data_8SCH # _entry.id 8SCH # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8SCH pdb_00008sch 10.2210/pdb8sch/pdb WWPDB D_1000273530 ? ? BMRB 31078 ? 10.13018/BMR31078 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-07-12 2 'Structure model' 1 1 2023-07-26 3 'Structure model' 1 2 2023-09-20 4 'Structure model' 1 3 2024-05-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 3 'Structure model' 'Data collection' 4 3 'Structure model' 'Database references' 5 4 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 2 'Structure model' pdbx_validate_planes 4 3 'Structure model' chem_comp_atom 5 3 'Structure model' chem_comp_bond 6 3 'Structure model' citation 7 3 'Structure model' citation_author 8 4 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.pdbx_database_id_DOI' 2 2 'Structure model' '_citation.pdbx_database_id_PubMed' 3 2 'Structure model' '_citation.title' 4 2 'Structure model' '_citation_author.identifier_ORCID' 5 2 'Structure model' '_pdbx_validate_planes.type' 6 3 'Structure model' '_citation.journal_volume' 7 3 'Structure model' '_citation.page_first' 8 3 'Structure model' '_citation.page_last' 9 3 'Structure model' '_citation_author.identifier_ORCID' 10 4 'Structure model' '_database_2.pdbx_DOI' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr REL _pdbx_database_status.entry_id 8SCH _pdbx_database_status.recvd_initial_deposition_date 2023-04-05 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs REL _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name BMRB _pdbx_database_related.details 'TCEI_III NMR Structure' _pdbx_database_related.db_id 31078 _pdbx_database_related.content_type unspecified # _pdbx_contact_author.id 2 _pdbx_contact_author.email hall4@niehs.nih.gov _pdbx_contact_author.name_first Traci _pdbx_contact_author.name_last Hall _pdbx_contact_author.name_mi MT _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0001-6166-3009 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Warden, M.S.' 1 0000-0002-3350-1368 'Mueller, G.A.' 2 0000-0001-8361-5323 'Hall, T.M.T.' 3 0000-0001-6166-3009 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 51 _citation.language ? _citation.page_first 8836 _citation.page_last 8849 _citation.title 'The translational repressor Glorund uses interchangeable RNA recognition domains to recognize Drosophila nanos.' _citation.year 2023 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkad586 _citation.pdbx_database_id_PubMed 37427795 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Warden, M.S.' 1 ? primary 'DeRose, E.F.' 2 ? primary 'Tamayo, J.V.' 3 ? primary 'Mueller, G.A.' 4 ? primary 'Gavis, E.R.' 5 ? primary 'Hall, T.M.T.' 6 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (68-MER)' _entity.formula_weight 21838.988 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GAGAAUCCAGCUCUGGAAGCGUUUAUAUAACAUGAAAUAUAUAUACGCAUUCCGAUCAAAGCUGGGUU _entity_poly.pdbx_seq_one_letter_code_can GAGAAUCCAGCUCUGGAAGCGUUUAUAUAACAUGAAAUAUAUAUACGCAUUCCGAUCAAAGCUGGGUU _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 A n 1 3 G n 1 4 A n 1 5 A n 1 6 U n 1 7 C n 1 8 C n 1 9 A n 1 10 G n 1 11 C n 1 12 U n 1 13 C n 1 14 U n 1 15 G n 1 16 G n 1 17 A n 1 18 A n 1 19 G n 1 20 C n 1 21 G n 1 22 U n 1 23 U n 1 24 U n 1 25 A n 1 26 U n 1 27 A n 1 28 U n 1 29 A n 1 30 A n 1 31 C n 1 32 A n 1 33 U n 1 34 G n 1 35 A n 1 36 A n 1 37 A n 1 38 U n 1 39 A n 1 40 U n 1 41 A n 1 42 U n 1 43 A n 1 44 U n 1 45 A n 1 46 C n 1 47 G n 1 48 C n 1 49 A n 1 50 U n 1 51 U n 1 52 C n 1 53 C n 1 54 G n 1 55 A n 1 56 U n 1 57 C n 1 58 A n 1 59 A n 1 60 A n 1 61 G n 1 62 C n 1 63 U n 1 64 G n 1 65 G n 1 66 G n 1 67 U n 1 68 U n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 68 _pdbx_entity_src_syn.organism_scientific 'Drosophila melanogaster' _pdbx_entity_src_syn.organism_common_name 'fruit fly' _pdbx_entity_src_syn.ncbi_taxonomy_id 7227 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 A 2 2 2 A A A . n A 1 3 G 3 3 3 G G A . n A 1 4 A 4 4 4 A A A . n A 1 5 A 5 5 5 A A A . n A 1 6 U 6 6 6 U U A . n A 1 7 C 7 7 7 C C A . n A 1 8 C 8 8 8 C C A . n A 1 9 A 9 9 9 A A A . n A 1 10 G 10 10 10 G G A . n A 1 11 C 11 11 11 C C A . n A 1 12 U 12 12 12 U U A . n A 1 13 C 13 13 13 C C A . n A 1 14 U 14 14 14 U U A . n A 1 15 G 15 15 15 G G A . n A 1 16 G 16 16 16 G G A . n A 1 17 A 17 17 17 A A A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 C 20 20 20 C C A . n A 1 21 G 21 21 21 G G A . n A 1 22 U 22 22 22 U U A . n A 1 23 U 23 23 23 U U A . n A 1 24 U 24 24 24 U U A . n A 1 25 A 25 25 25 A A A . n A 1 26 U 26 26 26 U U A . n A 1 27 A 27 27 27 A A A . n A 1 28 U 28 28 28 U U A . n A 1 29 A 29 29 29 A A A . n A 1 30 A 30 30 30 A A A . n A 1 31 C 31 31 31 C C A . n A 1 32 A 32 32 32 A A A . n A 1 33 U 33 33 33 U U A . n A 1 34 G 34 34 34 G G A . n A 1 35 A 35 35 35 A A A . n A 1 36 A 36 36 36 A A A . n A 1 37 A 37 37 37 A A A . n A 1 38 U 38 38 38 U U A . n A 1 39 A 39 39 39 A A A . n A 1 40 U 40 40 40 U U A . n A 1 41 A 41 41 41 A A A . n A 1 42 U 42 42 42 U U A . n A 1 43 A 43 43 43 A A A . n A 1 44 U 44 44 44 U U A . n A 1 45 A 45 45 45 A A A . n A 1 46 C 46 46 46 C C A . n A 1 47 G 47 47 47 G G A . n A 1 48 C 48 48 48 C C A . n A 1 49 A 49 49 49 A A A . n A 1 50 U 50 50 50 U U A . n A 1 51 U 51 51 51 U U A . n A 1 52 C 52 52 52 C C A . n A 1 53 C 53 53 53 C C A . n A 1 54 G 54 54 54 G G A . n A 1 55 A 55 55 55 A A A . n A 1 56 U 56 56 56 U U A . n A 1 57 C 57 57 57 C C A . n A 1 58 A 58 58 58 A A A . n A 1 59 A 59 59 59 A A A . n A 1 60 A 60 60 60 A A A . n A 1 61 G 61 61 61 G G A . n A 1 62 C 62 62 62 C C A . n A 1 63 U 63 63 63 U U A . n A 1 64 G 64 64 64 G G A . n A 1 65 G 65 65 65 G G A . n A 1 66 G 66 66 66 G G A . n A 1 67 U 67 67 67 U U A . n A 1 68 U 68 68 68 U U A . n # loop_ _exptl.absorpt_coefficient_mu _exptl.absorpt_correction_T_max _exptl.absorpt_correction_T_min _exptl.absorpt_correction_type _exptl.absorpt_process_details _exptl.entry_id _exptl.crystals_number _exptl.details _exptl.method _exptl.method_details ? ? ? ? ? 8SCH ? ? 'SOLUTION NMR' ? ? ? ? ? ? 8SCH ? ? 'SOLUTION SCATTERING' ? # _struct.entry_id 8SCH _struct.title 'TCEI_III NMR Structure' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8SCH _struct_keywords.text 'RNA, nanos, Glorund, qRRM, TCEI_III, nos, translation, control element' _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8SCH _struct_ref.pdbx_db_accession 8SCH _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8SCH _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 68 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 8SCH _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 68 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 68 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 67 N3 ? ? A A 5 A U 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 67 O4 ? ? A A 5 A U 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A U 6 N3 ? ? ? 1_555 A G 66 O6 ? ? A U 6 A G 66 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog4 hydrog ? ? A U 6 O2 ? ? ? 1_555 A G 66 N1 ? ? A U 6 A G 66 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog5 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 65 N1 ? ? A C 7 A G 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 65 O6 ? ? A C 7 A G 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 65 N2 ? ? A C 7 A G 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 64 N1 ? ? A C 8 A G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 64 O6 ? ? A C 8 A G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 64 N2 ? ? A C 8 A G 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 9 N1 ? ? ? 1_555 A U 63 N3 ? ? A A 9 A U 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 9 N6 ? ? ? 1_555 A U 63 O4 ? ? A A 9 A U 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 62 N3 ? ? A G 10 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 62 O2 ? ? A G 10 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 62 N4 ? ? A G 10 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 61 N1 ? ? A C 11 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 61 O6 ? ? A C 11 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 61 N2 ? ? A C 11 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 12 N3 ? ? ? 1_555 A A 60 N1 ? ? A U 12 A A 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A U 12 O4 ? ? ? 1_555 A A 60 N6 ? ? A U 12 A A 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 15 N1 ? ? ? 1_555 A C 53 N3 ? ? A G 15 A C 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 15 N2 ? ? ? 1_555 A C 53 O2 ? ? A G 15 A C 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 15 O6 ? ? ? 1_555 A C 53 N4 ? ? A G 15 A C 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 16 N1 ? ? ? 1_555 A C 52 N3 ? ? A G 16 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 16 N2 ? ? ? 1_555 A C 52 O2 ? ? A G 16 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 16 O6 ? ? ? 1_555 A C 52 N4 ? ? A G 16 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 17 N1 ? ? ? 1_555 A U 51 N3 ? ? A A 17 A U 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A A 17 N6 ? ? ? 1_555 A U 51 O4 ? ? A A 17 A U 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 19 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 19 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 19 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 20 N3 ? ? ? 1_555 A G 47 N1 ? ? A C 20 A G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 20 N4 ? ? ? 1_555 A G 47 O6 ? ? A C 20 A G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 20 O2 ? ? ? 1_555 A G 47 N2 ? ? A C 20 A G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 21 N1 ? ? ? 1_555 A C 46 N3 ? ? A G 21 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 21 N2 ? ? ? 1_555 A C 46 O2 ? ? A G 21 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 21 O6 ? ? ? 1_555 A C 46 N4 ? ? A G 21 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 45 N1 ? ? A U 22 A A 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 45 N6 ? ? A U 22 A A 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A U 23 N3 ? ? ? 1_555 A U 44 O2 ? ? A U 23 A U 44 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog41 hydrog ? ? A U 23 O4 ? ? ? 1_555 A U 44 N3 ? ? A U 23 A U 44 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog42 hydrog ? ? A U 24 N3 ? ? ? 1_555 A A 43 N1 ? ? A U 24 A A 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A U 24 O4 ? ? ? 1_555 A A 43 N6 ? ? A U 24 A A 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A A 25 N1 ? ? ? 1_555 A U 42 N3 ? ? A A 25 A U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A A 25 N6 ? ? ? 1_555 A U 42 O4 ? ? A A 25 A U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A U 26 N3 ? ? ? 1_555 A A 41 N1 ? ? A U 26 A A 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A U 26 O4 ? ? ? 1_555 A A 41 N6 ? ? A U 26 A A 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A A 27 N1 ? ? ? 1_555 A U 40 N3 ? ? A A 27 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A A 27 N6 ? ? ? 1_555 A U 40 O4 ? ? A A 27 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A U 28 N3 ? ? ? 1_555 A A 39 N1 ? ? A U 28 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A U 28 O4 ? ? ? 1_555 A A 39 N6 ? ? A U 28 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A A 29 N1 ? ? ? 1_555 A U 38 N3 ? ? A A 29 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A A 29 N6 ? ? ? 1_555 A U 38 O4 ? ? A A 29 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A A 59 N1 ? ? ? 1_555 A C 62 N4 ? ? A A 59 A C 62 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 4 "C3'" A C 31 ? ? "C2'" A C 31 ? ? "C1'" A C 31 ? ? 96.89 101.30 -4.41 0.70 N 2 8 "C3'" A A 32 ? ? "C2'" A A 32 ? ? "C1'" A A 32 ? ? 96.31 101.30 -4.99 0.70 N # _pdbx_validate_planes.id 1 _pdbx_validate_planes.PDB_model_num 1 _pdbx_validate_planes.auth_comp_id C _pdbx_validate_planes.auth_asym_id A _pdbx_validate_planes.auth_seq_id 13 _pdbx_validate_planes.PDB_ins_code ? _pdbx_validate_planes.label_alt_id ? _pdbx_validate_planes.rmsd 0.058 _pdbx_validate_planes.type 'SIDE CHAIN' # _pdbx_nmr_ensemble.entry_id 8SCH _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the least restraint violations' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 8SCH _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'target function' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 '1 mM TCEI_III, 10 mM sodium phosphate, 90% H2O/10% D2O' '90% H2O/10% D2O' 'iso exchangeable' solution ? 2 '1 mM [U-100% 15N] TCEI_III, 10 mM sodium phosphate, 18 mg/mL nat Pf1 phage, 90% H2O/10% D2O' '90% H2O/10% D2O' anisotropic 'filamentous virus' ? # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 TCEI_III 1 ? mM 'natural abundance' 1 'sodium phosphate' 10 ? mM 'natural abundance' 2 TCEI_III 1 ? mM '[U-100% 15N]' 2 'sodium phosphate' 10 ? mM 'natural abundance' 2 'Pf1 phage' 18 ? mg/mL nat # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.details _pdbx_nmr_exptl_sample_conditions.ionic_strength_err _pdbx_nmr_exptl_sample_conditions.ionic_strength_units _pdbx_nmr_exptl_sample_conditions.label _pdbx_nmr_exptl_sample_conditions.pH_err _pdbx_nmr_exptl_sample_conditions.pH_units _pdbx_nmr_exptl_sample_conditions.pressure_err _pdbx_nmr_exptl_sample_conditions.temperature_err _pdbx_nmr_exptl_sample_conditions.temperature_units 1 278 atm 1 6.8 10 ? ? mM iso ? pH ? ? K 2 278 atm 1 6.8 10 ? ? mM aniso ? pH ? ? K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 1H-1H NOESY' 1 isotropic 2 2 2 '1H 15N ARTSY' 1 anisotropic 3 1 1 '2D 1H-15N HSQC' 1 isotropic 4 2 2 '2D 1H-15N HSQC' 1 anisotropic # _pdbx_nmr_refine.entry_id 8SCH _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 3 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 processing NMRDraw ? 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' 2 'chemical shift assignment' NMRViewJ ? Johnson 3 refinement 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' 4 'peak picking' NMRViewJ ? Johnson 5 'structure calculation' 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8SCH 'a-form double helix' 8SCH 'hairpin loop' 8SCH 'mismatched base pair' 8SCH 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A A 5 1_555 A U 67 1_555 -0.126 -0.159 0.169 2.932 -14.032 2.311 1 A_A5:U67_A A 5 ? A 67 ? 20 1 1 A U 6 1_555 A G 66 1_555 1.404 -0.358 -0.104 -1.263 -14.489 -0.282 2 A_U6:G66_A A 6 ? A 66 ? 28 1 1 A C 7 1_555 A G 65 1_555 0.380 -0.147 -0.061 -1.417 -11.098 4.311 3 A_C7:G65_A A 7 ? A 65 ? 19 1 1 A C 8 1_555 A G 64 1_555 0.209 -0.072 -0.090 -0.968 -7.389 2.758 4 A_C8:G64_A A 8 ? A 64 ? 19 1 1 A A 9 1_555 A U 63 1_555 -0.016 -0.112 0.055 1.499 -6.722 0.582 5 A_A9:U63_A A 9 ? A 63 ? 20 1 1 A G 10 1_555 A C 62 1_555 -0.319 -0.096 0.036 1.022 -10.847 3.803 6 A_G10:C62_A A 10 ? A 62 ? 19 1 1 A C 11 1_555 A G 61 1_555 0.113 -0.063 0.097 2.042 -12.917 4.424 7 A_C11:G61_A A 11 ? A 61 ? 19 1 1 A U 12 1_555 A A 60 1_555 0.388 -0.233 0.062 -2.980 -9.676 1.468 8 A_U12:A60_A A 12 ? A 60 ? 20 1 1 A G 15 1_555 A C 53 1_555 -1.247 -0.460 -0.225 -5.102 10.999 -4.942 9 A_G15:C53_A A 15 ? A 53 ? 19 1 1 A G 16 1_555 A C 52 1_555 -0.400 0.014 0.007 5.032 1.849 3.736 10 A_G16:C52_A A 16 ? A 52 ? 19 1 1 A A 17 1_555 A U 51 1_555 0.092 -0.114 -0.038 2.141 -6.628 6.586 11 A_A17:U51_A A 17 ? A 51 ? 20 1 1 A G 19 1_555 A C 48 1_555 -1.100 -0.303 -0.084 -3.948 12.562 7.204 12 A_G19:C48_A A 19 ? A 48 ? 19 1 1 A C 20 1_555 A G 47 1_555 -0.665 -0.013 -0.151 5.101 1.868 2.674 13 A_C20:G47_A A 20 ? A 47 ? 19 1 1 A G 21 1_555 A C 46 1_555 -0.505 -0.181 0.044 3.430 -10.008 4.098 14 A_G21:C46_A A 21 ? A 46 ? 19 1 1 A U 22 1_555 A A 45 1_555 0.503 -0.206 0.090 3.197 -13.572 11.758 15 A_U22:A45_A A 22 ? A 45 ? 20 1 1 A U 23 1_555 A U 44 1_555 -1.690 -1.371 0.199 2.958 -15.489 3.669 16 A_U23:U44_A A 23 ? A 44 ? 16 1 1 A U 24 1_555 A A 43 1_555 0.051 -0.137 0.160 0.431 -14.580 8.790 17 A_U24:A43_A A 24 ? A 43 ? 20 1 1 A A 25 1_555 A U 42 1_555 -0.206 -0.169 0.159 0.476 -11.624 4.718 18 A_A25:U42_A A 25 ? A 42 ? 20 1 1 A U 26 1_555 A A 41 1_555 0.216 -0.195 0.123 -3.203 -13.501 0.987 19 A_U26:A41_A A 26 ? A 41 ? 20 1 1 A A 27 1_555 A U 40 1_555 0.005 -0.199 0.022 -4.591 -12.409 -3.903 20 A_A27:U40_A A 27 ? A 40 ? 20 1 1 A U 28 1_555 A A 39 1_555 -0.005 -0.054 0.234 -6.250 -13.893 -8.417 21 A_U28:A39_A A 28 ? A 39 ? 20 1 1 A A 29 1_555 A U 38 1_555 -0.386 -0.233 0.018 3.967 -11.203 -9.707 22 A_A29:U38_A A 29 ? A 38 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A A 5 1_555 A U 67 1_555 A U 6 1_555 A G 66 1_555 -0.082 -1.389 3.371 3.001 3.234 38.531 -2.492 0.495 3.233 4.881 -4.529 38.774 1 AA_A5U6:G66U67_AA A 5 ? A 67 ? A 6 ? A 66 ? 1 A U 6 1_555 A G 66 1_555 A C 7 1_555 A G 65 1_555 0.258 -1.729 3.139 2.412 5.339 28.457 -4.522 -0.030 2.787 10.718 -4.841 29.042 2 AA_U6C7:G65G66_AA A 6 ? A 66 ? A 7 ? A 65 ? 1 A C 7 1_555 A G 65 1_555 A C 8 1_555 A G 64 1_555 -0.064 -1.612 3.164 1.285 7.066 30.651 -4.179 0.337 2.728 13.142 -2.391 31.462 3 AA_C7C8:G64G65_AA A 7 ? A 65 ? A 8 ? A 64 ? 1 A C 8 1_555 A G 64 1_555 A A 9 1_555 A U 63 1_555 -0.089 -1.595 2.996 -0.787 10.723 29.972 -4.551 0.042 2.304 19.944 1.464 31.800 4 AA_C8A9:U63G64_AA A 8 ? A 64 ? A 9 ? A 63 ? 1 A A 9 1_555 A U 63 1_555 A G 10 1_555 A C 62 1_555 0.088 -1.641 3.095 -1.098 11.337 30.111 -4.706 -0.328 2.335 20.905 2.024 32.146 5 AA_A9G10:C62U63_AA A 9 ? A 63 ? A 10 ? A 62 ? 1 A G 10 1_555 A C 62 1_555 A C 11 1_555 A G 61 1_555 0.031 -1.488 3.172 -1.141 6.362 33.476 -3.479 -0.221 2.847 10.920 1.958 34.076 6 AA_G10C11:G61C62_AA A 10 ? A 62 ? A 11 ? A 61 ? 1 A C 11 1_555 A G 61 1_555 A U 12 1_555 A A 60 1_555 0.182 -1.510 3.211 0.852 9.117 33.607 -3.808 -0.185 2.724 15.415 -1.440 34.798 7 AA_C11U12:A60G61_AA A 11 ? A 61 ? A 12 ? A 60 ? 1 A G 15 1_555 A C 53 1_555 A G 16 1_555 A C 52 1_555 0.108 -1.790 3.024 -6.087 16.013 28.620 -5.235 -0.990 1.748 29.312 11.142 33.263 8 AA_G15G16:C52C53_AA A 15 ? A 53 ? A 16 ? A 52 ? 1 A G 16 1_555 A C 52 1_555 A A 17 1_555 A U 51 1_555 -0.006 -1.749 3.281 -0.702 10.348 30.733 -4.812 -0.104 2.572 18.863 1.279 32.396 9 AA_G16A17:U51C52_AA A 16 ? A 52 ? A 17 ? A 51 ? 1 A G 19 1_555 A C 48 1_555 A C 20 1_555 A G 47 1_555 0.072 -1.691 3.061 1.759 10.678 28.373 -5.052 0.162 2.289 20.850 -3.435 30.328 10 AA_G19C20:G47C48_AA A 19 ? A 48 ? A 20 ? A 47 ? 1 A C 20 1_555 A G 47 1_555 A G 21 1_555 A C 46 1_555 0.006 -1.764 3.173 -1.479 13.815 29.517 -5.210 -0.232 2.152 25.416 2.720 32.557 11 AA_C20G21:C46G47_AA A 20 ? A 47 ? A 21 ? A 46 ? 1 A G 21 1_555 A C 46 1_555 A U 22 1_555 A A 45 1_555 0.308 -1.319 3.207 -1.151 7.831 34.997 -3.194 -0.655 2.844 12.820 1.884 35.854 12 AA_G21U22:A45C46_AA A 21 ? A 46 ? A 22 ? A 45 ? 1 A U 22 1_555 A A 45 1_555 A U 23 1_555 A U 44 1_555 -0.405 -1.877 3.015 -3.169 9.995 22.779 -6.739 0.169 2.058 23.757 7.533 25.047 13 AA_U22U23:U44A45_AA A 22 ? A 45 ? A 23 ? A 44 ? 1 A U 23 1_555 A U 44 1_555 A U 24 1_555 A A 43 1_555 0.384 -1.191 3.255 -0.093 8.342 41.246 -2.490 -0.545 2.969 11.697 0.131 42.045 14 AA_U23U24:A43U44_AA A 23 ? A 44 ? A 24 ? A 43 ? 1 A U 24 1_555 A A 43 1_555 A A 25 1_555 A U 42 1_555 -0.166 -1.501 3.046 -0.057 8.919 30.136 -4.226 0.298 2.510 16.699 0.106 31.399 15 AA_U24A25:U42A43_AA A 24 ? A 43 ? A 25 ? A 42 ? 1 A A 25 1_555 A U 42 1_555 A U 26 1_555 A A 41 1_555 -0.029 -1.442 3.337 1.467 7.641 34.075 -3.529 0.265 2.951 12.832 -2.463 34.926 16 AA_A25U26:A41U42_AA A 25 ? A 42 ? A 26 ? A 41 ? 1 A U 26 1_555 A A 41 1_555 A A 27 1_555 A U 40 1_555 -0.052 -1.545 3.134 1.770 8.336 32.265 -3.941 0.356 2.657 14.683 -3.117 33.343 17 AA_U26A27:U40A41_AA A 26 ? A 41 ? A 27 ? A 40 ? 1 A A 27 1_555 A U 40 1_555 A U 28 1_555 A A 39 1_555 -0.007 -1.584 3.306 0.955 6.799 32.616 -3.854 0.166 2.924 11.942 -1.678 33.312 18 AA_A27U28:A39U40_AA A 27 ? A 40 ? A 28 ? A 39 ? 1 A U 28 1_555 A A 39 1_555 A A 29 1_555 A U 38 1_555 0.192 -1.628 2.939 3.847 9.405 29.898 -4.446 0.240 2.338 17.600 -7.199 31.540 19 AA_U28A29:U38A39_AA A 28 ? A 39 ? A 29 ? A 38 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Institutes of Health/National Institute of Environmental Health Sciences (NIH/NIEHS)' 'United States' ZIA-ES050165 1 'National Institutes of Health/National Institute of Environmental Health Sciences (NIH/NIEHS)' 'United States' ZIC-ES103362 2 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' 'R35 GM126967' 3 # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.model 'Direct Drive' _pdbx_nmr_spectrometer.type ? _pdbx_nmr_spectrometer.manufacturer Agilent _pdbx_nmr_spectrometer.field_strength 800 _pdbx_nmr_spectrometer.details ? # _atom_sites.entry_id 8SCH _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_