data_8S95 # _entry.id 8S95 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.379 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8S95 pdb_00008s95 10.2210/pdb8s95/pdb WWPDB D_1000273030 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8S95 _pdbx_database_status.recvd_initial_deposition_date 2023-03-27 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'McNeme, S.C.' 1 0000-0003-0304-4247 'Choi, K.H.' 2 0000-0003-0865-1265 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 51 _citation.language ? _citation.page_first 8850 _citation.page_last 8863 _citation.title 'Structural basis for cloverleaf RNA-initiated viral genome replication.' _citation.year 2023 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkad618 _citation.pdbx_database_id_PubMed 37486760 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Gottipati, K.' 1 ? primary 'McNeme, S.C.' 2 ? primary 'Tipo, J.' 3 ? primary 'White, M.A.' 4 ? primary 'Choi, K.H.' 5 ? # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 98.039 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 8S95 _cell.details ? _cell.formula_units_Z ? _cell.length_a 150.021 _cell.length_a_esd ? _cell.length_b 28.015 _cell.length_b_esd ? _cell.length_c 111.267 _cell.length_c_esd ? _cell.volume 463041.790 _cell.volume_esd ? _cell.Z_PDB 4 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8S95 _symmetry.cell_setting ? _symmetry.Int_Tables_number 5 _symmetry.space_group_name_Hall 'C 2y' _symmetry.space_group_name_H-M 'C 1 2 1' _symmetry.pdbx_full_space_group_name_H-M ? # _entity.id 1 _entity.type polymer _entity.src_method man _entity.pdbx_description 'Lysine tRNA scaffold,Poliovirus cloverleaf RNA' _entity.formula_weight 50486.848 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;CGCCCGGAUAGCUCAGUCGGUAGAGCAGCGGCUAAAACAGCUCUGGGGUUGUACCCACCCCAGAGGCCCACGUGGCGGCU AGUACUCCGGUAUUGCGGUACCCUUGUACGCCUGUUUUAGCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA ; _entity_poly.pdbx_seq_one_letter_code_can ;CGCCCGGAUAGCUCAGUCGGUAGAGCAGCGGCUAAAACAGCUCUGGGGUUGUACCCACCCCAGAGGCCCACGUGGCGGCU AGUACUCCGGUAUUGCGGUACCCUUGUACGCCUGUUUUAGCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA ; _entity_poly.pdbx_strand_id C _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 C n 1 2 G n 1 3 C n 1 4 C n 1 5 C n 1 6 G n 1 7 G n 1 8 A n 1 9 U n 1 10 A n 1 11 G n 1 12 C n 1 13 U n 1 14 C n 1 15 A n 1 16 G n 1 17 U n 1 18 C n 1 19 G n 1 20 G n 1 21 U n 1 22 A n 1 23 G n 1 24 A n 1 25 G n 1 26 C n 1 27 A n 1 28 G n 1 29 C n 1 30 G n 1 31 G n 1 32 C n 1 33 U n 1 34 A n 1 35 A n 1 36 A n 1 37 A n 1 38 C n 1 39 A n 1 40 G n 1 41 C n 1 42 U n 1 43 C n 1 44 U n 1 45 G n 1 46 G n 1 47 G n 1 48 G n 1 49 U n 1 50 U n 1 51 G n 1 52 U n 1 53 A n 1 54 C n 1 55 C n 1 56 C n 1 57 A n 1 58 C n 1 59 C n 1 60 C n 1 61 C n 1 62 A n 1 63 G n 1 64 A n 1 65 G n 1 66 G n 1 67 C n 1 68 C n 1 69 C n 1 70 A n 1 71 C n 1 72 G n 1 73 U n 1 74 G n 1 75 G n 1 76 C n 1 77 G n 1 78 G n 1 79 C n 1 80 U n 1 81 A n 1 82 G n 1 83 U n 1 84 A n 1 85 C n 1 86 U n 1 87 C n 1 88 C n 1 89 G n 1 90 G n 1 91 U n 1 92 A n 1 93 U n 1 94 U n 1 95 G n 1 96 C n 1 97 G n 1 98 G n 1 99 U n 1 100 A n 1 101 C n 1 102 C n 1 103 C n 1 104 U n 1 105 U n 1 106 G n 1 107 U n 1 108 A n 1 109 C n 1 110 G n 1 111 C n 1 112 C n 1 113 U n 1 114 G n 1 115 U n 1 116 U n 1 117 U n 1 118 U n 1 119 A n 1 120 G n 1 121 C n 1 122 C n 1 123 G n 1 124 C n 1 125 G n 1 126 G n 1 127 G n 1 128 U n 1 129 C n 1 130 C n 1 131 A n 1 132 G n 1 133 G n 1 134 G n 1 135 U n 1 136 U n 1 137 C n 1 138 A n 1 139 A n 1 140 G n 1 141 U n 1 142 C n 1 143 C n 1 144 C n 1 145 U n 1 146 G n 1 147 U n 1 148 U n 1 149 C n 1 150 G n 1 151 G n 1 152 G n 1 153 C n 1 154 G n 1 155 C n 1 156 C n 1 157 A n # loop_ _entity_src_gen.entity_id _entity_src_gen.pdbx_src_id _entity_src_gen.pdbx_alt_source_flag _entity_src_gen.pdbx_seq_type _entity_src_gen.pdbx_beg_seq_num _entity_src_gen.pdbx_end_seq_num _entity_src_gen.gene_src_common_name _entity_src_gen.gene_src_genus _entity_src_gen.pdbx_gene_src_gene _entity_src_gen.gene_src_species _entity_src_gen.gene_src_strain _entity_src_gen.gene_src_tissue _entity_src_gen.gene_src_tissue_fraction _entity_src_gen.gene_src_details _entity_src_gen.pdbx_gene_src_fragment _entity_src_gen.pdbx_gene_src_scientific_name _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id _entity_src_gen.pdbx_gene_src_variant _entity_src_gen.pdbx_gene_src_cell_line _entity_src_gen.pdbx_gene_src_atcc _entity_src_gen.pdbx_gene_src_organ _entity_src_gen.pdbx_gene_src_organelle _entity_src_gen.pdbx_gene_src_cell _entity_src_gen.pdbx_gene_src_cellular_location _entity_src_gen.host_org_common_name _entity_src_gen.pdbx_host_org_scientific_name _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id _entity_src_gen.host_org_genus _entity_src_gen.pdbx_host_org_gene _entity_src_gen.pdbx_host_org_organ _entity_src_gen.host_org_species _entity_src_gen.pdbx_host_org_tissue _entity_src_gen.pdbx_host_org_tissue_fraction _entity_src_gen.pdbx_host_org_strain _entity_src_gen.pdbx_host_org_variant _entity_src_gen.pdbx_host_org_cell_line _entity_src_gen.pdbx_host_org_atcc _entity_src_gen.pdbx_host_org_culture_collection _entity_src_gen.pdbx_host_org_cell _entity_src_gen.pdbx_host_org_organelle _entity_src_gen.pdbx_host_org_cellular_location _entity_src_gen.pdbx_host_org_vector_type _entity_src_gen.pdbx_host_org_vector _entity_src_gen.host_org_details _entity_src_gen.expression_system_id _entity_src_gen.plasmid_name _entity_src_gen.plasmid_details _entity_src_gen.pdbx_description 1 1 sample 'Biological sequence' 1 32 human ? ? ? ? ? ? ? ? 'Homo sapiens' 9606 ? ? ? ? ? ? ? ? 'Escherichia coli BL21(DE3)' 469008 ? ? ? ? ? ? ? ? ? ? ? ? ? ? Plasmid ? 'lpp promoter, rrnC terminator, Amp resistant' ? 'pBluescript II SK+' ? ? 1 2 sample 'Biological sequence' 33 119 ? ? ? ? 'Mahoney 1' ? ? ? ? 'Poliovirus 1' 12081 ? ? ? ? ? ? ? ? 'Escherichia coli BL21(DE3)' 469008 ? ? ? ? ? ? ? ? ? ? ? ? ? ? Plasmid ? 'lpp promoter, rrnC terminator, Amp resistant' ? 'pBluescript II SK+' ? ? 1 3 sample 'Biological sequence' 120 157 ? ? ? ? ? ? ? ? ? 'Homo sapiens' 9606 ? ? ? ? ? ? ? ? 'Escherichia coli BL21(DE3)' 469008 ? ? ? ? ? ? ? ? ? ? ? ? ? ? Plasmid ? 'lpp promoter, rrnC terminator, Amp resistant' ? 'pBluescript II SK+' ? ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 GB U00939.1 U00939.1 ? 1 GCCCGGAUAGCUCAGUCGGUAGAGCA 1 2 GB V01149.1 V01149.1 ? 1 ;UAAAACAGCUCUGGGGUUGUACCCACCCCAGAGGCCCACGUGGCGGCUAGUACUCCGGUAUUGCGGUACCCUUGUACGCC UGUUUUA ; 2 3 GB U00939.1 U00939.1 ? 1 GGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA 44 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 8S95 C 2 ? 27 ? U00939.1 1 ? 26 ? 1 26 2 2 8S95 C 33 ? 119 ? V01149.1 2 ? 88 ? 32 118 3 3 8S95 C 125 ? 157 ? U00939.1 44 ? 76 ? 124 156 # loop_ _struct_ref_seq_dif.align_id _struct_ref_seq_dif.pdbx_pdb_id_code _struct_ref_seq_dif.mon_id _struct_ref_seq_dif.pdbx_pdb_strand_id _struct_ref_seq_dif.seq_num _struct_ref_seq_dif.pdbx_pdb_ins_code _struct_ref_seq_dif.pdbx_seq_db_name _struct_ref_seq_dif.pdbx_seq_db_accession_code _struct_ref_seq_dif.db_mon_id _struct_ref_seq_dif.pdbx_seq_db_seq_num _struct_ref_seq_dif.details _struct_ref_seq_dif.pdbx_auth_seq_num _struct_ref_seq_dif.pdbx_ordinal 1 8S95 C C 1 ? GB U00939.1 ? ? 'cloning artifact' 0 1 1 8S95 G C 28 ? GB U00939.1 ? ? linker 27 2 1 8S95 C C 29 ? GB U00939.1 ? ? linker 28 3 1 8S95 G C 30 ? GB U00939.1 ? ? linker 29 4 1 8S95 G C 31 ? GB U00939.1 ? ? linker 30 5 1 8S95 C C 32 ? GB U00939.1 ? ? linker 31 6 2 8S95 G C 120 ? GB V01149.1 ? ? linker 119 7 2 8S95 C C 121 ? GB V01149.1 ? ? linker 120 8 2 8S95 C C 122 ? GB V01149.1 ? ? linker 121 9 2 8S95 G C 123 ? GB V01149.1 ? ? linker 122 10 2 8S95 C C 124 ? GB V01149.1 ? ? linker 123 11 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8S95 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.29 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 63.8 _exptl_crystal.description 'flat plate-like crystals emanating from a single nucleating event like flower petals' _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas 4 _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 7.4 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details 'LN2 cryostream' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;47% polypropylene glycol P 400, 100mM Imidazole pH 7.4. 1uL of mother liquor mixed with 1 uL RNA (4mg/mL), and then before sealing well, 10%(v/v) methanol was added to mother liquor, not drop ; _exptl_crystal_grow.pdbx_pH_range 7.4-7.4 _exptl_crystal_grow.temp 292 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details 'cold nitrogen gas stream' _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details 'MSC Varimax Confocal Cu/Cr' _diffrn_detector.detector 'IMAGE PLATE' _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'RIGAKU RAXIS II' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2021-06-03 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator 'MSC Varimax Confocal Cu/Cr' _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.542 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source 'ROTATING ANODE' _diffrn_source.target ? _diffrn_source.type 'RIGAKU FR-E+ DW' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.542 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline ? _diffrn_source.pdbx_synchrotron_site ? # _reflns.B_iso_Wilson_estimate 78.29 _reflns.entry_id 8S95 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.99 _reflns.d_resolution_low 47.54 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 8747 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.7 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 5.4 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 6.5 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all 0.127 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half ? _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 3.10 _reflns_shell.d_res_low 3.15 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 2838 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 4.9 _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all 0.635 _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half ? _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all 99.8 _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 114.52 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8S95 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.10 _refine.ls_d_res_low 47.54 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 8745 _refine.ls_number_reflns_R_free 438 _refine.ls_number_reflns_R_work 8307 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.51 _refine.ls_percent_reflns_R_free 5.01 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2756 _refine.ls_R_factor_R_free 0.2874 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2749 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.33 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 37.2127 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.4922 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 3.10 _refine_hist.d_res_low 47.54 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 3109 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 3109 _refine_hist.pdbx_number_atoms_ligand 0 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0028 ? 3470 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.5866 ? 5405 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0327 ? 729 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0025 ? 146 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 20.9663 ? 1746 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 3.10 3.55 . . 141 2697 99.8 . . . . 0.3434 . . . . . . . . . . . 0.3671 'X-RAY DIFFRACTION' 3.55 4.47 . . 146 2761 99.86 . . . . 0.3333 . . . . . . . . . . . 0.3359 # _struct.entry_id 8S95 _struct.title 'Crystal Structure of Poliovirus (type 1 Mahoney) cloverleaf RNA with tRNA scaffold' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8S95 _struct_keywords.text 'cloverleaf, H-type junction, promoter, A-C-U base triple, RNA' _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 153 N3 ? ? C G 1 C C 152 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 153 O2 ? ? C G 1 C C 152 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 153 N4 ? ? C G 1 C C 152 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 152 N1 ? ? C C 2 C G 151 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 152 O6 ? ? C C 2 C G 151 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 152 N2 ? ? C C 2 C G 151 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 151 N1 ? ? C C 3 C G 150 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 151 O6 ? ? C C 3 C G 150 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 151 N2 ? ? C C 3 C G 150 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 152 N1 ? ? C C 3 C G 151 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 152 O6 ? ? C C 3 C G 151 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 152 N2 ? ? C C 3 C G 151 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 150 N1 ? ? C C 4 C G 149 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 150 O6 ? ? C C 4 C G 149 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 150 N2 ? ? C C 4 C G 149 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 149 N3 ? ? C G 5 C C 148 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 149 O2 ? ? C G 5 C C 148 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 149 N4 ? ? C G 5 C C 148 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 7 N1 ? ? ? 1_555 A U 148 O2 ? ? C G 6 C U 147 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog20 hydrog ? ? A G 7 O6 ? ? ? 1_555 A U 148 N3 ? ? C G 6 C U 147 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog21 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 147 N3 ? ? C A 7 C U 146 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 147 O4 ? ? C A 7 C U 146 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 15 N7 ? ? C U 8 C A 14 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog24 hydrog ? ? A U 9 O2 ? ? ? 1_555 A A 15 N6 ? ? C U 8 C A 14 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog25 hydrog ? ? A A 10 N6 ? ? ? 1_555 A A 24 N7 ? ? C A 9 C A 23 1_555 ? ? ? ? ? ? TYPE_2_PAIR ? ? ? hydrog26 hydrog ? ? A A 10 N7 ? ? ? 1_555 A A 24 N6 ? ? C A 9 C A 23 1_555 ? ? ? ? ? ? TYPE_2_PAIR ? ? ? hydrog27 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 26 N3 ? ? C G 10 C C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 26 O2 ? ? C G 10 C C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 26 N4 ? ? C G 10 C C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 25 N1 ? ? C C 11 C G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 25 O6 ? ? C C 11 C G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 25 N2 ? ? C C 11 C G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A U 13 N3 ? ? ? 1_555 A A 24 N1 ? ? C U 12 C A 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A U 13 O4 ? ? ? 1_555 A A 24 N6 ? ? C U 12 C A 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 23 N1 ? ? C C 13 C G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 23 O6 ? ? C C 13 C G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 23 N2 ? ? C C 13 C G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A A 15 N6 ? ? ? 1_555 A A 22 N3 ? ? C A 14 C A 21 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog39 hydrog ? ? A G 16 N1 ? ? ? 1_555 A C 129 O2 ? ? C G 15 C C 128 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog40 hydrog ? ? A G 16 N2 ? ? ? 1_555 A C 129 N3 ? ? C G 15 C C 128 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog41 hydrog ? ? A G 19 N1 ? ? ? 1_555 A U 136 O2 ? ? C G 18 C U 135 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog42 hydrog ? ? A G 20 N1 ? ? ? 1_555 A C 137 N3 ? ? C G 19 C C 136 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 20 N2 ? ? ? 1_555 A C 137 O2 ? ? C G 19 C C 136 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 20 O6 ? ? ? 1_555 A C 137 N4 ? ? C G 19 C C 136 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 23 N7 ? ? ? 1_555 A G 127 N1 ? ? C G 22 C G 126 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog46 hydrog ? ? A G 23 O6 ? ? ? 1_555 A G 127 N2 ? ? C G 22 C G 126 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog47 hydrog ? ? A A 27 N1 ? ? ? 1_555 A G 125 N1 ? ? C A 26 C G 124 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog48 hydrog ? ? A A 27 N6 ? ? ? 1_555 A G 125 O6 ? ? C A 26 C G 124 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog49 hydrog ? ? A G 28 N1 ? ? ? 1_555 A C 124 N3 ? ? C G 27 C C 123 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 124 O2 ? ? C G 27 C C 123 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 28 O6 ? ? ? 1_555 A C 124 N4 ? ? C G 27 C C 123 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 29 N3 ? ? ? 1_555 A G 123 N1 ? ? C C 28 C G 122 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 29 N4 ? ? ? 1_555 A G 123 O6 ? ? C C 28 C G 122 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 29 O2 ? ? ? 1_555 A G 123 N2 ? ? C C 28 C G 122 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 30 N1 ? ? ? 1_555 A C 122 N3 ? ? C G 29 C C 121 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 30 N2 ? ? ? 1_555 A C 122 O2 ? ? C G 29 C C 121 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A G 30 O6 ? ? ? 1_555 A C 122 N4 ? ? C G 29 C C 121 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 121 N3 ? ? C G 30 C C 120 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 121 O2 ? ? C G 30 C C 120 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 121 N4 ? ? C G 30 C C 120 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A C 32 N3 ? ? ? 1_555 A G 120 N1 ? ? C C 31 C G 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A C 32 N4 ? ? ? 1_555 A G 120 O6 ? ? C C 31 C G 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A C 32 O2 ? ? ? 1_555 A G 120 N2 ? ? C C 31 C G 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A U 33 N3 ? ? ? 1_555 A A 119 N1 ? ? C U 32 C A 118 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A U 33 O4 ? ? ? 1_555 A A 119 N6 ? ? C U 32 C A 118 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A A 34 N1 ? ? ? 1_555 A U 118 N3 ? ? C A 33 C U 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A A 34 N6 ? ? ? 1_555 A U 118 O4 ? ? C A 33 C U 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A A 35 N1 ? ? ? 1_555 A U 117 N3 ? ? C A 34 C U 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A A 35 N6 ? ? ? 1_555 A U 117 O4 ? ? C A 34 C U 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A A 36 N1 ? ? ? 1_555 A U 116 N3 ? ? C A 35 C U 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A A 36 N6 ? ? ? 1_555 A U 116 O4 ? ? C A 35 C U 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A A 37 N1 ? ? ? 1_555 A U 115 N3 ? ? C A 36 C U 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A A 37 N6 ? ? ? 1_555 A U 115 O4 ? ? C A 36 C U 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A C 38 N3 ? ? ? 1_555 A G 114 N1 ? ? C C 37 C G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A C 38 N4 ? ? ? 1_555 A G 114 O6 ? ? C C 37 C G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A C 38 O2 ? ? ? 1_555 A G 114 N2 ? ? C C 37 C G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A A 39 N1 ? ? ? 1_555 A U 113 N3 ? ? C A 38 C U 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A A 39 N6 ? ? ? 1_555 A U 113 O4 ? ? C A 38 C U 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A G 40 N1 ? ? ? 1_555 A C 112 N3 ? ? C G 39 C C 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A G 40 N2 ? ? ? 1_555 A C 112 O2 ? ? C G 39 C C 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A G 40 O6 ? ? ? 1_555 A C 112 N4 ? ? C G 39 C C 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A C 41 N3 ? ? ? 1_555 A G 65 N1 ? ? C C 40 C G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A C 41 N4 ? ? ? 1_555 A G 65 O6 ? ? C C 40 C G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A C 41 O2 ? ? ? 1_555 A G 65 N2 ? ? C C 40 C G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A U 42 N3 ? ? ? 1_555 A A 64 N1 ? ? C U 41 C A 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A U 42 O4 ? ? ? 1_555 A A 64 N6 ? ? C U 41 C A 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A C 43 N3 ? ? ? 1_555 A G 63 N1 ? ? C C 42 C G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A C 43 N4 ? ? ? 1_555 A G 63 O6 ? ? C C 42 C G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A C 43 O2 ? ? ? 1_555 A G 63 N2 ? ? C C 42 C G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A U 44 N3 ? ? ? 1_555 A A 62 N1 ? ? C U 43 C A 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A U 44 O4 ? ? ? 1_555 A A 62 N6 ? ? C U 43 C A 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A G 45 N1 ? ? ? 1_555 A C 61 N3 ? ? C G 44 C C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A G 45 N2 ? ? ? 1_555 A C 61 O2 ? ? C G 44 C C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? A G 45 O6 ? ? ? 1_555 A C 61 N4 ? ? C G 44 C C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A G 46 N1 ? ? ? 1_555 A C 60 N3 ? ? C G 45 C C 59 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A G 46 N2 ? ? ? 1_555 A C 60 O2 ? ? C G 45 C C 59 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? A G 46 O6 ? ? ? 1_555 A C 60 N4 ? ? C G 45 C C 59 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? A G 47 N1 ? ? ? 1_555 A C 59 N3 ? ? C G 46 C C 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? A G 47 N2 ? ? ? 1_555 A C 59 O2 ? ? C G 46 C C 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? A G 47 O6 ? ? ? 1_555 A C 59 N4 ? ? C G 46 C C 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog101 hydrog ? ? A G 66 N1 ? ? ? 1_555 A C 76 N3 ? ? C G 65 C C 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog102 hydrog ? ? A G 66 N2 ? ? ? 1_555 A C 76 O2 ? ? C G 65 C C 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog103 hydrog ? ? A G 66 O6 ? ? ? 1_555 A C 76 N4 ? ? C G 65 C C 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog104 hydrog ? ? A C 67 O2 ? ? ? 1_555 A G 75 N2 ? ? C C 66 C G 74 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog105 hydrog ? ? A C 68 N3 ? ? ? 1_555 A G 74 N1 ? ? C C 67 C G 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog106 hydrog ? ? A C 68 N4 ? ? ? 1_555 A G 74 O6 ? ? C C 67 C G 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog107 hydrog ? ? A C 68 O2 ? ? ? 1_555 A G 74 N2 ? ? C C 67 C G 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog108 hydrog ? ? A C 68 N3 ? ? ? 1_555 A G 75 N1 ? ? C C 67 C G 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog109 hydrog ? ? A C 68 N4 ? ? ? 1_555 A G 75 O6 ? ? C C 67 C G 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog110 hydrog ? ? A C 68 O2 ? ? ? 1_555 A G 75 N2 ? ? C C 67 C G 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog111 hydrog ? ? A C 69 N3 ? ? ? 1_555 A G 74 N1 ? ? C C 68 C G 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog112 hydrog ? ? A C 69 N4 ? ? ? 1_555 A G 74 O6 ? ? C C 68 C G 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog113 hydrog ? ? A C 69 O2 ? ? ? 1_555 A G 74 N2 ? ? C C 68 C G 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog114 hydrog ? ? A A 70 N6 ? ? ? 1_555 A C 87 O2 ? ? C A 69 C C 86 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog115 hydrog ? ? A A 70 N6 ? ? ? 1_555 A U 104 O2 ? ? C A 69 C U 103 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog116 hydrog ? ? A G 77 N1 ? ? ? 1_555 A G 82 O6 ? ? C G 76 C G 81 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog117 hydrog ? ? A G 77 N2 ? ? ? 1_555 A G 82 N7 ? ? C G 76 C G 81 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog118 hydrog ? ? A G 77 O6 ? ? ? 1_555 A C 109 N4 ? ? C G 76 C C 108 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog119 hydrog ? ? A G 78 N1 ? ? ? 1_555 A C 111 N3 ? ? C G 77 C C 110 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog120 hydrog ? ? A G 78 N2 ? ? ? 1_555 A C 111 O2 ? ? C G 77 C C 110 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog121 hydrog ? ? A G 78 O6 ? ? ? 1_555 A C 111 N4 ? ? C G 77 C C 110 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog122 hydrog ? ? A C 79 N3 ? ? ? 1_555 A G 110 N1 ? ? C C 78 C G 109 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog123 hydrog ? ? A C 79 N4 ? ? ? 1_555 A G 110 O6 ? ? C C 78 C G 109 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog124 hydrog ? ? A C 79 O2 ? ? ? 1_555 A G 110 N2 ? ? C C 78 C G 109 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog125 hydrog ? ? A A 81 N3 ? ? ? 1_555 A G 110 N2 ? ? C A 80 C G 109 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog126 hydrog ? ? A G 82 N1 ? ? ? 1_555 A C 109 N3 ? ? C G 81 C C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog127 hydrog ? ? A G 82 N2 ? ? ? 1_555 A C 109 O2 ? ? C G 81 C C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog128 hydrog ? ? A G 82 O6 ? ? ? 1_555 A C 109 N4 ? ? C G 81 C C 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog129 hydrog ? ? A U 83 N3 ? ? ? 1_555 A A 108 N1 ? ? C U 82 C A 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog130 hydrog ? ? A U 83 O4 ? ? ? 1_555 A A 108 N6 ? ? C U 82 C A 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog131 hydrog ? ? A A 84 N1 ? ? ? 1_555 A U 107 N3 ? ? C A 83 C U 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog132 hydrog ? ? A A 84 N6 ? ? ? 1_555 A U 107 O4 ? ? C A 83 C U 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog133 hydrog ? ? A C 85 N3 ? ? ? 1_555 A G 106 N1 ? ? C C 84 C G 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog134 hydrog ? ? A C 85 N4 ? ? ? 1_555 A G 106 O6 ? ? C C 84 C G 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog135 hydrog ? ? A C 85 O2 ? ? ? 1_555 A G 106 N2 ? ? C C 84 C G 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog136 hydrog ? ? A U 86 O2 ? ? ? 1_555 A U 105 N3 ? ? C U 85 C U 104 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog137 hydrog ? ? A C 87 N3 ? ? ? 1_555 A U 104 N3 ? ? C C 86 C U 103 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog138 hydrog ? ? A C 87 N4 ? ? ? 1_555 A U 104 O4 ? ? C C 86 C U 103 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog139 hydrog ? ? A G 89 N1 ? ? ? 1_555 A C 102 N3 ? ? C G 88 C C 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog140 hydrog ? ? A G 89 N2 ? ? ? 1_555 A C 102 O2 ? ? C G 88 C C 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog141 hydrog ? ? A G 89 O6 ? ? ? 1_555 A C 102 N4 ? ? C G 88 C C 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog142 hydrog ? ? A G 90 N1 ? ? ? 1_555 A C 101 N3 ? ? C G 89 C C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog143 hydrog ? ? A G 90 N2 ? ? ? 1_555 A C 101 O2 ? ? C G 89 C C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog144 hydrog ? ? A G 90 O6 ? ? ? 1_555 A C 101 N4 ? ? C G 89 C C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog145 hydrog ? ? A U 91 N3 ? ? ? 1_555 A A 100 N1 ? ? C U 90 C A 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog146 hydrog ? ? A U 91 O4 ? ? ? 1_555 A A 100 N6 ? ? C U 90 C A 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog147 hydrog ? ? A A 92 N1 ? ? ? 1_555 A U 99 N3 ? ? C A 91 C U 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog148 hydrog ? ? A A 92 N6 ? ? ? 1_555 A U 99 O4 ? ? C A 91 C U 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog149 hydrog ? ? A U 93 N3 ? ? ? 1_555 A G 98 O6 ? ? C U 92 C G 97 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog150 hydrog ? ? A U 93 O2 ? ? ? 1_555 A G 98 N1 ? ? C U 92 C G 97 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog151 hydrog ? ? A C 130 N3 ? ? ? 1_555 A G 146 N1 ? ? C C 129 C G 145 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog152 hydrog ? ? A C 130 N4 ? ? ? 1_555 A G 146 O6 ? ? C C 129 C G 145 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog153 hydrog ? ? A C 130 O2 ? ? ? 1_555 A G 146 N2 ? ? C C 129 C G 145 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog154 hydrog ? ? A A 131 N1 ? ? ? 1_555 A U 145 N3 ? ? C A 130 C U 144 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog155 hydrog ? ? A A 131 N6 ? ? ? 1_555 A U 145 O4 ? ? C A 130 C U 144 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog156 hydrog ? ? A G 132 N1 ? ? ? 1_555 A C 144 N3 ? ? C G 131 C C 143 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog157 hydrog ? ? A G 132 N2 ? ? ? 1_555 A C 144 O2 ? ? C G 131 C C 143 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog158 hydrog ? ? A G 132 O6 ? ? ? 1_555 A C 144 N4 ? ? C G 131 C C 143 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog159 hydrog ? ? A G 133 N1 ? ? ? 1_555 A C 143 N3 ? ? C G 132 C C 142 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog160 hydrog ? ? A G 133 N2 ? ? ? 1_555 A C 143 O2 ? ? C G 132 C C 142 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog161 hydrog ? ? A G 133 O6 ? ? ? 1_555 A C 143 N4 ? ? C G 132 C C 142 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog162 hydrog ? ? A G 134 N1 ? ? ? 1_555 A C 142 N3 ? ? C G 133 C C 141 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog163 hydrog ? ? A G 134 N2 ? ? ? 1_555 A C 142 O2 ? ? C G 133 C C 141 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog164 hydrog ? ? A G 134 O6 ? ? ? 1_555 A C 142 N4 ? ? C G 133 C C 141 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog165 hydrog ? ? A U 135 N3 ? ? ? 1_555 A A 139 N7 ? ? C U 134 C A 138 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog166 hydrog ? ? A U 135 O2 ? ? ? 1_555 A A 139 N6 ? ? C U 134 C A 138 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 8S95 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.006666 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000941 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.035695 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.009077 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source C ? ? 3.54356 2.42580 ? ? 25.62398 1.50364 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 6.96715 ? ? ? 11.43723 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 7.96527 ? ? ? 9.05267 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 9.51135 5.44231 ? ? 1.42069 35.72801 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 C 1 0 ? ? ? C . n A 1 2 G 2 1 1 G G C . n A 1 3 C 3 2 2 C C C . n A 1 4 C 4 3 3 C C C . n A 1 5 C 5 4 4 C C C . n A 1 6 G 6 5 5 G G C . n A 1 7 G 7 6 6 G G C . n A 1 8 A 8 7 7 A A C . n A 1 9 U 9 8 8 U U C . n A 1 10 A 10 9 9 A A C . n A 1 11 G 11 10 10 G G C . n A 1 12 C 12 11 11 C C C . n A 1 13 U 13 12 12 U U C . n A 1 14 C 14 13 13 C C C . n A 1 15 A 15 14 14 A A C . n A 1 16 G 16 15 15 G G C . n A 1 17 U 17 16 16 U U C . n A 1 18 C 18 17 17 C C C . n A 1 19 G 19 18 18 G G C . n A 1 20 G 20 19 19 G G C . n A 1 21 U 21 20 20 U U C . n A 1 22 A 22 21 21 A A C . n A 1 23 G 23 22 22 G G C . n A 1 24 A 24 23 23 A A C . n A 1 25 G 25 24 24 G G C . n A 1 26 C 26 25 25 C C C . n A 1 27 A 27 26 26 A A C . n A 1 28 G 28 27 27 G G C . n A 1 29 C 29 28 28 C C C . n A 1 30 G 30 29 29 G G C . n A 1 31 G 31 30 30 G G C . n A 1 32 C 32 31 31 C C C . n A 1 33 U 33 32 32 U U C . n A 1 34 A 34 33 33 A A C . n A 1 35 A 35 34 34 A A C . n A 1 36 A 36 35 35 A A C . n A 1 37 A 37 36 36 A A C . n A 1 38 C 38 37 37 C C C . n A 1 39 A 39 38 38 A A C . n A 1 40 G 40 39 39 G G C . n A 1 41 C 41 40 40 C C C . n A 1 42 U 42 41 41 U U C . n A 1 43 C 43 42 42 C C C . n A 1 44 U 44 43 43 U U C . n A 1 45 G 45 44 44 G G C . n A 1 46 G 46 45 45 G G C . n A 1 47 G 47 46 46 G G C . n A 1 48 G 48 47 ? ? ? C . n A 1 49 U 49 48 ? ? ? C . n A 1 50 U 50 49 ? ? ? C . n A 1 51 G 51 50 ? ? ? C . n A 1 52 U 52 51 ? ? ? C . n A 1 53 A 53 52 ? ? ? C . n A 1 54 C 54 53 ? ? ? C . n A 1 55 C 55 54 ? ? ? C . n A 1 56 C 56 55 ? ? ? C . n A 1 57 A 57 56 56 A A C . n A 1 58 C 58 57 57 C C C . n A 1 59 C 59 58 58 C C C . n A 1 60 C 60 59 59 C C C . n A 1 61 C 61 60 60 C C C . n A 1 62 A 62 61 61 A A C . n A 1 63 G 63 62 62 G G C . n A 1 64 A 64 63 63 A A C . n A 1 65 G 65 64 64 G G C . n A 1 66 G 66 65 65 G G C . n A 1 67 C 67 66 66 C C C . n A 1 68 C 68 67 67 C C C . n A 1 69 C 69 68 68 C C C . n A 1 70 A 70 69 69 A A C . n A 1 71 C 71 70 70 C C C . n A 1 72 G 72 71 71 G G C . n A 1 73 U 73 72 72 U U C . n A 1 74 G 74 73 73 G G C . n A 1 75 G 75 74 74 G G C . n A 1 76 C 76 75 75 C C C . n A 1 77 G 77 76 76 G G C . n A 1 78 G 78 77 77 G G C . n A 1 79 C 79 78 78 C C C . n A 1 80 U 80 79 79 U U C . n A 1 81 A 81 80 80 A A C . n A 1 82 G 82 81 81 G G C . n A 1 83 U 83 82 82 U U C . n A 1 84 A 84 83 83 A A C . n A 1 85 C 85 84 84 C C C . n A 1 86 U 86 85 85 U U C . n A 1 87 C 87 86 86 C C C . n A 1 88 C 88 87 87 C C C . n A 1 89 G 89 88 88 G G C . n A 1 90 G 90 89 89 G G C . n A 1 91 U 91 90 90 U U C . n A 1 92 A 92 91 91 A A C . n A 1 93 U 93 92 92 U U C . n A 1 94 U 94 93 93 U U C . n A 1 95 G 95 94 94 G G C . n A 1 96 C 96 95 95 C C C . n A 1 97 G 97 96 96 G G C . n A 1 98 G 98 97 97 G G C . n A 1 99 U 99 98 98 U U C . n A 1 100 A 100 99 99 A A C . n A 1 101 C 101 100 100 C C C . n A 1 102 C 102 101 101 C C C . n A 1 103 C 103 102 102 C C C . n A 1 104 U 104 103 103 U U C . n A 1 105 U 105 104 104 U U C . n A 1 106 G 106 105 105 G G C . n A 1 107 U 107 106 106 U U C . n A 1 108 A 108 107 107 A A C . n A 1 109 C 109 108 108 C C C . n A 1 110 G 110 109 109 G G C . n A 1 111 C 111 110 110 C C C . n A 1 112 C 112 111 111 C C C . n A 1 113 U 113 112 112 U U C . n A 1 114 G 114 113 113 G G C . n A 1 115 U 115 114 114 U U C . n A 1 116 U 116 115 115 U U C . n A 1 117 U 117 116 116 U U C . n A 1 118 U 118 117 117 U U C . n A 1 119 A 119 118 118 A A C . n A 1 120 G 120 119 119 G G C . n A 1 121 C 121 120 120 C C C . n A 1 122 C 122 121 121 C C C . n A 1 123 G 123 122 122 G G C . n A 1 124 C 124 123 123 C C C . n A 1 125 G 125 124 124 G G C . n A 1 126 G 126 125 125 G G C . n A 1 127 G 127 126 126 G G C . n A 1 128 U 128 127 127 U U C . n A 1 129 C 129 128 128 C C C . n A 1 130 C 130 129 129 C C C . n A 1 131 A 131 130 130 A A C . n A 1 132 G 132 131 131 G G C . n A 1 133 G 133 132 132 G G C . n A 1 134 G 134 133 133 G G C . n A 1 135 U 135 134 134 U U C . n A 1 136 U 136 135 135 U U C . n A 1 137 C 137 136 136 C C C . n A 1 138 A 138 137 137 A A C . n A 1 139 A 139 138 138 A A C . n A 1 140 G 140 139 139 G G C . n A 1 141 U 141 140 140 U U C . n A 1 142 C 142 141 141 C C C . n A 1 143 C 143 142 142 C C C . n A 1 144 C 144 143 143 C C C . n A 1 145 U 145 144 144 U U C . n A 1 146 G 146 145 145 G G C . n A 1 147 U 147 146 146 U U C . n A 1 148 U 148 147 147 U U C . n A 1 149 C 149 148 148 C C C . n A 1 150 G 150 149 149 G G C . n A 1 151 G 151 150 150 G G C . n A 1 152 G 152 151 151 G G C . n A 1 153 C 153 152 152 C C C . n A 1 154 G 154 153 153 G G C . n A 1 155 C 155 154 154 C C C . n A 1 156 C 156 155 155 C C C . n A 1 157 A 157 156 ? ? ? C . n # _pdbx_contact_author.id 3 _pdbx_contact_author.email kaychoi@iu.edu _pdbx_contact_author.name_first Kyung _pdbx_contact_author.name_last Choi _pdbx_contact_author.name_mi H _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0003-0865-1265 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-08-09 2 'Structure model' 1 1 2023-09-20 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' chem_comp_atom 2 2 'Structure model' chem_comp_bond 3 2 'Structure model' citation 4 2 'Structure model' citation_author # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' 4 2 'Structure model' '_citation_author.identifier_ORCID' # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 -x,y,-z 3 x+1/2,y+1/2,z 4 -x+1/2,y+1/2,-z # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.19_4092 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # loop_ _pdbx_unobs_or_zero_occ_residues.id _pdbx_unobs_or_zero_occ_residues.PDB_model_num _pdbx_unobs_or_zero_occ_residues.polymer_flag _pdbx_unobs_or_zero_occ_residues.occupancy_flag _pdbx_unobs_or_zero_occ_residues.auth_asym_id _pdbx_unobs_or_zero_occ_residues.auth_comp_id _pdbx_unobs_or_zero_occ_residues.auth_seq_id _pdbx_unobs_or_zero_occ_residues.PDB_ins_code _pdbx_unobs_or_zero_occ_residues.label_asym_id _pdbx_unobs_or_zero_occ_residues.label_comp_id _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 1 Y 1 C C 0 ? A C 1 2 1 Y 1 C G 47 ? A G 48 3 1 Y 1 C U 48 ? A U 49 4 1 Y 1 C U 49 ? A U 50 5 1 Y 1 C G 50 ? A G 51 6 1 Y 1 C U 51 ? A U 52 7 1 Y 1 C A 52 ? A A 53 8 1 Y 1 C C 53 ? A C 54 9 1 Y 1 C C 54 ? A C 55 10 1 Y 1 C C 55 ? A C 56 11 1 Y 1 C A 156 ? A A 157 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8S95 'double helix' 8S95 'a-form double helix' 8S95 'parallel strands' 8S95 'hairpin loop' 8S95 'bulge loop' 8S95 'mismatched base pair' 8S95 'internal loop' 8S95 'triple helix' 8S95 'four-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 A C 153 1_555 0.141 -0.075 0.470 4.644 -7.325 -7.676 1 C_G1:C152_C C 1 ? C 152 ? 19 1 1 A C 3 1_555 A G 152 1_555 0.423 -0.398 -0.005 6.926 -7.413 -8.047 2 C_C2:G151_C C 2 ? C 151 ? 19 1 1 A C 4 1_555 A G 151 1_555 -0.370 0.048 -1.164 18.514 -9.579 -14.887 3 C_C3:G150_C C 3 ? C 150 ? 19 1 1 A C 5 1_555 A G 150 1_555 -0.470 -0.284 -0.457 7.732 -13.295 0.443 4 C_C4:G149_C C 4 ? C 149 ? 19 1 1 A G 6 1_555 A C 149 1_555 0.090 -0.231 0.505 0.493 -9.761 1.792 5 C_G5:C148_C C 5 ? C 148 ? 19 1 1 A G 7 1_555 A U 148 1_555 -1.426 -0.519 0.489 2.060 -16.416 -9.540 6 C_G6:U147_C C 6 ? C 147 ? 28 1 1 A A 8 1_555 A U 147 1_555 -0.038 0.218 0.115 10.017 -20.722 0.780 7 C_A7:U146_C C 7 ? C 146 ? 20 1 1 A C 130 1_555 A G 146 1_555 -0.692 -0.116 -0.404 13.507 -10.762 -6.405 8 C_C129:G145_C C 129 ? C 145 ? 19 1 1 A A 131 1_555 A U 145 1_555 -0.096 0.120 -0.383 -15.174 -11.355 -1.843 9 C_A130:U144_C C 130 ? C 144 ? 20 1 1 A G 132 1_555 A C 144 1_555 -0.044 -0.442 0.036 -0.221 0.149 -6.618 10 C_G131:C143_C C 131 ? C 143 ? 19 1 1 A G 133 1_555 A C 143 1_555 -0.094 -0.534 -0.577 -4.335 -9.585 -2.268 11 C_G132:C142_C C 132 ? C 142 ? 19 1 1 A G 134 1_555 A C 142 1_555 -0.214 0.410 -0.746 -22.648 -7.731 6.770 12 C_G133:C141_C C 133 ? C 141 ? 19 1 1 A U 135 1_555 A A 139 1_555 4.098 -1.447 0.436 8.457 16.454 -108.679 13 C_U134:A138_C C 134 ? C 138 ? 24 4 1 A U 136 1_555 A G 19 1_555 1.029 -4.802 0.232 25.237 10.082 -97.941 14 C_U135:G18_C C 135 ? C 18 ? ? 2 1 A G 98 1_555 A U 93 1_555 -1.491 -0.571 -1.085 3.657 -27.904 27.245 15 C_G97:U92_C C 97 ? C 92 ? 28 1 1 A U 99 1_555 A A 92 1_555 -1.156 -0.269 -0.973 -10.541 4.409 9.860 16 C_U98:A91_C C 98 ? C 91 ? 20 1 1 A A 100 1_555 A U 91 1_555 0.921 0.208 0.179 -1.368 -14.214 1.062 17 C_A99:U90_C C 99 ? C 90 ? 20 1 1 A C 101 1_555 A G 90 1_555 0.537 -0.025 0.447 -2.417 -12.637 4.024 18 C_C100:G89_C C 100 ? C 89 ? 19 1 1 A C 102 1_555 A G 89 1_555 0.499 0.222 -0.516 6.889 -25.938 4.477 19 C_C101:G88_C C 101 ? C 88 ? 19 1 1 A U 104 1_555 A C 87 1_555 -0.049 -1.782 -0.845 2.843 -23.612 9.575 20 C_U103:C86_C C 103 ? C 86 ? 18 1 1 A U 105 1_555 A U 86 1_555 -0.862 -1.151 0.453 -10.416 -18.706 21.059 21 C_U104:U85_C C 104 ? C 85 ? ? ? 1 A G 106 1_555 A C 85 1_555 -0.172 -0.069 0.006 -11.988 2.071 -0.328 22 C_G105:C84_C C 105 ? C 84 ? 19 1 1 A U 107 1_555 A A 84 1_555 0.295 0.298 -0.471 -1.071 3.499 0.108 23 C_U106:A83_C C 106 ? C 83 ? 20 1 1 A A 108 1_555 A U 83 1_555 0.292 0.152 0.166 1.922 9.615 4.318 24 C_A107:U82_C C 107 ? C 82 ? 20 1 1 A C 109 1_555 A G 82 1_555 0.152 0.065 -0.635 11.347 -3.035 1.738 25 C_C108:G81_C C 108 ? C 81 ? 19 1 1 A G 110 1_555 A C 79 1_555 0.354 0.262 -0.263 16.845 9.791 -5.173 26 C_G109:C78_C C 109 ? C 78 ? 19 1 1 A C 111 1_555 A G 78 1_555 -0.048 0.380 -0.990 17.314 -12.270 -6.391 27 C_C110:G77_C C 110 ? C 77 ? 19 1 1 A C 112 1_555 A G 40 1_555 0.077 0.327 0.511 7.817 -19.225 -4.875 28 C_C111:G39_C C 111 ? C 39 ? 19 1 1 A U 113 1_555 A A 39 1_555 0.431 -0.100 0.589 2.826 -25.785 0.100 29 C_U112:A38_C C 112 ? C 38 ? 20 1 1 A G 114 1_555 A C 38 1_555 0.473 -0.009 0.418 9.533 -1.948 -2.372 30 C_G113:C37_C C 113 ? C 37 ? 19 1 1 A U 115 1_555 A A 37 1_555 0.399 -0.168 -1.047 6.399 -13.249 -1.886 31 C_U114:A36_C C 114 ? C 36 ? 20 1 1 A U 116 1_555 A A 36 1_555 0.115 0.359 -0.196 -3.842 -10.355 13.662 32 C_U115:A35_C C 115 ? C 35 ? 20 1 1 A U 117 1_555 A A 35 1_555 -0.059 -0.120 -0.518 -1.447 -8.009 -1.450 33 C_U116:A34_C C 116 ? C 34 ? 20 1 1 A U 118 1_555 A A 34 1_555 0.064 -0.020 -0.496 -1.606 -3.756 -4.472 34 C_U117:A33_C C 117 ? C 33 ? 20 1 1 A A 119 1_555 A U 33 1_555 0.796 0.076 -0.450 -15.681 -10.328 -2.225 35 C_A118:U32_C C 118 ? C 32 ? 20 1 1 A G 120 1_555 A C 32 1_555 -0.102 -0.130 -0.102 -1.756 -2.632 -5.595 36 C_G119:C31_C C 119 ? C 31 ? 19 1 1 A C 121 1_555 A G 31 1_555 1.194 -0.492 -0.195 13.376 -13.577 -8.873 37 C_C120:G30_C C 120 ? C 30 ? 19 1 1 A C 122 1_555 A G 30 1_555 0.344 -0.259 -0.542 -0.574 -12.922 -11.929 38 C_C121:G29_C C 121 ? C 29 ? 19 1 1 A G 123 1_555 A C 29 1_555 0.258 -0.155 -0.338 -10.084 -24.939 2.483 39 C_G122:C28_C C 122 ? C 28 ? 19 1 1 A C 124 1_555 A G 28 1_555 0.011 -0.355 -0.118 -0.416 -19.380 3.765 40 C_C123:G27_C C 123 ? C 27 ? 19 1 1 A G 125 1_555 A A 27 1_555 -0.839 2.220 0.058 -27.210 -19.997 -33.616 41 C_G124:A26_C C 124 ? C 26 ? 8 1 1 A G 11 1_555 A C 26 1_555 0.105 -0.295 -0.295 -4.986 -13.634 -12.546 42 C_G10:C25_C C 10 ? C 25 ? 19 1 1 A C 12 1_555 A G 25 1_555 0.504 -0.036 0.200 -10.469 -7.171 2.115 43 C_C11:G24_C C 11 ? C 24 ? 19 1 1 A U 13 1_555 A A 24 1_555 -0.002 0.380 0.072 -13.786 -6.487 -0.305 44 C_U12:A23_C C 12 ? C 23 ? 20 1 1 A C 14 1_555 A G 23 1_555 -0.297 -0.254 0.251 -2.812 -11.321 -4.229 45 C_C13:G22_C C 13 ? C 22 ? 19 1 1 A A 15 1_555 A U 9 1_555 -3.724 -1.595 -0.099 1.885 4.554 -98.641 46 C_A14:U8_C C 14 ? C 8 ? 24 4 1 A G 16 1_555 A C 129 1_555 -0.123 3.599 0.389 10.892 12.522 167.505 47 C_G15:C128_C C 15 ? C 128 ? 22 2 1 A G 20 1_555 A C 137 1_555 -0.659 -0.068 0.312 -13.715 -22.192 2.941 48 C_G19:C136_C C 19 ? C 136 ? 19 1 1 A C 59 1_555 A G 47 1_555 1.292 -0.524 -0.471 25.465 -34.940 -12.097 49 C_C58:G46_C C 58 ? C 46 ? 19 1 1 A C 60 1_555 A G 46 1_555 -0.727 -0.361 -0.922 17.943 -6.065 -11.081 50 C_C59:G45_C C 59 ? C 45 ? 19 1 1 A C 61 1_555 A G 45 1_555 0.263 -0.555 -0.541 13.138 -9.352 -3.621 51 C_C60:G44_C C 60 ? C 44 ? 19 1 1 A A 62 1_555 A U 44 1_555 0.248 0.085 -1.133 -13.075 5.631 3.040 52 C_A61:U43_C C 61 ? C 43 ? 20 1 1 A G 63 1_555 A C 43 1_555 -0.125 0.239 -0.907 -12.397 4.386 2.192 53 C_G62:C42_C C 62 ? C 42 ? 19 1 1 A A 64 1_555 A U 42 1_555 0.826 0.585 -0.996 -6.648 6.546 -4.565 54 C_A63:U41_C C 63 ? C 41 ? 20 1 1 A G 65 1_555 A C 41 1_555 0.001 0.172 -0.758 -12.229 0.489 2.167 55 C_G64:C40_C C 64 ? C 40 ? 19 1 1 A G 66 1_555 A C 76 1_555 0.649 -0.073 -0.218 -14.402 -11.584 -4.681 56 C_G65:C75_C C 65 ? C 75 ? 19 1 1 A C 67 1_555 A G 75 1_555 0.210 0.634 -0.173 -3.213 0.169 20.634 57 C_C66:G74_C C 66 ? C 74 ? ? 1 1 A C 68 1_555 A G 74 1_555 0.206 -0.383 -0.893 4.903 -3.089 -17.759 58 C_C67:G73_C C 67 ? C 73 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 A C 153 1_555 A C 3 1_555 A G 152 1_555 0.086 -2.131 3.477 3.512 -6.130 39.107 -2.342 0.329 3.749 -9.068 -5.195 39.716 1 CC_G1C2:G151C152_CC C 1 ? C 152 ? C 2 ? C 151 ? 1 A C 3 1_555 A G 152 1_555 A C 4 1_555 A G 151 1_555 -0.837 -1.981 2.916 3.966 2.669 21.161 -6.145 3.529 2.454 7.152 -10.626 21.688 2 CC_C2C3:G150G151_CC C 2 ? C 151 ? C 3 ? C 150 ? 1 A C 4 1_555 A G 151 1_555 A C 5 1_555 A G 150 1_555 0.506 -1.648 3.592 -2.921 18.741 33.799 -4.741 -1.116 2.344 29.527 4.602 38.621 3 CC_C3C4:G149G150_CC C 3 ? C 150 ? C 4 ? C 149 ? 1 A C 5 1_555 A G 150 1_555 A G 6 1_555 A C 149 1_555 -0.511 -2.090 3.516 -6.911 6.466 26.102 -5.953 -0.637 2.959 13.755 14.700 27.737 4 CC_C4G5:C148G149_CC C 4 ? C 149 ? C 5 ? C 148 ? 1 A G 6 1_555 A C 149 1_555 A G 7 1_555 A U 148 1_555 -0.828 -1.658 2.954 -1.133 1.657 29.801 -3.524 1.397 2.889 3.218 2.200 29.867 5 CC_G5G6:U147C148_CC C 5 ? C 148 ? C 6 ? C 147 ? 1 A G 7 1_555 A U 148 1_555 A A 8 1_555 A U 147 1_555 0.064 -0.873 3.118 3.604 6.319 39.814 -1.924 0.285 2.946 9.186 -5.240 40.447 6 CC_G6A7:U146U147_CC C 6 ? C 147 ? C 7 ? C 146 ? 1 A A 8 1_555 A U 147 1_555 A C 130 1_555 A G 146 1_555 -0.340 -1.419 3.186 0.997 2.387 34.569 -2.732 0.718 3.074 4.010 -1.675 34.662 7 CC_A7C129:G145U146_CC C 7 ? C 146 ? C 129 ? C 145 ? 1 A C 130 1_555 A G 146 1_555 A A 131 1_555 A U 145 1_555 0.447 -1.903 3.884 0.317 15.200 36.890 -4.703 -0.617 2.913 22.866 -0.477 39.799 8 CC_C129A130:U144G145_CC C 129 ? C 145 ? C 130 ? C 144 ? 1 A A 131 1_555 A U 145 1_555 A G 132 1_555 A C 144 1_555 -0.816 -1.767 2.790 -4.904 6.209 28.793 -4.490 0.748 2.466 12.198 9.635 29.838 9 CC_A130G131:C143U144_CC C 130 ? C 144 ? C 131 ? C 143 ? 1 A G 132 1_555 A C 144 1_555 A G 133 1_555 A C 143 1_555 0.765 -1.644 3.449 3.940 5.267 30.843 -4.036 -0.654 3.202 9.763 -7.304 31.519 10 CC_G131G132:C142C143_CC C 131 ? C 143 ? C 132 ? C 142 ? 1 A G 133 1_555 A C 143 1_555 A G 134 1_555 A C 142 1_555 0.822 -2.176 3.748 -1.312 9.207 36.794 -4.603 -1.444 3.104 14.307 2.040 37.912 11 CC_G132G133:C141C142_CC C 132 ? C 142 ? C 133 ? C 141 ? 1 A G 134 1_555 A C 142 1_555 A U 135 1_555 A A 139 1_555 -3.026 -1.943 2.775 -0.334 4.546 84.725 -1.529 2.237 2.697 3.371 0.247 84.824 12 CC_G133U134:A138C141_CC C 133 ? C 141 ? C 134 ? C 138 ? 1 A U 135 1_555 A A 139 1_555 A U 136 1_555 A G 19 1_555 1.872 -1.835 3.567 2.691 1.352 35.661 -3.201 -2.620 3.624 2.202 -4.385 35.784 13 CC_U134U135:G18A138_CC C 134 ? C 138 ? C 135 ? C 18 ? 1 A G 98 1_555 A U 93 1_555 A U 99 1_555 A A 92 1_555 -1.087 -0.897 4.187 -14.224 3.118 38.848 -1.713 -0.490 4.235 4.500 20.529 41.389 14 CC_G97U98:A91U92_CC C 97 ? C 92 ? C 98 ? C 91 ? 1 A U 99 1_555 A A 92 1_555 A A 100 1_555 A U 91 1_555 -1.351 -1.133 3.368 -6.062 10.061 28.009 -4.226 1.341 3.012 19.726 11.885 30.327 15 CC_U98A99:U90A91_CC C 98 ? C 91 ? C 99 ? C 90 ? 1 A A 100 1_555 A U 91 1_555 A C 101 1_555 A G 90 1_555 0.422 -1.520 3.006 0.706 5.475 36.365 -3.072 -0.584 2.763 8.711 -1.123 36.767 16 CC_A99C100:G89U90_CC C 99 ? C 90 ? C 100 ? C 89 ? 1 A C 101 1_555 A G 90 1_555 A C 102 1_555 A G 89 1_555 -0.691 -1.535 2.770 5.257 11.986 23.656 -5.485 2.445 1.628 26.773 -11.742 26.990 17 CC_C100C101:G88G89_CC C 100 ? C 89 ? C 101 ? C 88 ? 1 A C 102 1_555 A G 89 1_555 A U 104 1_555 A C 87 1_555 -0.332 -2.082 7.156 -2.735 21.530 54.098 -4.553 0.037 6.014 22.675 2.881 57.983 18 CC_C101U103:C86G88_CC C 101 ? C 88 ? C 103 ? C 86 ? 1 A U 104 1_555 A C 87 1_555 A U 105 1_555 A U 86 1_555 0.889 -1.196 3.388 -8.807 15.906 38.198 -3.211 -2.093 2.469 22.798 12.624 42.158 19 CC_U103U104:U85C86_CC C 103 ? C 86 ? C 104 ? C 85 ? 1 A U 105 1_555 A U 86 1_555 A G 106 1_555 A C 85 1_555 -1.045 -1.792 3.275 -1.077 9.072 26.953 -5.566 1.900 2.586 18.791 2.230 28.432 20 CC_U104G105:C84U85_CC C 104 ? C 85 ? C 105 ? C 84 ? 1 A G 106 1_555 A C 85 1_555 A U 107 1_555 A A 84 1_555 -0.307 -1.538 3.145 3.368 6.951 34.625 -3.457 0.955 2.753 11.502 -5.574 35.450 21 CC_G105U106:A83C84_CC C 105 ? C 84 ? C 106 ? C 83 ? 1 A U 107 1_555 A A 84 1_555 A A 108 1_555 A U 83 1_555 0.333 -1.627 3.136 -4.929 6.967 27.779 -4.611 -1.630 2.565 14.097 9.973 29.035 22 CC_U106A107:U82A83_CC C 106 ? C 83 ? C 107 ? C 82 ? 1 A A 108 1_555 A U 83 1_555 A C 109 1_555 A G 82 1_555 0.299 -2.100 3.099 7.569 4.807 30.171 -4.695 0.739 2.733 8.989 -14.152 31.445 23 CC_A107C108:G81U82_CC C 107 ? C 82 ? C 108 ? C 81 ? 1 A C 109 1_555 A G 82 1_555 A G 110 1_555 A C 79 1_555 1.190 -2.212 3.385 -11.285 6.081 42.830 -3.443 -2.548 2.681 8.113 15.055 44.620 24 CC_C108G109:C78G81_CC C 108 ? C 81 ? C 109 ? C 78 ? 1 A G 110 1_555 A C 79 1_555 A C 111 1_555 A G 78 1_555 0.662 -2.345 3.255 2.579 2.894 33.374 -4.519 -0.736 3.087 5.018 -4.472 33.592 25 CC_G109C110:G77C78_CC C 109 ? C 78 ? C 110 ? C 77 ? 1 A C 111 1_555 A G 78 1_555 A C 112 1_555 A G 40 1_555 0.739 -2.870 3.219 -12.469 18.815 40.928 -4.875 -1.758 1.550 24.772 16.416 46.504 26 CC_C110C111:G39G77_CC C 110 ? C 77 ? C 111 ? C 39 ? 1 A C 112 1_555 A G 40 1_555 A U 113 1_555 A A 39 1_555 -0.020 -0.586 3.873 -1.486 -0.904 36.909 -0.781 -0.206 3.884 -1.427 2.346 36.948 27 CC_C111U112:A38G39_CC C 111 ? C 39 ? C 112 ? C 38 ? 1 A U 113 1_555 A A 39 1_555 A G 114 1_555 A C 38 1_555 -0.242 -1.561 3.055 -5.225 5.177 27.066 -4.321 -0.608 2.713 10.810 10.910 28.029 28 CC_U112G113:C37A38_CC C 112 ? C 38 ? C 113 ? C 37 ? 1 A G 114 1_555 A C 38 1_555 A U 115 1_555 A A 37 1_555 0.061 -1.375 3.415 10.733 8.247 35.545 -3.172 1.284 2.932 12.945 -16.846 37.957 29 CC_G113U114:A36C37_CC C 113 ? C 37 ? C 114 ? C 36 ? 1 A U 115 1_555 A A 37 1_555 A U 116 1_555 A A 36 1_555 1.422 -1.297 3.852 -0.229 11.365 30.432 -4.537 -2.590 3.166 20.762 0.418 32.439 30 CC_U114U115:A35A36_CC C 114 ? C 36 ? C 115 ? C 35 ? 1 A U 116 1_555 A A 36 1_555 A U 117 1_555 A A 35 1_555 -0.779 -1.447 3.133 4.423 10.051 29.043 -4.392 2.199 2.371 19.197 -8.448 31.008 31 CC_U115U116:A34A35_CC C 115 ? C 35 ? C 116 ? C 34 ? 1 A U 117 1_555 A A 35 1_555 A U 118 1_555 A A 34 1_555 0.018 -1.163 3.400 1.674 8.656 28.234 -4.098 0.316 2.919 17.221 -3.331 29.551 32 CC_U116U117:A33A34_CC C 116 ? C 34 ? C 117 ? C 33 ? 1 A U 118 1_555 A A 34 1_555 A A 119 1_555 A U 33 1_555 0.541 -1.098 3.729 0.501 16.365 36.105 -3.696 -0.736 2.984 24.890 -0.762 39.531 33 CC_U117A118:U32A33_CC C 117 ? C 33 ? C 118 ? C 32 ? 1 A A 119 1_555 A U 33 1_555 A G 120 1_555 A C 32 1_555 -0.528 -1.431 2.894 -1.285 7.167 26.325 -4.518 0.852 2.448 15.365 2.755 27.296 34 CC_A118G119:C31U32_CC C 118 ? C 32 ? C 119 ? C 31 ? 1 A G 120 1_555 A C 32 1_555 A C 121 1_555 A G 31 1_555 0.145 -0.943 2.837 1.302 9.864 40.301 -2.212 -0.088 2.550 14.059 -1.856 41.461 35 CC_G119C120:G30C31_CC C 119 ? C 31 ? C 120 ? C 30 ? 1 A C 121 1_555 A G 31 1_555 A C 122 1_555 A G 30 1_555 -0.861 -2.211 3.482 2.103 8.688 27.265 -6.335 2.191 2.596 17.833 -4.316 28.666 36 CC_C120C121:G29G30_CC C 120 ? C 30 ? C 121 ? C 29 ? 1 A C 122 1_555 A G 30 1_555 A G 123 1_555 A C 29 1_555 0.824 -0.726 3.616 3.112 18.832 28.158 -4.455 -0.883 2.696 34.186 -5.649 33.909 37 CC_C121G122:C28G29_CC C 121 ? C 29 ? C 122 ? C 28 ? 1 A G 123 1_555 A C 29 1_555 A C 124 1_555 A G 28 1_555 -1.374 -1.484 2.867 -8.762 2.031 28.319 -3.292 0.977 3.036 4.025 17.364 29.685 38 CC_G122C123:G27C28_CC C 122 ? C 28 ? C 123 ? C 27 ? 1 A C 124 1_555 A G 28 1_555 A G 125 1_555 A A 27 1_555 -1.854 -2.475 3.815 1.320 10.059 30.514 -6.346 3.597 2.798 18.483 -2.425 32.118 39 CC_C123G124:A26G27_CC C 123 ? C 27 ? C 124 ? C 26 ? 1 A G 125 1_555 A A 27 1_555 A G 11 1_555 A C 26 1_555 -3.376 -2.697 3.441 16.529 9.124 64.757 -2.755 3.627 2.265 8.336 -15.101 67.165 40 CC_G124G10:C25A26_CC C 124 ? C 26 ? C 10 ? C 25 ? 1 A G 11 1_555 A C 26 1_555 A C 12 1_555 A G 25 1_555 -0.108 -2.036 3.429 -3.249 -1.781 32.531 -3.285 -0.405 3.526 -3.167 5.777 32.736 41 CC_G10C11:G24C25_CC C 10 ? C 25 ? C 11 ? C 24 ? 1 A C 12 1_555 A G 25 1_555 A U 13 1_555 A A 24 1_555 -0.154 -1.179 3.182 4.671 20.255 36.725 -3.513 0.645 2.230 29.437 -6.788 42.022 42 CC_C11U12:A23G24_CC C 11 ? C 24 ? C 12 ? C 23 ? 1 A U 13 1_555 A A 24 1_555 A C 14 1_555 A G 23 1_555 1.237 -2.269 3.240 3.688 -3.701 17.447 -4.877 -1.624 3.812 -11.860 -11.819 18.207 43 CC_U12C13:G22A23_CC C 12 ? C 23 ? C 13 ? C 22 ? 1 A C 14 1_555 A G 23 1_555 A A 15 1_555 A U 9 1_555 -1.092 -0.402 3.341 2.173 0.495 69.234 -0.372 1.041 3.307 0.435 -1.912 69.265 44 CC_C13A14:U8G22_CC C 13 ? C 22 ? C 14 ? C 8 ? 1 A A 15 1_555 A U 9 1_555 A G 16 1_555 A C 129 1_555 1.835 -2.906 2.761 -3.587 4.205 -68.260 2.445 1.514 2.996 -3.741 -3.191 -68.457 45 CC_A14G15:C128U8_CC C 14 ? C 8 ? C 15 ? C 128 ? 1 A C 59 1_555 A G 47 1_555 A C 60 1_555 A G 46 1_555 0.382 -2.536 4.059 -3.242 21.284 30.103 -6.913 -1.046 1.871 35.795 5.453 36.864 46 CC_C58C59:G45G46_CC C 58 ? C 46 ? C 59 ? C 45 ? 1 A C 60 1_555 A G 46 1_555 A C 61 1_555 A G 45 1_555 0.101 -2.074 3.851 -3.388 7.270 32.906 -4.864 -0.780 3.304 12.602 5.873 33.843 47 CC_C59C60:G44G45_CC C 59 ? C 45 ? C 60 ? C 44 ? 1 A C 61 1_555 A G 45 1_555 A A 62 1_555 A U 44 1_555 0.841 -1.559 4.057 4.962 7.422 34.388 -3.872 -0.499 3.732 12.299 -8.222 35.495 48 CC_C60A61:U43G44_CC C 60 ? C 44 ? C 61 ? C 43 ? 1 A A 62 1_555 A U 44 1_555 A G 63 1_555 A C 43 1_555 -0.448 -1.719 3.281 0.032 6.448 28.463 -4.742 0.895 2.831 12.906 -0.064 29.170 49 CC_A61G62:C42U43_CC C 61 ? C 43 ? C 62 ? C 42 ? 1 A G 63 1_555 A C 43 1_555 A A 64 1_555 A U 42 1_555 0.336 -1.495 3.106 2.337 8.865 32.335 -3.888 -0.239 2.633 15.533 -4.095 33.576 50 CC_G62A63:U41C42_CC C 62 ? C 42 ? C 63 ? C 41 ? 1 A A 64 1_555 A U 42 1_555 A G 65 1_555 A C 41 1_555 0.871 -2.419 3.729 1.762 5.545 27.337 -6.430 -1.352 3.233 11.567 -3.675 27.937 51 CC_A63G64:C40U41_CC C 63 ? C 41 ? C 64 ? C 40 ? 1 A G 65 1_555 A C 41 1_555 A G 66 1_555 A C 76 1_555 0.624 -1.870 3.302 -0.637 7.228 36.207 -3.887 -1.069 2.877 11.489 1.013 36.903 52 CC_G64G65:C75C40_CC C 64 ? C 40 ? C 65 ? C 75 ? 1 A G 66 1_555 A C 76 1_555 A C 67 1_555 A G 75 1_555 1.273 -0.882 3.025 -0.987 9.891 32.580 -2.899 -2.315 2.615 17.140 1.710 34.023 53 CC_G65C66:G74C75_CC C 65 ? C 75 ? C 66 ? C 74 ? 1 A C 67 1_555 A G 75 1_555 A C 68 1_555 A G 74 1_555 -1.925 -1.071 2.824 5.427 13.995 34.552 -3.053 3.528 1.947 22.305 -8.649 37.581 54 CC_C66C67:G73G74_CC C 66 ? C 74 ? C 67 ? C 73 ? # _pdbx_audit_support.funding_organization 'National Institutes of Health/National Institute Of Allergy and Infectious Diseases (NIH/NIAID)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number 'R01AI 187856' _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name Other _pdbx_initial_refinement_model.accession_code ? _pdbx_initial_refinement_model.details 'CVB3 cloverleaf xray structure to be deposited along with this one' # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support SAXS _pdbx_struct_assembly_auth_evidence.details ;Plasmid was sequenced to verify correct chimeric construct in plasmid. RNAfold was used to confirm that predicted secondary structure of cloverleaf was maintained. SAXS assay was performed to confirm that the RNA folded as expected. Urea PAGE confirmed purity of isolated RNA construct. ; # _space_group.name_H-M_alt 'C 1 2 1' _space_group.name_Hall 'C 2y' _space_group.IT_number 5 _space_group.crystal_system monoclinic _space_group.id 1 #