethyl ether 550, 0.6% 1,6-diaminohexane' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2020-04-20 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.240 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL19U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.240 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL19U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 8HZM _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.50 _reflns.d_resolution_low 50.00 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 6395 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 97.1 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 5.9 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 4.5 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 1.254 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.126 _reflns.pdbx_Rpim_I_all 0.049 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all 37919 _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.984 _reflns.pdbx_CC_star 0.996 _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.116 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.percent_possible_all _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 2.50 2.54 ? ? ? ? ? ? 260 ? ? ? ? ? ? ? ? ? ? ? 3.2 0.389 ? ? 0.655 0.329 ? 1 1 0.623 0.876 ? 78.1 ? 0.561 ? ? ? ? ? ? ? ? ? 2.54 2.59 ? ? ? ? ? ? 282 ? ? ? ? ? ? ? ? ? ? ? 3.5 0.587 ? ? 0.674 0.319 ? 2 1 0.679 0.899 ? 86.8 ? 0.589 ? ? ? ? ? ? ? ? ? 2.59 2.64 ? ? ? ? ? ? 281 ? ? ? ? ? ? ? ? ? ? ? 4.1 0.559 ? ? 0.608 0.280 ? 3 1 0.466 0.798 ? 90.1 ? 0.536 ? ? ? ? ? ? ? ? ? 2.64 2.69 ? ? ? ? ? ? 332 ? ? ? ? ? ? ? ? ? ? ? 5.2 0.559 ? ? 0.503 0.210 ? 4 1 0.741 0.923 ? 94.3 ? 0.454 ? ? ? ? ? ? ? ? ? 2.69 2.75 ? ? ? ? ? ? 298 ? ? ? ? ? ? ? ? ? ? ? 5.6 0.584 ? ? 0.444 0.178 ? 5 1 0.881 0.968 ? 97.4 ? 0.406 ? ? ? ? ? ? ? ? ? 2.75 2.82 ? ? ? ? ? ? 333 ? ? ? ? ? ? ? ? ? ? ? 5.9 0.481 ? ? 0.386 0.151 ? 6 1 0.925 0.980 ? 98.2 ? 0.354 ? ? ? ? ? ? ? ? ? 2.82 2.89 ? ? ? ? ? ? 323 ? ? ? ? ? ? ? ? ? ? ? 6.1 0.484 ? ? 0.338 0.132 ? 7 1 0.937 0.984 ? 99.7 ? 0.311 ? ? ? ? ? ? ? ? ? 2.89 2.96 ? ? ? ? ? ? 332 ? ? ? ? ? ? ? ? ? ? ? 6.2 0.500 ? ? 0.265 0.103 ? 8 1 0.969 0.992 ? 99.7 ? 0.243 ? ? ? ? ? ? ? ? ? 2.96 3.05 ? ? ? ? ? ? 320 ? ? ? ? ? ? ? ? ? ? ? 6.2 0.563 ? ? 0.235 0.092 ? 9 1 0.977 0.994 ? 99.7 ? 0.216 ? ? ? ? ? ? ? ? ? 3.05 3.15 ? ? ? ? ? ? 316 ? ? ? ? ? ? ? ? ? ? ? 5.9 0.591 ? ? 0.172 0.070 ? 10 1 0.982 0.995 ? 99.4 ? 0.157 ? ? ? ? ? ? ? ? ? 3.15 3.26 ? ? ? ? ? ? 326 ? ? ? ? ? ? ? ? ? ? ? 6.4 0.612 ? ? 0.155 0.060 ? 11 1 0.991 0.998 ? 100.0 ? 0.143 ? ? ? ? ? ? ? ? ? 3.26 3.39 ? ? ? ? ? ? 325 ? ? ? ? ? ? ? ? ? ? ? 6.7 0.688 ? ? 0.145 0.054 ? 12 1 0.990 0.998 ? 99.7 ? 0.134 ? ? ? ? ? ? ? ? ? 3.39 3.55 ? ? ? ? ? ? 335 ? ? ? ? ? ? ? ? ? ? ? 6.8 0.760 ? ? 0.130 0.049 ? 13 1 0.992 0.998 ? 99.7 ? 0.120 ? ? ? ? ? ? ? ? ? 3.55 3.73 ? ? ? ? ? ? 327 ? ? ? ? ? ? ? ? ? ? ? 6.7 0.799 ? ? 0.116 0.044 ? 14 1 0.991 0.998 ? 100.0 ? 0.107 ? ? ? ? ? ? ? ? ? 3.73 3.97 ? ? ? ? ? ? 330 ? ? ? ? ? ? ? ? ? ? ? 6.4 0.802 ? ? 0.108 0.042 ? 15 1 0.990 0.997 ? 100.0 ? 0.099 ? ? ? ? ? ? ? ? ? 3.97 4.27 ? ? ? ? ? ? 324 ? ? ? ? ? ? ? ? ? ? ? 6.2 1.156 ? ? 0.102 0.040 ? 16 1 0.991 0.998 ? 100.0 ? 0.094 ? ? ? ? ? ? ? ? ? 4.27 4.70 ? ? ? ? ? ? 335 ? ? ? ? ? ? ? ? ? ? ? 7.0 1.040 ? ? 0.096 0.036 ? 17 1 0.993 0.998 ? 100.0 ? 0.089 ? ? ? ? ? ? ? ? ? 4.70 5.38 ? ? ? ? ? ? 328 ? ? ? ? ? ? ? ? ? ? ? 6.7 1.216 ? ? 0.096 0.036 ? 18 1 0.994 0.998 ? 99.7 ? 0.089 ? ? ? ? ? ? ? ? ? 5.38 6.78 ? ? ? ? ? ? 341 ? ? ? ? ? ? ? ? ? ? ? 6.2 2.554 ? ? 0.102 0.040 ? 19 1 0.981 0.995 ? 99.7 ? 0.094 ? ? ? ? ? ? ? ? ? 6.78 50.00 ? ? ? ? ? ? 347 ? ? ? ? ? ? ? ? ? ? ? 6.4 7.997 ? ? 0.125 0.047 ? 20 1 0.988 0.997 ? 99.4 ? 0.115 ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8HZM _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.50 _refine.ls_d_res_low 39.14 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 6390 _refine.ls_number_reflns_R_free 328 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 96.86 _refine.ls_percent_reflns_R_free 5.13 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2073 _refine.ls_R_factor_R_free 0.2567 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2048 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.38 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 8HZE _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 33.36 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.43 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.50 _refine_hist.d_res_low 39.14 _refine_hist.number_atoms_solvent 42 _refine_hist.number_atoms_total 1678 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1564 _refine_hist.pdbx_number_atoms_ligand 72 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.006 ? 1806 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.142 ? 2800 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 15.728 ? 874 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.046 ? 358 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.006 ? 82 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.50 3.15 . . 170 2903 94.00 . . . . 0.2772 . . . . . . . . . . . 0.3676 'X-RAY DIFFRACTION' 3.15 39.14 . . 158 3159 100.00 . . . . 0.1852 . . . . . . . . . . . 0.2221 # _struct.entry_id 8HZM _struct.title 'A new fluorescent RNA aptamer bound with N, manganese soak' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8HZM _struct_keywords.text 'Fluorescent RNA aptamer, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 3 ? E N N 3 ? F N N 3 ? G N N 3 ? H N N 3 ? I N N 3 ? J N N 4 ? K N N 4 ? L N N 5 ? M N N 5 ? N N N 6 ? O N N 2 ? P N N 3 ? Q N N 3 ? R N N 3 ? S N N 3 ? T N N 3 ? U N N 5 ? V N N 5 ? W N N 5 ? X N N 6 ? Y N N 7 ? Z N N 7 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8HZM _struct_ref.pdbx_db_accession 8HZM _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 8HZM A 1 ? 35 ? 8HZM 2 ? 36 ? 2 36 2 1 8HZM B 1 ? 35 ? 8HZM 2 ? 36 ? 2 36 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 4100 ? 1 MORE -98 ? 1 'SSA (A^2)' 11070 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J,K,L,M,N,O,P,Q,R,S,T,U,V,W,X,Y,Z # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0 _pdbx_struct_oper_list.matrix[1][2] 0.0 _pdbx_struct_oper_list.matrix[1][3] 0.0 _pdbx_struct_oper_list.vector[1] 0.0 _pdbx_struct_oper_list.matrix[2][1] 0.0 _pdbx_struct_oper_list.matrix[2][2] 1.0 _pdbx_struct_oper_list.matrix[2][3] 0.0 _pdbx_struct_oper_list.vector[2] 0.0 _pdbx_struct_oper_list.matrix[3][1] 0.0 _pdbx_struct_oper_list.matrix[3][2] 0.0 _pdbx_struct_oper_list.matrix[3][3] 1.0 _pdbx_struct_oper_list.vector[3] 0.0 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A G 1 P ? ? ? 1_555 C GTP . "O3'" ? ? A G 2 A GTP 101 1_555 ? ? ? ? ? ? ? 1.563 ? ? covale2 covale both ? B G 1 P ? ? ? 1_555 O GTP . "O3'" ? ? B G 2 B GTP 101 1_555 ? ? ? ? ? ? ? 1.569 ? ? metalc1 metalc ? ? A U 7 OP1 ? ? ? 1_555 J K . K ? ? A U 8 A K 108 1_555 ? ? ? ? ? ? ? 2.895 ? ? metalc2 metalc ? ? A U 7 OP2 ? ? ? 1_555 J K . K ? ? A U 8 A K 108 1_555 ? ? ? ? ? ? ? 2.849 ? ? metalc3 metalc ? ? A U 9 OP1 ? ? ? 1_555 I MN . MN ? ? A U 10 A MN 107 1_555 ? ? ? ? ? ? ? 2.180 ? ? metalc4 metalc ? ? A C 17 OP1 ? ? ? 1_555 F MN . MN ? ? A C 18 A MN 104 1_555 ? ? ? ? ? ? ? 2.315 ? ? metalc5 metalc ? ? A G 19 OP2 ? ? ? 1_555 G MN . MN ? ? A G 20 A MN 105 1_555 ? ? ? ? ? ? ? 2.041 ? ? metalc6 metalc ? ? A G 19 "O3'" ? ? ? 1_555 K K . K ? ? A G 20 A K 109 1_555 ? ? ? ? ? ? ? 3.443 ? ? metalc7 metalc ? ? A G 23 N7 ? ? ? 1_555 E MN . MN ? ? A G 24 A MN 103 1_555 ? ? ? ? ? ? ? 2.394 ? ? metalc8 metalc ? ? A G 24 OP1 ? ? ? 1_555 U MG . MG ? ? A G 25 B MG 107 1_555 ? ? ? ? ? ? ? 2.943 ? ? metalc9 metalc ? ? A A 26 OP2 ? ? ? 1_555 H MN . MN ? ? A A 27 A MN 106 1_555 ? ? ? ? ? ? ? 2.740 ? ? metalc10 metalc ? ? A C 29 OP2 ? ? ? 1_555 M MG . MG ? ? A C 30 A MG 111 1_555 ? ? ? ? ? ? ? 2.625 ? ? metalc11 metalc ? ? A A 30 OP2 ? ? ? 1_555 M MG . MG ? ? A A 31 A MG 111 1_555 ? ? ? ? ? ? ? 2.195 ? ? metalc12 metalc ? ? A C 35 "O3'" ? ? ? 1_555 L MG . MG ? ? A C 36 A MG 110 1_555 ? ? ? ? ? ? ? 1.748 ? ? metalc13 metalc ? ? A C 35 "O2'" ? ? ? 1_555 L MG . MG ? ? A C 36 A MG 110 1_555 ? ? ? ? ? ? ? 2.047 ? ? metalc14 metalc ? ? D MN . MN ? ? ? 1_555 Y HOH . O ? ? A MN 102 A HOH 215 1_555 ? ? ? ? ? ? ? 2.203 ? ? metalc15 metalc ? ? D MN . MN ? ? ? 1_555 Z HOH . O ? ? A MN 102 B HOH 210 1_555 ? ? ? ? ? ? ? 2.257 ? ? metalc16 metalc ? ? D MN . MN ? ? ? 1_555 Z HOH . O ? ? A MN 102 B HOH 212 1_555 ? ? ? ? ? ? ? 2.247 ? ? metalc17 metalc ? ? D MN . MN ? ? ? 1_555 Z HOH . O ? ? A MN 102 B HOH 221 2_555 ? ? ? ? ? ? ? 1.734 ? ? metalc18 metalc ? ? E MN . MN ? ? ? 1_555 Y HOH . O ? ? A MN 103 A HOH 201 1_555 ? ? ? ? ? ? ? 2.413 ? ? metalc19 metalc ? ? G MN . MN ? ? ? 1_555 Y HOH . O ? ? A MN 105 A HOH 214 1_555 ? ? ? ? ? ? ? 2.268 ? ? metalc20 metalc ? ? G MN . MN ? ? ? 1_555 Z HOH . O ? ? A MN 105 B HOH 223 4_455 ? ? ? ? ? ? ? 2.412 ? ? metalc21 metalc ? ? J K . K ? ? ? 1_555 Y HOH . O ? ? A K 108 A HOH 210 1_555 ? ? ? ? ? ? ? 2.556 ? ? metalc22 metalc ? ? J K . K ? ? ? 1_555 B G 19 "O3'" ? ? A K 108 B G 20 1_555 ? ? ? ? ? ? ? 3.271 ? ? metalc23 metalc ? ? J K . K ? ? ? 1_555 B A 20 OP1 ? ? A K 108 B A 21 1_555 ? ? ? ? ? ? ? 3.223 ? ? metalc24 metalc ? ? J K . K ? ? ? 1_555 Z HOH . O ? ? A K 108 B HOH 206 1_555 ? ? ? ? ? ? ? 3.375 ? ? metalc25 metalc ? ? K K . K ? ? ? 1_555 B U 7 OP1 ? ? A K 109 B U 8 1_555 ? ? ? ? ? ? ? 3.079 ? ? metalc26 metalc ? ? K K . K ? ? ? 1_555 B U 7 OP2 ? ? A K 109 B U 8 1_555 ? ? ? ? ? ? ? 3.111 ? ? metalc27 metalc ? ? K K . K ? ? ? 1_555 Z HOH . O ? ? A K 109 B HOH 216 1_555 ? ? ? ? ? ? ? 2.564 ? ? metalc28 metalc ? ? M MG . MG ? ? ? 1_555 Y HOH . O ? ? A MG 111 A HOH 203 1_555 ? ? ? ? ? ? ? 2.617 ? ? metalc29 metalc ? ? Y HOH . O ? ? ? 1_556 P MN . MN ? ? A HOH 206 B MN 102 1_555 ? ? ? ? ? ? ? 2.191 ? ? metalc30 metalc ? ? B U 9 OP1 ? ? ? 1_555 R MN . MN ? ? B U 10 B MN 104 1_555 ? ? ? ? ? ? ? 1.880 ? ? metalc31 metalc ? ? B A 11 OP1 ? ? ? 1_555 V MG . MG ? ? B A 12 B MG 108 1_555 ? ? ? ? ? ? ? 2.018 ? ? metalc32 metalc ? ? B G 19 OP2 ? ? ? 1_555 S MN . MN ? ? B G 20 B MN 105 1_555 ? ? ? ? ? ? ? 2.250 ? ? metalc33 metalc ? ? B C 29 OP2 ? ? ? 1_555 P MN . MN ? ? B C 30 B MN 102 1_555 ? ? ? ? ? ? ? 2.245 ? ? metalc34 metalc ? ? B A 30 OP2 ? ? ? 1_555 P MN . MN ? ? B A 31 B MN 102 1_555 ? ? ? ? ? ? ? 2.200 ? ? metalc35 metalc ? ? P MN . MN ? ? ? 1_555 Z HOH . O ? ? B MN 102 B HOH 215 1_555 ? ? ? ? ? ? ? 2.320 ? ? metalc36 metalc ? ? Q MN . MN ? ? ? 1_555 Z HOH . O ? ? B MN 103 B HOH 213 1_555 ? ? ? ? ? ? ? 2.433 ? ? metalc37 metalc ? ? Q MN . MN ? ? ? 1_555 Z HOH . O ? ? B MN 103 B HOH 217 1_555 ? ? ? ? ? ? ? 2.657 ? ? metalc38 metalc ? ? Q MN . MN ? ? ? 1_555 Z HOH . O ? ? B MN 103 B HOH 218 1_555 ? ? ? ? ? ? ? 1.923 ? ? metalc39 metalc ? ? V MG . MG ? ? ? 1_555 Z HOH . O ? ? B MG 108 B HOH 201 2_555 ? ? ? ? ? ? ? 1.792 ? ? metalc40 metalc ? ? V MG . MG ? ? ? 1_555 Z HOH . O ? ? B MG 108 B HOH 209 1_555 ? ? ? ? ? ? ? 1.804 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 2 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 2 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 2 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A A 2 N1 ? ? ? 1_555 A U 33 N3 ? ? A A 3 A U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A A 2 N6 ? ? ? 1_555 A U 33 O4 ? ? A A 3 A U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 32 N3 ? ? A A 4 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 32 O4 ? ? A A 4 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 4 N2 ? ? ? 1_555 A A 11 N1 ? ? A G 5 A A 12 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog9 hydrog ? ? A G 4 N3 ? ? ? 1_555 A A 11 N6 ? ? A G 5 A A 12 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog10 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 5 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 5 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 5 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 5 N6 ? ? ? 1_555 A A 12 N1 ? ? A A 6 A A 13 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog14 hydrog ? ? A A 5 N7 ? ? ? 1_555 A A 12 N6 ? ? A A 6 A A 13 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog15 hydrog ? ? A A 5 N1 ? ? ? 1_555 A A 30 N6 ? ? A A 6 A A 31 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog16 hydrog ? ? A A 5 N6 ? ? ? 1_555 A A 30 N1 ? ? A A 6 A A 31 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog17 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 28 N7 ? ? A U 8 A A 29 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog18 hydrog ? ? A U 7 O2 ? ? ? 1_555 A A 28 N6 ? ? A U 8 A A 29 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog19 hydrog ? ? A A 10 N6 ? ? ? 1_555 A U 32 O2 ? ? A A 11 A U 33 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog20 hydrog ? ? A A 14 N6 ? ? ? 1_555 A G 27 N3 ? ? A A 15 A G 28 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog21 hydrog ? ? A A 14 N7 ? ? ? 1_555 A G 27 N2 ? ? A A 15 A G 28 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog22 hydrog ? ? A U 15 N3 ? ? ? 1_555 A A 26 N1 ? ? A U 16 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A U 15 O4 ? ? ? 1_555 A A 26 N6 ? ? A U 16 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 16 N1 ? ? ? 1_555 A C 25 N3 ? ? A G 17 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 16 N2 ? ? ? 1_555 A C 25 O2 ? ? A G 17 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 16 O6 ? ? ? 1_555 A C 25 N4 ? ? A G 17 A C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 17 N3 ? ? ? 1_555 A G 24 N1 ? ? A C 18 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 17 N4 ? ? ? 1_555 A G 24 O6 ? ? A C 18 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 17 O2 ? ? ? 1_555 A G 24 N2 ? ? A C 18 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 18 N3 ? ? ? 1_555 A G 23 N1 ? ? A C 19 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 18 N4 ? ? ? 1_555 A G 23 O6 ? ? A C 19 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 18 O2 ? ? ? 1_555 A G 23 N2 ? ? A C 19 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 19 N2 ? ? ? 1_555 A A 22 N7 ? ? A G 20 A A 23 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog34 hydrog ? ? B G 1 N1 ? ? ? 1_555 B C 34 N3 ? ? B G 2 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? B G 1 N2 ? ? ? 1_555 B C 34 O2 ? ? B G 2 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? B G 1 O6 ? ? ? 1_555 B C 34 N4 ? ? B G 2 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? B A 2 N1 ? ? ? 1_555 B U 33 N3 ? ? B A 3 B U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? B A 2 N6 ? ? ? 1_555 B U 33 O4 ? ? B A 3 B U 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? B A 3 N1 ? ? ? 1_555 B U 32 N3 ? ? B A 4 B U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? B A 3 N6 ? ? ? 1_555 B U 32 O4 ? ? B A 4 B U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? B G 4 N2 ? ? ? 1_555 B A 11 N1 ? ? B G 5 B A 12 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog42 hydrog ? ? B G 4 N3 ? ? ? 1_555 B A 11 N6 ? ? B G 5 B A 12 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog43 hydrog ? ? B G 4 N2 ? ? ? 1_555 B A 12 N1 ? ? B G 5 B A 13 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog44 hydrog ? ? B G 4 N3 ? ? ? 1_555 B A 12 N6 ? ? B G 5 B A 13 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog45 hydrog ? ? B G 4 N1 ? ? ? 1_555 B C 31 N3 ? ? B G 5 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? B G 4 N2 ? ? ? 1_555 B C 31 O2 ? ? B G 5 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? B G 4 O6 ? ? ? 1_555 B C 31 N4 ? ? B G 5 B C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? B A 5 N6 ? ? ? 1_555 B A 12 N1 ? ? B A 6 B A 13 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog49 hydrog ? ? B A 5 N7 ? ? ? 1_555 B A 12 N6 ? ? B A 6 B A 13 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog50 hydrog ? ? B A 5 N1 ? ? ? 1_555 B A 30 N6 ? ? B A 6 B A 31 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog51 hydrog ? ? B A 5 N6 ? ? ? 1_555 B A 30 N1 ? ? B A 6 B A 31 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog52 hydrog ? ? B U 7 N3 ? ? ? 1_555 B A 28 N7 ? ? B U 8 B A 29 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog53 hydrog ? ? B U 7 O2 ? ? ? 1_555 B A 28 N6 ? ? B U 8 B A 29 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog54 hydrog ? ? B A 10 N6 ? ? ? 1_555 B U 32 O2 ? ? B A 11 B U 33 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog55 hydrog ? ? B C 13 N3 ? ? ? 1_555 B A 28 N6 ? ? B C 14 B A 29 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog56 hydrog ? ? B A 14 N6 ? ? ? 1_555 B G 27 N3 ? ? B A 15 B G 28 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog57 hydrog ? ? B A 14 N7 ? ? ? 1_555 B G 27 N2 ? ? B A 15 B G 28 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog58 hydrog ? ? B U 15 N3 ? ? ? 1_555 B A 26 N1 ? ? B U 16 B A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? B U 15 O4 ? ? ? 1_555 B A 26 N6 ? ? B U 16 B A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? B G 16 N1 ? ? ? 1_555 B C 25 N3 ? ? B G 17 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? B G 16 N2 ? ? ? 1_555 B C 25 O2 ? ? B G 17 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? B G 16 O6 ? ? ? 1_555 B C 25 N4 ? ? B G 17 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? B C 17 N3 ? ? ? 1_555 B G 24 N1 ? ? B C 18 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? B C 17 N4 ? ? ? 1_555 B G 24 O6 ? ? B C 18 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? B C 17 O2 ? ? ? 1_555 B G 24 N2 ? ? B C 18 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? B C 18 N3 ? ? ? 1_555 B G 23 N1 ? ? B C 19 B G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? B C 18 N4 ? ? ? 1_555 B G 23 O6 ? ? B C 19 B G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? B C 18 O2 ? ? ? 1_555 B G 23 N2 ? ? B C 19 B G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? B G 19 N2 ? ? ? 1_555 B A 22 N7 ? ? B G 20 B A 23 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 OP1 ? A U 7 ? A U 8 ? 1_555 K ? J K . ? A K 108 ? 1_555 OP2 ? A U 7 ? A U 8 ? 1_555 53.8 ? 2 OP1 ? A U 7 ? A U 8 ? 1_555 K ? J K . ? A K 108 ? 1_555 O ? Y HOH . ? A HOH 210 ? 1_555 104.1 ? 3 OP2 ? A U 7 ? A U 8 ? 1_555 K ? J K . ? A K 108 ? 1_555 O ? Y HOH . ? A HOH 210 ? 1_555 52.9 ? 4 OP1 ? A U 7 ? A U 8 ? 1_555 K ? J K . ? A K 108 ? 1_555 "O3'" ? B G 19 ? B G 20 ? 1_555 148.7 ? 5 OP2 ? A U 7 ? A U 8 ? 1_555 K ? J K . ? A K 108 ? 1_555 "O3'" ? B G 19 ? B G 20 ? 1_555 148.1 ? 6 O ? Y HOH . ? A HOH 210 ? 1_555 K ? J K . ? A K 108 ? 1_555 "O3'" ? B G 19 ? B G 20 ? 1_555 105.9 ? 7 OP1 ? A U 7 ? A U 8 ? 1_555 K ? J K . ? A K 108 ? 1_555 OP1 ? B A 20 ? B A 21 ? 1_555 133.7 ? 8 OP2 ? A U 7 ? A U 8 ? 1_555 K ? J K . ? A K 108 ? 1_555 OP1 ? B A 20 ? B A 21 ? 1_555 150.0 ? 9 O ? Y HOH . ? A HOH 210 ? 1_555 K ? J K . ? A K 108 ? 1_555 OP1 ? B A 20 ? B A 21 ? 1_555 103.1 ? 10 "O3'" ? B G 19 ? B G 20 ? 1_555 K ? J K . ? A K 108 ? 1_555 OP1 ? B A 20 ? B A 21 ? 1_555 45.5 ? 11 OP1 ? A U 7 ? A U 8 ? 1_555 K ? J K . ? A K 108 ? 1_555 O ? Z HOH . ? B HOH 206 ? 1_555 134.2 ? 12 OP2 ? A U 7 ? A U 8 ? 1_555 K ? J K . ? A K 108 ? 1_555 O ? Z HOH . ? B HOH 206 ? 1_555 108.6 ? 13 O ? Y HOH . ? A HOH 210 ? 1_555 K ? J K . ? A K 108 ? 1_555 O ? Z HOH . ? B HOH 206 ? 1_555 61.2 ? 14 "O3'" ? B G 19 ? B G 20 ? 1_555 K ? J K . ? A K 108 ? 1_555 O ? Z HOH . ? B HOH 206 ? 1_555 70.3 ? 15 OP1 ? B A 20 ? B A 21 ? 1_555 K ? J K . ? A K 108 ? 1_555 O ? Z HOH . ? B HOH 206 ? 1_555 42.8 ? 16 OP2 ? A G 19 ? A G 20 ? 1_555 MN ? G MN . ? A MN 105 ? 1_555 O ? Y HOH . ? A HOH 214 ? 1_555 92.3 ? 17 OP2 ? A G 19 ? A G 20 ? 1_555 MN ? G MN . ? A MN 105 ? 1_555 O ? Z HOH . ? B HOH 223 ? 4_455 174.3 ? 18 O ? Y HOH . ? A HOH 214 ? 1_555 MN ? G MN . ? A MN 105 ? 1_555 O ? Z HOH . ? B HOH 223 ? 4_455 84.1 ? 19 "O3'" ? A G 19 ? A G 20 ? 1_555 K ? K K . ? A K 109 ? 1_555 OP1 ? B U 7 ? B U 8 ? 1_555 165.1 ? 20 "O3'" ? A G 19 ? A G 20 ? 1_555 K ? K K . ? A K 109 ? 1_555 OP2 ? B U 7 ? B U 8 ? 1_555 143.6 ? 21 OP1 ? B U 7 ? B U 8 ? 1_555 K ? K K . ? A K 109 ? 1_555 OP2 ? B U 7 ? B U 8 ? 1_555 48.8 ? 22 "O3'" ? A G 19 ? A G 20 ? 1_555 K ? K K . ? A K 109 ? 1_555 O ? Z HOH . ? B HOH 216 ? 1_555 86.8 ? 23 OP1 ? B U 7 ? B U 8 ? 1_555 K ? K K . ? A K 109 ? 1_555 O ? Z HOH . ? B HOH 216 ? 1_555 100.1 ? 24 OP2 ? B U 7 ? B U 8 ? 1_555 K ? K K . ? A K 109 ? 1_555 O ? Z HOH . ? B HOH 216 ? 1_555 60.1 ? 25 N7 ? A G 23 ? A G 24 ? 1_555 MN ? E MN . ? A MN 103 ? 1_555 O ? Y HOH . ? A HOH 201 ? 1_555 102.0 ? 26 OP2 ? A C 29 ? A C 30 ? 1_555 MG ? M MG . ? A MG 111 ? 1_555 OP2 ? A A 30 ? A A 31 ? 1_555 89.4 ? 27 OP2 ? A C 29 ? A C 30 ? 1_555 MG ? M MG . ? A MG 111 ? 1_555 O ? Y HOH . ? A HOH 203 ? 1_555 48.3 ? 28 OP2 ? A A 30 ? A A 31 ? 1_555 MG ? M MG . ? A MG 111 ? 1_555 O ? Y HOH . ? A HOH 203 ? 1_555 66.4 ? 29 "O3'" ? A C 35 ? A C 36 ? 1_555 MG ? L MG . ? A MG 110 ? 1_555 "O2'" ? A C 35 ? A C 36 ? 1_555 88.9 ? 30 O ? Y HOH . ? A HOH 215 ? 1_555 MN ? D MN . ? A MN 102 ? 1_555 O ? Z HOH . ? B HOH 210 ? 1_555 78.8 ? 31 O ? Y HOH . ? A HOH 215 ? 1_555 MN ? D MN . ? A MN 102 ? 1_555 O ? Z HOH . ? B HOH 212 ? 1_555 87.4 ? 32 O ? Z HOH . ? B HOH 210 ? 1_555 MN ? D MN . ? A MN 102 ? 1_555 O ? Z HOH . ? B HOH 212 ? 1_555 92.7 ? 33 O ? Y HOH . ? A HOH 215 ? 1_555 MN ? D MN . ? A MN 102 ? 1_555 O ? Z HOH . ? B HOH 221 ? 2_555 76.1 ? 34 O ? Z HOH . ? B HOH 210 ? 1_555 MN ? D MN . ? A MN 102 ? 1_555 O ? Z HOH . ? B HOH 221 ? 2_555 82.1 ? 35 O ? Z HOH . ? B HOH 212 ? 1_555 MN ? D MN . ? A MN 102 ? 1_555 O ? Z HOH . ? B HOH 221 ? 2_555 163.3 ? 36 O ? Y HOH . ? A HOH 206 ? 1_556 MN ? P MN . ? B MN 102 ? 1_555 OP2 ? B C 29 ? B C 30 ? 1_555 91.0 ? 37 O ? Y HOH . ? A HOH 206 ? 1_556 MN ? P MN . ? B MN 102 ? 1_555 OP2 ? B A 30 ? B A 31 ? 1_555 85.3 ? 38 OP2 ? B C 29 ? B C 30 ? 1_555 MN ? P MN . ? B MN 102 ? 1_555 OP2 ? B A 30 ? B A 31 ? 1_555 92.3 ? 39 O ? Y HOH . ? A HOH 206 ? 1_556 MN ? P MN . ? B MN 102 ? 1_555 O ? Z HOH . ? B HOH 215 ? 1_555 167.2 ? 40 OP2 ? B C 29 ? B C 30 ? 1_555 MN ? P MN . ? B MN 102 ? 1_555 O ? Z HOH . ? B HOH 215 ? 1_555 85.2 ? 41 OP2 ? B A 30 ? B A 31 ? 1_555 MN ? P MN . ? B MN 102 ? 1_555 O ? Z HOH . ? B HOH 215 ? 1_555 82.7 ? 42 OP1 ? B A 11 ? B A 12 ? 1_555 MG ? V MG . ? B MG 108 ? 1_555 O ? Z HOH . ? B HOH 201 ? 2_555 104.2 ? 43 OP1 ? B A 11 ? B A 12 ? 1_555 MG ? V MG . ? B MG 108 ? 1_555 O ? Z HOH . ? B HOH 209 ? 1_555 85.0 ? 44 O ? Z HOH . ? B HOH 201 ? 2_555 MG ? V MG . ? B MG 108 ? 1_555 O ? Z HOH . ? B HOH 209 ? 1_555 160.0 ? 45 O ? Z HOH . ? B HOH 213 ? 1_555 MN ? Q MN . ? B MN 103 ? 1_555 O ? Z HOH . ? B HOH 217 ? 1_555 92.4 ? 46 O ? Z HOH . ? B HOH 213 ? 1_555 MN ? Q MN . ? B MN 103 ? 1_555 O ? Z HOH . ? B HOH 218 ? 1_555 67.7 ? 47 O ? Z HOH . ? B HOH 217 ? 1_555 MN ? Q MN . ? B MN 103 ? 1_555 O ? Z HOH . ? B HOH 218 ? 1_555 105.0 ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 MN B MN 102 ? ? O B HOH 203 ? ? 1.58 2 1 OP1 B G 2 ? ? "O3'" B GTP 101 ? ? 2.02 3 1 OP1 B G 24 ? ? O B HOH 201 ? ? 2.03 4 1 OP2 A G 24 ? ? O A HOH 201 ? ? 2.09 5 1 N7 A GTP 101 ? ? O A HOH 202 ? ? 2.10 6 1 OP1 B U 7 ? ? O B HOH 202 ? ? 2.11 7 1 O A HOH 208 ? ? O A HOH 216 ? ? 2.14 8 1 OP2 A C 30 ? ? O A HOH 203 ? ? 2.15 9 1 OP1 A G 2 ? ? "O3'" A GTP 101 ? ? 2.16 # _pdbx_entry_details.entry_id 8HZM _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification ? # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GTP PG P N N 111 GTP O1G O N N 112 GTP O2G O N N 113 GTP O3G O N N 114 GTP O3B O N N 115 GTP PB P N N 116 GTP O1B O N N 117 GTP O2B O N N 118 GTP O3A O N N 119 GTP PA P N N 120 GTP O1A O N N 121 GTP O2A O N N 122 GTP "O5'" O N N 123 GTP "C5'" C N N 124 GTP "C4'" C N R 125 GTP "O4'" O N N 126 GTP "C3'" C N S 127 GTP "O3'" O N N 128 GTP "C2'" C N R 129 GTP "O2'" O N N 130 GTP "C1'" C N R 131 GTP N9 N Y N 132 GTP C8 C Y N 133 GTP N7 N Y N 134 GTP C5 C Y N 135 GTP C6 C N N 136 GTP O6 O N N 137 GTP N1 N N N 138 GTP C2 C N N 139 GTP N2 N N N 140 GTP N3 N N N 141 GTP C4 C Y N 142 GTP HOG2 H N N 143 GTP HOG3 H N N 144 GTP HOB2 H N N 145 GTP HOA2 H N N 146 GTP "H5'" H N N 147 GTP "H5''" H N N 148 GTP "H4'" H N N 149 GTP "H3'" H N N 150 GTP "HO3'" H N N 151 GTP "H2'" H N N 152 GTP "HO2'" H N N 153 GTP "H1'" H N N 154 GTP H8 H N N 155 GTP HN1 H N N 156 GTP HN21 H N N 157 GTP HN22 H N N 158 HOH O O N N 159 HOH H1 H N N 160 HOH H2 H N N 161 K K K N N 162 MG MG MG N N 163 MN MN MN N N 164 NI4 C17 C Y N 165 NI4 C20 C Y N 166 NI4 C21 C Y N 167 NI4 C22 C Y N 168 NI4 C24 C N N 169 NI4 C01 C Y N 170 NI4 C02 C Y N 171 NI4 C03 C Y N 172 NI4 C04 C Y N 173 NI4 C05 C Y N 174 NI4 C06 C Y N 175 NI4 C07 C N N 176 NI4 C08 C N N 177 NI4 C09 C N N 178 NI4 N10 N N N 179 NI4 C11 C N N 180 NI4 C12 C N N 181 NI4 N13 N N N 182 NI4 C14 C N N 183 NI4 O15 O N N 184 NI4 C16 C N N 185 NI4 C18 C Y N 186 NI4 C19 C Y N 187 NI4 N23 N N N 188 NI4 C25 C N N 189 NI4 O26 O N N 190 NI4 C27 C N N 191 NI4 H1 H N N 192 NI4 H2 H N N 193 NI4 H3 H N N 194 NI4 H4 H N N 195 NI4 H5 H N N 196 NI4 H6 H N N 197 NI4 H7 H N N 198 NI4 H8 H N N 199 NI4 H9 H N N 200 NI4 H10 H N N 201 NI4 H11 H N N 202 NI4 H12 H N N 203 NI4 H13 H N N 204 NI4 H14 H N N 205 NI4 H15 H N N 206 NI4 H16 H N N 207 NI4 H17 H N N 208 NI4 H18 H N N 209 NI4 H19 H N N 210 NI4 H20 H N N 211 NI4 H21 H N N 212 NI4 H22 H N N 213 NI4 H23 H N N 214 U OP3 O N N 215 U P P N N 216 U OP1 O N N 217 U OP2 O N N 218 U "O5'" O N N 219 U "C5'" C N N 220 U "C4'" C N R 221 U "O4'" O N N 222 U "C3'" C N S 223 U "O3'" O N N 224 U "C2'" C N R 225 U "O2'" O N N 226 U "C1'" C N R 227 U N1 N N N 228 U C2 C N N 229 U O2 O N N 230 U N3 N N N 231 U C4 C N N 232 U O4 O N N 233 U C5 C N N 234 U C6 C N N 235 U HOP3 H N N 236 U HOP2 H N N 237 U "H5'" H N N 238 U "H5''" H N N 239 U "H4'" H N N 240 U "H3'" H N N 241 U "HO3'" H N N 242 U "H2'" H N N 243 U "HO2'" H N N 244 U "H1'" H N N 245 U H3 H N N 246 U H5 H N N 247 U H6 H N N 248 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GTP PG O1G doub N N 116 GTP PG O2G sing N N 117 GTP PG O3G sing N N 118 GTP PG O3B sing N N 119 GTP O2G HOG2 sing N N 120 GTP O3G HOG3 sing N N 121 GTP O3B PB sing N N 122 GTP PB O1B doub N N 123 GTP PB O2B sing N N 124 GTP PB O3A sing N N 125 GTP O2B HOB2 sing N N 126 GTP O3A PA sing N N 127 GTP PA O1A doub N N 128 GTP PA O2A sing N N 129 GTP PA "O5'" sing N N 130 GTP O2A HOA2 sing N N 131 GTP "O5'" "C5'" sing N N 132 GTP "C5'" "C4'" sing N N 133 GTP "C5'" "H5'" sing N N 134 GTP "C5'" "H5''" sing N N 135 GTP "C4'" "O4'" sing N N 136 GTP "C4'" "C3'" sing N N 137 GTP "C4'" "H4'" sing N N 138 GTP "O4'" "C1'" sing N N 139 GTP "C3'" "O3'" sing N N 140 GTP "C3'" "C2'" sing N N 141 GTP "C3'" "H3'" sing N N 142 GTP "O3'" "HO3'" sing N N 143 GTP "C2'" "O2'" sing N N 144 GTP "C2'" "C1'" sing N N 145 GTP "C2'" "H2'" sing N N 146 GTP "O2'" "HO2'" sing N N 147 GTP "C1'" N9 sing N N 148 GTP "C1'" "H1'" sing N N 149 GTP N9 C8 sing Y N 150 GTP N9 C4 sing Y N 151 GTP C8 N7 doub Y N 152 GTP C8 H8 sing N N 153 GTP N7 C5 sing Y N 154 GTP C5 C6 sing N N 155 GTP C5 C4 doub Y N 156 GTP C6 O6 doub N N 157 GTP C6 N1 sing N N 158 GTP N1 C2 sing N N 159 GTP N1 HN1 sing N N 160 GTP C2 N2 sing N N 161 GTP C2 N3 doub N N 162 GTP N2 HN21 sing N N 163 GTP N2 HN22 sing N N 164 GTP N3 C4 sing N N 165 HOH O H1 sing N N 166 HOH O H2 sing N N 167 NI4 O26 C25 sing N N 168 NI4 C24 C25 sing N N 169 NI4 C24 N23 sing N N 170 NI4 C19 C18 doub Y N 171 NI4 C19 C20 sing Y N 172 NI4 C18 C17 sing Y N 173 NI4 N23 C20 sing N N 174 NI4 N23 C27 sing N N 175 NI4 C20 C21 doub Y N 176 NI4 C17 C16 sing N N 177 NI4 C17 C22 doub Y N 178 NI4 C16 C11 doub N Z 179 NI4 O15 C12 doub N N 180 NI4 C21 C22 sing Y N 181 NI4 C12 C11 sing N N 182 NI4 C12 N13 sing N N 183 NI4 C11 N10 sing N N 184 NI4 N13 C14 sing N N 185 NI4 N13 C09 sing N N 186 NI4 N10 C09 doub N N 187 NI4 C09 C08 sing N N 188 NI4 C07 C08 doub N E 189 NI4 C07 C02 sing N N 190 NI4 C02 C03 doub Y N 191 NI4 C02 C01 sing Y N 192 NI4 C03 C04 sing Y N 193 NI4 C01 C06 doub Y N 194 NI4 C04 C05 doub Y N 195 NI4 C06 C05 sing Y N 196 NI4 C21 H1 sing N N 197 NI4 C22 H2 sing N N 198 NI4 C24 H3 sing N N 199 NI4 C24 H4 sing N N 200 NI4 C01 H5 sing N N 201 NI4 C03 H6 sing N N 202 NI4 C04 H7 sing N N 203 NI4 C05 H8 sing N N 204 NI4 C06 H9 sing N N 205 NI4 C07 H10 sing N N 206 NI4 C08 H11 sing N N 207 NI4 C14 H12 sing N N 208 NI4 C14 H13 sing N N 209 NI4 C14 H14 sing N N 210 NI4 C16 H15 sing N N 211 NI4 C18 H16 sing N N 212 NI4 C19 H17 sing N N 213 NI4 C25 H18 sing N N 214 NI4 C25 H19 sing N N 215 NI4 O26 H20 sing N N 216 NI4 C27 H21 sing N N 217 NI4 C27 H22 sing N N 218 NI4 C27 H23 sing N N 219 U OP3 P sing N N 220 U OP3 HOP3 sing N N 221 U P OP1 doub N N 222 U P OP2 sing N N 223 U P "O5'" sing N N 224 U OP2 HOP2 sing N N 225 U "O5'" "C5'" sing N N 226 U "C5'" "C4'" sing N N 227 U "C5'" "H5'" sing N N 228 U "C5'" "H5''" sing N N 229 U "C4'" "O4'" sing N N 230 U "C4'" "C3'" sing N N 231 U "C4'" "H4'" sing N N 232 U "O4'" "C1'" sing N N 233 U "C3'" "O3'" sing N N 234 U "C3'" "C2'" sing N N 235 U "C3'" "H3'" sing N N 236 U "O3'" "HO3'" sing N N 237 U "C2'" "O2'" sing N N 238 U "C2'" "C1'" sing N N 239 U "C2'" "H2'" sing N N 240 U "O2'" "HO2'" sing N N 241 U "C1'" N1 sing N N 242 U "C1'" "H1'" sing N N 243 U N1 C2 sing N N 244 U N1 C6 sing N N 245 U C2 O2 doub N N 246 U C2 N3 sing N N 247 U N3 C4 sing N N 248 U N3 H3 sing N N 249 U C4 O4 doub N N 250 U C4 C5 sing N N 251 U C5 C6 doub N N 252 U C5 H5 sing N N 253 U C6 H6 sing N N 254 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8HZM 'double helix' 8HZM 'a-form double helix' 8HZM tetraloop 8HZM 'mismatched base pair' 8HZM 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 34 1_555 -0.071 -0.222 -0.105 -7.043 -11.341 -3.619 1 A_G2:C35_A A 2 ? A 35 ? 19 1 1 A A 2 1_555 A U 33 1_555 0.549 -0.116 -0.260 -5.210 -18.114 1.097 2 A_A3:U34_A A 3 ? A 34 ? 20 1 1 A A 3 1_555 A U 32 1_555 0.404 -0.330 0.529 7.767 -13.636 -3.457 3 A_A4:U33_A A 4 ? A 33 ? 20 1 1 A G 4 1_555 A C 31 1_555 0.284 -0.155 0.222 -0.344 -13.110 0.830 4 A_G5:C32_A A 5 ? A 32 ? 19 1 1 A A 5 1_555 A A 30 1_555 1.325 1.573 0.018 -6.720 5.260 -168.982 5 A_A6:A31_A A 6 ? A 31 ? 1 2 1 A U 7 1_555 A A 28 1_555 3.847 -1.630 -1.310 11.302 -17.018 -105.530 6 A_U8:A29_A A 8 ? A 29 ? 24 4 1 A A 14 1_555 A G 27 1_555 -7.005 -4.818 0.266 -0.355 -3.533 -16.534 7 A_A15:G28_A A 15 ? A 28 ? 11 10 1 A U 15 1_555 A A 26 1_555 -0.182 0.062 0.102 5.372 -7.638 1.179 8 A_U16:A27_A A 16 ? A 27 ? 20 1 1 A G 16 1_555 A C 25 1_555 -0.228 -0.036 -0.059 2.305 1.458 7.647 9 A_G17:C26_A A 17 ? A 26 ? 19 1 1 A C 17 1_555 A G 24 1_555 0.350 -0.039 -0.162 6.612 -8.172 4.604 10 A_C18:G25_A A 18 ? A 25 ? 19 1 1 A C 18 1_555 A G 23 1_555 -0.201 -0.168 -0.267 -0.640 3.426 0.681 11 A_C19:G24_A A 19 ? A 24 ? 19 1 1 A G 19 1_555 A A 22 1_555 7.080 -5.097 0.672 13.356 7.132 -12.652 12 A_G20:A23_A A 20 ? A 23 ? ? 10 1 B G 1 1_555 B C 34 1_555 0.321 -0.374 -0.274 -6.482 -21.122 -10.024 13 B_G2:C35_B B 2 ? B 35 ? 19 1 1 B A 2 1_555 B U 33 1_555 0.664 -0.417 0.766 1.871 -17.228 5.607 14 B_A3:U34_B B 3 ? B 34 ? 20 1 1 B A 3 1_555 B U 32 1_555 0.530 -0.279 0.231 -2.585 -21.003 -1.954 15 B_A4:U33_B B 4 ? B 33 ? 20 1 1 B G 4 1_555 B C 31 1_555 -0.496 -0.057 0.182 0.090 -18.568 2.360 16 B_G5:C32_B B 5 ? B 32 ? 19 1 1 B A 5 1_555 B A 30 1_555 1.502 1.996 -0.298 -9.733 4.326 -172.274 17 B_A6:A31_B B 6 ? B 31 ? 1 2 1 B U 7 1_555 B A 28 1_555 4.053 -2.164 -1.087 10.754 -20.403 -94.339 18 B_U8:A29_B B 8 ? B 29 ? 24 4 1 B A 14 1_555 B G 27 1_555 -7.041 -4.910 -0.268 1.553 3.033 -16.863 19 B_A15:G28_B B 15 ? B 28 ? 11 10 1 B U 15 1_555 B A 26 1_555 -0.900 -0.077 -0.677 18.039 -10.843 -0.053 20 B_U16:A27_B B 16 ? B 27 ? 20 1 1 B G 16 1_555 B C 25 1_555 0.148 -0.013 -0.193 2.904 -3.581 2.437 21 B_G17:C26_B B 17 ? B 26 ? 19 1 1 B C 17 1_555 B G 24 1_555 0.323 -0.072 -0.225 5.225 -13.647 5.384 22 B_C18:G25_B B 18 ? B 25 ? 19 1 1 B C 18 1_555 B G 23 1_555 0.481 -0.566 -0.521 1.266 -3.004 -2.421 23 B_C19:G24_B B 19 ? B 24 ? 19 1 1 B G 19 1_555 B A 22 1_555 7.275 -5.745 1.074 10.634 1.100 -18.101 24 B_G20:A23_B B 20 ? B 23 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 34 1_555 A A 2 1_555 A U 33 1_555 -0.084 -1.059 3.156 2.443 7.159 36.185 -2.573 0.440 2.890 11.374 -3.881 36.941 1 AA_G2A3:U34C35_AA A 2 ? A 35 ? A 3 ? A 34 ? 1 A A 2 1_555 A U 33 1_555 A A 3 1_555 A U 32 1_555 0.388 -0.844 2.780 -2.486 3.817 31.346 -2.132 -1.093 2.623 7.018 4.570 31.667 2 AA_A3A4:U33U34_AA A 3 ? A 34 ? A 4 ? A 33 ? 1 A A 3 1_555 A U 32 1_555 A G 4 1_555 A C 31 1_555 0.788 -1.668 3.387 8.563 8.537 32.413 -4.137 0.006 2.974 14.671 -14.716 34.538 3 AA_A4G5:C32U33_AA A 4 ? A 33 ? A 5 ? A 32 ? 1 A G 4 1_555 A C 31 1_555 A A 5 1_555 A A 30 1_555 -3.346 0.782 -0.132 90.906 148.635 173.376 0.395 1.671 -0.194 74.322 -45.455 179.667 4 AA_G5A6:A31C32_AA A 5 ? A 32 ? A 6 ? A 31 ? 1 A A 5 1_555 A A 30 1_555 A U 7 1_555 A A 28 1_555 2.462 -1.431 -2.073 132.723 95.303 -170.193 0.768 1.158 -2.165 -47.669 66.386 -178.586 5 AA_A6U8:A29A31_AA A 6 ? A 31 ? A 8 ? A 29 ? 1 A A 14 1_555 A G 27 1_555 A U 15 1_555 A A 26 1_555 1.250 -0.776 3.208 -2.853 6.565 60.998 -1.058 -1.354 3.063 6.443 2.800 61.376 6 AA_A15U16:A27G28_AA A 15 ? A 28 ? A 16 ? A 27 ? 1 A U 15 1_555 A A 26 1_555 A G 16 1_555 A C 25 1_555 -0.213 -1.752 3.189 -2.249 9.690 30.157 -4.805 0.018 2.527 18.018 4.183 31.720 7 AA_U16G17:C26A27_AA A 16 ? A 27 ? A 17 ? A 26 ? 1 A G 16 1_555 A C 25 1_555 A C 17 1_555 A G 24 1_555 0.071 -2.090 3.076 0.141 5.751 32.226 -4.589 -0.105 2.673 10.258 -0.252 32.722 8 AA_G17C18:G25C26_AA A 17 ? A 26 ? A 18 ? A 25 ? 1 A C 17 1_555 A G 24 1_555 A C 18 1_555 A G 23 1_555 -0.458 -2.057 3.256 0.547 12.947 30.134 -5.594 0.894 2.201 23.579 -0.996 32.743 9 AA_C18C19:G24G25_AA A 18 ? A 25 ? A 19 ? A 24 ? 1 A C 18 1_555 A G 23 1_555 A G 19 1_555 A A 22 1_555 -1.887 -0.925 2.892 -1.798 7.837 55.931 -1.364 1.906 2.804 8.308 1.907 56.460 10 AA_C19G20:A23G24_AA A 19 ? A 24 ? A 20 ? A 23 ? 1 B G 1 1_555 B C 34 1_555 B A 2 1_555 B U 33 1_555 0.319 -1.548 2.746 -5.784 6.209 36.227 -3.085 -1.112 2.380 9.820 9.148 37.175 11 BB_G2A3:U34C35_BB B 2 ? B 35 ? B 3 ? B 34 ? 1 B A 2 1_555 B U 33 1_555 B A 3 1_555 B U 32 1_555 -0.381 -1.066 3.146 7.089 6.782 32.848 -2.793 1.674 2.739 11.672 -12.201 34.243 12 BB_A3A4:U33U34_BB B 3 ? B 34 ? B 4 ? B 33 ? 1 B A 3 1_555 B U 32 1_555 B G 4 1_555 B C 31 1_555 0.828 -1.573 3.138 6.345 10.846 30.364 -4.475 -0.477 2.559 19.681 -11.513 32.805 13 BB_A4G5:C32U33_BB B 4 ? B 33 ? B 5 ? B 32 ? 1 B G 4 1_555 B C 31 1_555 B A 5 1_555 B A 30 1_555 -3.116 1.148 0.665 88.813 153.589 94.948 0.444 1.633 0.107 77.088 -44.577 178.255 14 BB_G5A6:A31C32_BB B 5 ? B 32 ? B 6 ? B 31 ? 1 B A 5 1_555 B A 30 1_555 B U 7 1_555 B A 28 1_555 -1.971 2.084 -2.754 -133.315 -98.179 154.810 0.868 1.222 -2.612 -49.192 66.796 176.860 15 BB_A6U8:A29A31_BB B 6 ? B 31 ? B 8 ? B 29 ? 1 B A 14 1_555 B G 27 1_555 B U 15 1_555 B A 26 1_555 1.348 -1.081 3.054 3.002 1.701 54.827 -1.267 -1.293 3.086 1.846 -3.257 54.927 16 BB_A15U16:A27G28_BB B 15 ? B 28 ? B 16 ? B 27 ? 1 B U 15 1_555 B A 26 1_555 B G 16 1_555 B C 25 1_555 -0.434 -1.873 3.734 -6.079 11.382 30.746 -5.279 -0.315 2.909 20.377 10.882 33.284 17 BB_U16G17:C26A27_BB B 16 ? B 27 ? B 17 ? B 26 ? 1 B G 16 1_555 B C 25 1_555 B C 17 1_555 B G 24 1_555 0.269 -1.805 3.276 0.929 2.133 34.135 -3.399 -0.312 3.167 3.628 -1.581 34.212 18 BB_G17C18:G25C26_BB B 17 ? B 26 ? B 18 ? B 25 ? 1 B C 17 1_555 B G 24 1_555 B C 18 1_555 B G 23 1_555 -0.886 -1.639 3.100 1.267 15.797 32.156 -4.570 1.596 2.061 26.597 -2.133 35.756 19 BB_C18C19:G24G25_BB B 18 ? B 25 ? B 19 ? B 24 ? 1 B C 18 1_555 B G 23 1_555 B G 19 1_555 B A 22 1_555 -2.718 -0.837 3.094 -7.542 11.668 57.040 -1.449 2.395 3.188 12.022 7.771 58.569 20 BB_C19G20:A23G24_BB B 19 ? B 24 ? B 20 ? B 23 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id NI4 _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id NI4 _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 8HZE _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 8HZM _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.012871 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.005651 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.021335 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.019254 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C K MG MN N O P # loop_