data_8TBO # _entry.id 8TBO # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.383 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8TBO pdb_00008tbo 10.2210/pdb8tbo/pdb WWPDB D_1000275300 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8TBO _pdbx_database_status.recvd_initial_deposition_date 2023-06-29 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Simmons, C.R.' 1 0000-0002-2290-6132 'MacCulloch, T.' 2 0000-0001-5875-3361 'Stephanopoulos, N.' 3 0000-0001-7859-410X 'Yan, H.' 4 0000-0001-7397-9852 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev J.Am.Chem.Soc. _citation.journal_id_ASTM JACSAT _citation.journal_id_CSD ? _citation.journal_id_ISSN 1520-5126 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 145 _citation.language ? _citation.page_first 26075 _citation.page_last 26085 _citation.title ;Site-Specific Arrangement and Structure Determination of Minor Groove Binding Molecules in Self-Assembled Three-Dimensional DNA Crystals. ; _citation.year 2023 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1021/jacs.3c07802 _citation.pdbx_database_id_PubMed 37987645 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Simmons, C.R.' 1 0000-0002-2290-6132 primary 'Buchberger, A.' 2 ? primary 'Henry, S.J.W.' 3 0000-0002-5132-3948 primary 'Novacek, A.' 4 ? primary 'Fahmi, N.E.' 5 ? primary 'MacCulloch, T.' 6 ? primary 'Stephanopoulos, N.' 7 0000-0001-7859-410X primary 'Yan, H.' 8 0000-0001-7397-9852 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 8TBO _cell.details ? _cell.formula_units_Z ? _cell.length_a 68.164 _cell.length_a_esd ? _cell.length_b 68.164 _cell.length_b_esd ? _cell.length_c 63.053 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 6 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8TBO _symmetry.cell_setting ? _symmetry.Int_Tables_number 154 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 32 2 1' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*GP*AP*CP*AP*AP*TP*TP*GP*CP*TP*GP*AP*CP*GP*AP*CP*AP*CP*TP*CP*A)-3') ; 6416.175 1 ? ? ? ? 2 polymer syn ;DNA (5'-D(P*CP*GP*TP*CP*A)-3') ; 1480.012 1 ? ? ? ? 3 polymer syn ;DNA (5'-D(*TP*CP*TP*GP*AP*GP*TP*GP*T)-3') ; 2761.820 1 ? ? ? ? 4 polymer syn ;DNA (5'-D(P*GP*CP*AP*AP*TP*TP*G)-3') ; 2137.435 1 ? ? ? ? 5 non-polymer syn NETROPSIN 430.464 1 ? ? ? ? 6 non-polymer syn 'CACODYLATE ION' 136.989 4 ? ? ? ? 7 water nat water 18.015 3 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no no ;(DG)(DA)(DC)(DA)(DA)(DT)(DT)(DG)(DC)(DT)(DG)(DA)(DC)(DG)(DA)(DC)(DA)(DC)(DT)(DC) (DA) ; GACAATTGCTGACGACACTCA A ? 2 polydeoxyribonucleotide no no '(DC)(DG)(DT)(DC)(DA)' CGTCA B ? 3 polydeoxyribonucleotide no no '(DT)(DC)(DT)(DG)(DA)(DG)(DT)(DG)(DT)' TCTGAGTGT C ? 4 polydeoxyribonucleotide no no '(DG)(DC)(DA)(DA)(DT)(DT)(DG)' GCAATTG D ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DA n 1 3 DC n 1 4 DA n 1 5 DA n 1 6 DT n 1 7 DT n 1 8 DG n 1 9 DC n 1 10 DT n 1 11 DG n 1 12 DA n 1 13 DC n 1 14 DG n 1 15 DA n 1 16 DC n 1 17 DA n 1 18 DC n 1 19 DT n 1 20 DC n 1 21 DA n 2 1 DC n 2 2 DG n 2 3 DT n 2 4 DC n 2 5 DA n 3 1 DT n 3 2 DC n 3 3 DT n 3 4 DG n 3 5 DA n 3 6 DG n 3 7 DT n 3 8 DG n 3 9 DT n 4 1 DG n 4 2 DC n 4 3 DA n 4 4 DA n 4 5 DT n 4 6 DT n 4 7 DG n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 21 'synthetic construct' ? 32630 ? 2 1 sample 1 5 'synthetic construct' ? 32630 ? 3 1 sample 1 9 'synthetic construct' ? 32630 ? 4 1 sample 1 7 'synthetic construct' ? 32630 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 8TBO 8TBO ? 1 ? 1 2 PDB 8TBO 8TBO ? 2 ? 1 3 PDB 8TBO 8TBO ? 3 ? 1 4 PDB 8TBO 8TBO ? 4 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 8TBO A 1 ? 21 ? 8TBO 1 ? 21 ? 1 21 2 2 8TBO B 1 ? 5 ? 8TBO 1 ? 5 ? 1 5 3 3 8TBO C 1 ? 9 ? 8TBO 1 ? 9 ? 1 9 4 4 8TBO D 1 ? 7 ? 8TBO 10 ? 16 ? 10 16 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight CAC non-polymer . 'CACODYLATE ION' dimethylarsinate 'C2 H6 As O2 -1' 136.989 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 HOH non-polymer . WATER ? 'H2 O' 18.015 NT non-polymer . NETROPSIN ? 'C18 H26 N10 O3' 430.464 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8TBO _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 3.30 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 62.78 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details 'temperature gradient generated from 60 to 25 C at 0.3 degrees per hour' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.5 mL of 0.05 M Na Cacodylate pH 7.0, with 18 mM MgCl2, 2.25 mM spermine, 0.9 mM CoH18N6, and 4.5% MPD was added to the reservoir with 2 uL added to the drop containing 4 uL of DNA stock. ; _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 298 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER X 16M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2019-11-16 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.98 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'NSLS-II BEAMLINE 17-ID-2' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.98 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 17-ID-2 _diffrn_source.pdbx_synchrotron_site NSLS-II # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 8TBO _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.599 _reflns.d_resolution_low 50.00 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 5449 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.1 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 16.7 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 12.6 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 3.097 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.089 _reflns.pdbx_Rpim_I_all 0.023 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.956 _reflns.pdbx_CC_star 0.989 _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.085 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.percent_possible_all _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 2.60 2.64 ? ? ? ? ? ? 280 ? ? ? ? ? ? ? ? ? ? ? 12.0 0.415 ? ? 1.321 0.353 ? 1 1 0.755 0.927 ? 96.9 ? 1.269 ? ? ? ? ? ? ? ? ? 2.64 2.69 ? ? ? ? ? ? 258 ? ? ? ? ? ? ? ? ? ? ? 14.1 0.547 ? ? 1.000 0.251 ? 2 1 0.854 0.960 ? 100.0 ? 0.966 ? ? ? ? ? ? ? ? ? 2.69 2.74 ? ? ? ? ? ? 269 ? ? ? ? ? ? ? ? ? ? ? 16.3 0.463 ? ? 0.757 0.180 ? 3 1 0.944 0.986 ? 98.2 ? 0.734 ? ? ? ? ? ? ? ? ? 2.74 2.80 ? ? ? ? ? ? 258 ? ? ? ? ? ? ? ? ? ? ? 17.2 0.474 ? ? 0.626 0.147 ? 4 1 0.960 0.990 ? 100.0 ? 0.608 ? ? ? ? ? ? ? ? ? 2.80 2.86 ? ? ? ? ? ? 272 ? ? ? ? ? ? ? ? ? ? ? 18.0 0.491 ? ? 0.521 0.119 ? 5 1 0.970 0.992 ? 99.3 ? 0.507 ? ? ? ? ? ? ? ? ? 2.86 2.93 ? ? ? ? ? ? 265 ? ? ? ? ? ? ? ? ? ? ? 18.5 0.549 ? ? 0.363 0.083 ? 6 1 0.981 0.995 ? 99.6 ? 0.353 ? ? ? ? ? ? ? ? ? 2.93 3.00 ? ? ? ? ? ? 271 ? ? ? ? ? ? ? ? ? ? ? 18.5 0.890 ? ? 0.259 0.059 ? 7 1 0.986 0.996 ? 98.9 ? 0.252 ? ? ? ? ? ? ? ? ? 3.00 3.08 ? ? ? ? ? ? 262 ? ? ? ? ? ? ? ? ? ? ? 18.6 1.015 ? ? 0.161 0.036 ? 8 1 0.998 1.000 ? 100.0 ? 0.156 ? ? ? ? ? ? ? ? ? 3.08 3.17 ? ? ? ? ? ? 264 ? ? ? ? ? ? ? ? ? ? ? 17.4 1.551 ? ? 0.132 0.032 ? 9 1 0.993 0.998 ? 98.9 ? 0.127 ? ? ? ? ? ? ? ? ? 3.17 3.28 ? ? ? ? ? ? 262 ? ? ? ? ? ? ? ? ? ? ? 15.9 2.056 ? ? 0.119 0.032 ? 10 1 0.996 0.999 ? 96.0 ? 0.114 ? ? ? ? ? ? ? ? ? 3.28 3.39 ? ? ? ? ? ? 272 ? ? ? ? ? ? ? ? ? ? ? 18.0 3.696 ? ? 0.112 0.026 ? 11 1 0.999 1.000 ? 99.3 ? 0.109 ? ? ? ? ? ? ? ? ? 3.39 3.53 ? ? ? ? ? ? 272 ? ? ? ? ? ? ? ? ? ? ? 17.0 3.888 ? ? 0.113 0.028 ? 12 1 0.997 0.999 ? 99.6 ? 0.109 ? ? ? ? ? ? ? ? ? 3.53 3.69 ? ? ? ? ? ? 273 ? ? ? ? ? ? ? ? ? ? ? 17.6 4.202 ? ? 0.113 0.027 ? 13 1 0.998 0.999 ? 100.0 ? 0.110 ? ? ? ? ? ? ? ? ? 3.69 3.88 ? ? ? ? ? ? 266 ? ? ? ? ? ? ? ? ? ? ? 19.0 4.259 ? ? 0.102 0.023 ? 14 1 0.998 0.999 ? 99.6 ? 0.099 ? ? ? ? ? ? ? ? ? 3.88 4.13 ? ? ? ? ? ? 271 ? ? ? ? ? ? ? ? ? ? ? 18.1 5.424 ? ? 0.099 0.024 ? 15 1 0.998 1.000 ? 99.6 ? 0.096 ? ? ? ? ? ? ? ? ? 4.13 4.45 ? ? ? ? ? ? 281 ? ? ? ? ? ? ? ? ? ? ? 17.6 5.255 ? ? 0.094 0.023 ? 16 1 0.997 0.999 ? 99.6 ? 0.091 ? ? ? ? ? ? ? ? ? 4.45 4.89 ? ? ? ? ? ? 284 ? ? ? ? ? ? ? ? ? ? ? 16.6 5.188 ? ? 0.085 0.022 ? 17 1 0.997 0.999 ? 99.3 ? 0.082 ? ? ? ? ? ? ? ? ? 4.89 5.60 ? ? ? ? ? ? 272 ? ? ? ? ? ? ? ? ? ? ? 15.5 5.849 ? ? 0.077 0.020 ? 18 1 0.997 0.999 ? 99.6 ? 0.074 ? ? ? ? ? ? ? ? ? 5.60 7.05 ? ? ? ? ? ? 292 ? ? ? ? ? ? ? ? ? ? ? 13.8 7.060 ? ? 0.072 0.020 ? 19 1 0.998 0.999 ? 99.7 ? 0.069 ? ? ? ? ? ? ? ? ? 7.05 50.00 ? ? ? ? ? ? 305 ? ? ? ? ? ? ? ? ? ? ? 15.3 7.857 ? ? 0.069 0.020 ? 20 1 0.989 0.997 ? 98.1 ? 0.066 ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8TBO _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.599 _refine.ls_d_res_low 43.093 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 5389 _refine.ls_number_reflns_R_free 269 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 98.05 _refine.ls_percent_reflns_R_free 4.99 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2138 _refine.ls_R_factor_R_free 0.2430 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2119 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.39 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 27.07 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.33 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 855 _refine_hist.pdbx_number_atoms_ligand 35 _refine_hist.number_atoms_solvent 3 _refine_hist.number_atoms_total 893 _refine_hist.d_res_high 2.599 _refine_hist.d_res_low 43.093 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.010 ? 988 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.120 ? 1511 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 34.596 ? 417 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.059 ? 166 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.007 ? 49 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.599 3.2740 . . 134 2491 97.00 . . . . 0.3769 . . . . . . . . . . . 0.3696 'X-RAY DIFFRACTION' 3.2740 43.093 . . 135 2629 99.00 . . . . 0.1850 . . . . . . . . . . . 0.2207 # _struct.entry_id 8TBO _struct.title ;Sequence specific (AATT) orientation of netropsin molecules at a unique minor groove binding site (position1) within a self-assembled 3D DNA lattice (4x5) ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8TBO _struct_keywords.text ;Self-Assembly, DNA Nanotechnology, DNA Scaffold, Crystal Lattice, DNA, Minor Groove Binders, Netropsin, DAPI, Hoechst, ImPyPy, polyamide, host-guest ; _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 5 ? F N N 6 ? G N N 6 ? H N N 6 ? I N N 6 ? J N N 7 ? K N N 7 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A DC 3 N3 ? ? ? 1_555 D DG 7 N1 ? ? A DC 3 D DG 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DC 3 N4 ? ? ? 1_555 D DG 7 O6 ? ? A DC 3 D DG 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DC 3 O2 ? ? ? 1_555 D DG 7 N2 ? ? A DC 3 D DG 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DA 4 N1 ? ? ? 1_555 D DT 6 N3 ? ? A DA 4 D DT 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DA 4 N6 ? ? ? 1_555 D DT 6 O4 ? ? A DA 4 D DT 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DA 5 N1 ? ? ? 1_555 D DT 5 N3 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DA 5 N6 ? ? ? 1_555 D DT 5 O4 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DT 6 N3 ? ? ? 1_555 D DA 4 N1 ? ? A DT 6 D DA 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DT 6 O4 ? ? ? 1_555 D DA 4 N6 ? ? A DT 6 D DA 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DT 7 N3 ? ? ? 1_555 D DA 3 N1 ? ? A DT 7 D DA 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DT 7 O4 ? ? ? 1_555 D DA 3 N6 ? ? A DT 7 D DA 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DG 8 N1 ? ? ? 1_555 D DC 2 N3 ? ? A DG 8 D DC 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DG 8 N2 ? ? ? 1_555 D DC 2 O2 ? ? A DG 8 D DC 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DG 8 O6 ? ? ? 1_555 D DC 2 N4 ? ? A DG 8 D DC 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DC 9 N3 ? ? ? 1_555 D DG 1 N1 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 9 N4 ? ? ? 1_555 D DG 1 O6 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DC 9 O2 ? ? ? 1_555 D DG 1 N2 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DT 10 N3 ? ? ? 1_555 B DA 5 N1 ? ? A DT 10 B DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DT 10 O4 ? ? ? 1_555 B DA 5 N6 ? ? A DT 10 B DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DG 11 N1 ? ? ? 1_555 B DC 4 N3 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DG 11 N2 ? ? ? 1_555 B DC 4 O2 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DG 11 O6 ? ? ? 1_555 B DC 4 N4 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DA 12 N1 ? ? ? 1_555 B DT 3 N3 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DA 12 N6 ? ? ? 1_555 B DT 3 O4 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DC 13 N3 ? ? ? 1_555 B DG 2 N1 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DC 13 N4 ? ? ? 1_555 B DG 2 O6 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DC 13 O2 ? ? ? 1_555 B DG 2 N2 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DG 14 N1 ? ? ? 1_555 B DC 1 N3 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DG 14 N2 ? ? ? 1_555 B DC 1 O2 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A DG 14 O6 ? ? ? 1_555 B DC 1 N4 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A DA 15 N1 ? ? ? 1_555 C DT 9 N3 ? ? A DA 15 C DT 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A DA 15 N6 ? ? ? 1_555 C DT 9 O4 ? ? A DA 15 C DT 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DC 16 N3 ? ? ? 1_555 C DG 8 N1 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DC 16 N4 ? ? ? 1_555 C DG 8 O6 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DC 16 O2 ? ? ? 1_555 C DG 8 N2 ? ? A DC 16 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DA 17 N1 ? ? ? 1_555 C DT 7 N3 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DA 17 N6 ? ? ? 1_555 C DT 7 O4 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DC 18 N3 ? ? ? 1_555 C DG 6 N1 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DC 18 N4 ? ? ? 1_555 C DG 6 O6 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DC 18 O2 ? ? ? 1_555 C DG 6 N2 ? ? A DC 18 C DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DT 19 N3 ? ? ? 1_555 C DA 5 N1 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DT 19 O4 ? ? ? 1_555 C DA 5 N6 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DC 20 N3 ? ? ? 1_555 C DG 4 N1 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DC 20 N4 ? ? ? 1_555 C DG 4 O6 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A DC 20 O2 ? ? ? 1_555 C DG 4 N2 ? ? A DC 20 C DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A DA 21 N1 ? ? ? 1_555 C DT 3 N3 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A DA 21 N6 ? ? ? 1_555 C DT 3 O4 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _atom_sites.entry_id 8TBO _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.014671 _atom_sites.fract_transf_matrix[1][2] 0.008470 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.016940 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.015860 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol AS C N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DA 2 2 2 DA DA A . n A 1 3 DC 3 3 3 DC DC A . n A 1 4 DA 4 4 4 DA DA A . n A 1 5 DA 5 5 5 DA DA A . n A 1 6 DT 6 6 6 DT DT A . n A 1 7 DT 7 7 7 DT DT A . n A 1 8 DG 8 8 8 DG DG A . n A 1 9 DC 9 9 9 DC DC A . n A 1 10 DT 10 10 10 DT DT A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DA 12 12 12 DA DA A . n A 1 13 DC 13 13 13 DC DC A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DA 15 15 15 DA DA A . n A 1 16 DC 16 16 16 DC DC A . n A 1 17 DA 17 17 17 DA DA A . n A 1 18 DC 18 18 18 DC DC A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DC 20 20 20 DC DC A . n A 1 21 DA 21 21 21 DA DA A . n B 2 1 DC 1 1 1 DC DC B . n B 2 2 DG 2 2 2 DG DG B . n B 2 3 DT 3 3 3 DT DT B . n B 2 4 DC 4 4 4 DC DC B . n B 2 5 DA 5 5 5 DA DA B . n C 3 1 DT 1 1 1 DT DT C . n C 3 2 DC 2 2 2 DC DC C . n C 3 3 DT 3 3 3 DT DT C . n C 3 4 DG 4 4 4 DG DG C . n C 3 5 DA 5 5 5 DA DA C . n C 3 6 DG 6 6 6 DG DG C . n C 3 7 DT 7 7 7 DT DT C . n C 3 8 DG 8 8 8 DG DG C . n C 3 9 DT 9 9 9 DT DT C . n D 4 1 DG 1 10 10 DG DG D . n D 4 2 DC 2 11 11 DC DC D . n D 4 3 DA 3 12 12 DA DA D . n D 4 4 DA 4 13 13 DA DA D . n D 4 5 DT 5 14 14 DT DT D . n D 4 6 DT 6 15 15 DT DT D . n D 4 7 DG 7 16 16 DG DG D . n # _pdbx_contact_author.id 2 _pdbx_contact_author.email hao.yan@asu.edu _pdbx_contact_author.name_first Hao _pdbx_contact_author.name_last Yan _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0001-7397-9852 # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code E 5 NT 1 101 25 NT NT A . F 6 CAC 1 101 3 CAC AS B . G 6 CAC 1 101 1 CAC AS C . H 6 CAC 1 102 8 CAC AS C . I 6 CAC 1 101 6 CAC AS D . J 7 HOH 1 201 2 HOH HOH A . J 7 HOH 2 202 3 HOH HOH A . K 7 HOH 1 201 4 HOH HOH C . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details tetrameric _pdbx_struct_assembly.oligomeric_count 4 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J,K # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _pdbx_struct_special_symmetry.id 1 _pdbx_struct_special_symmetry.PDB_model_num 1 _pdbx_struct_special_symmetry.auth_asym_id C _pdbx_struct_special_symmetry.auth_comp_id HOH _pdbx_struct_special_symmetry.auth_seq_id 201 _pdbx_struct_special_symmetry.PDB_ins_code ? _pdbx_struct_special_symmetry.label_asym_id K _pdbx_struct_special_symmetry.label_comp_id HOH _pdbx_struct_special_symmetry.label_seq_id . # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2023-12-20 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.10_2152: ???)' 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _pdbx_entry_details.entry_id 8TBO _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 "O3'" C DG 8 ? ? "C3'" C DG 8 ? ? 1.379 1.419 -0.040 0.006 N 2 1 "O3'" C DT 9 ? ? "C3'" C DT 9 ? ? 1.381 1.419 -0.038 0.006 N 3 1 "O3'" D DT 14 ? ? "C3'" D DT 14 ? ? 1.345 1.419 -0.074 0.006 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A DC 13 ? ? "C1'" A DC 13 ? ? N1 A DC 13 ? ? 110.56 108.30 2.26 0.30 N 2 1 "O4'" A DC 20 ? ? "C1'" A DC 20 ? ? N1 A DC 20 ? ? 110.52 108.30 2.22 0.30 N 3 1 "C3'" B DA 5 ? ? "C2'" B DA 5 ? ? "C1'" B DA 5 ? ? 97.43 102.40 -4.97 0.80 N 4 1 "O4'" B DA 5 ? ? "C1'" B DA 5 ? ? N9 B DA 5 ? ? 110.68 108.30 2.38 0.30 N # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 N 1 B CAC 101 ? O1 ? F CAC 1 O1 2 1 N 1 B CAC 101 ? O2 ? F CAC 1 O2 3 1 N 1 B CAC 101 ? C1 ? F CAC 1 C1 4 1 N 1 B CAC 101 ? C2 ? F CAC 1 C2 5 1 N 1 C CAC 101 ? O1 ? G CAC 1 O1 6 1 N 1 C CAC 101 ? O2 ? G CAC 1 O2 7 1 N 1 C CAC 101 ? C1 ? G CAC 1 C1 8 1 N 1 C CAC 101 ? C2 ? G CAC 1 C2 9 1 N 1 C CAC 102 ? O1 ? H CAC 1 O1 10 1 N 1 C CAC 102 ? O2 ? H CAC 1 O2 11 1 N 1 C CAC 102 ? C1 ? H CAC 1 C1 12 1 N 1 C CAC 102 ? C2 ? H CAC 1 C2 13 1 N 1 D CAC 101 ? O1 ? I CAC 1 O1 14 1 N 1 D CAC 101 ? O2 ? I CAC 1 O2 15 1 N 1 D CAC 101 ? C1 ? I CAC 1 C1 16 1 N 1 D CAC 101 ? C2 ? I CAC 1 C2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal CAC AS AS N N 1 CAC O1 O N N 2 CAC O2 O N N 3 CAC C1 C N N 4 CAC C2 C N N 5 CAC H11 H N N 6 CAC H12 H N N 7 CAC H13 H N N 8 CAC H21 H N N 9 CAC H22 H N N 10 CAC H23 H N N 11 DA OP3 O N N 12 DA P P N N 13 DA OP1 O N N 14 DA OP2 O N N 15 DA "O5'" O N N 16 DA "C5'" C N N 17 DA "C4'" C N R 18 DA "O4'" O N N 19 DA "C3'" C N S 20 DA "O3'" O N N 21 DA "C2'" C N N 22 DA "C1'" C N R 23 DA N9 N Y N 24 DA C8 C Y N 25 DA N7 N Y N 26 DA C5 C Y N 27 DA C6 C Y N 28 DA N6 N N N 29 DA N1 N Y N 30 DA C2 C Y N 31 DA N3 N Y N 32 DA C4 C Y N 33 DA HOP3 H N N 34 DA HOP2 H N N 35 DA "H5'" H N N 36 DA "H5''" H N N 37 DA "H4'" H N N 38 DA "H3'" H N N 39 DA "HO3'" H N N 40 DA "H2'" H N N 41 DA "H2''" H N N 42 DA "H1'" H N N 43 DA H8 H N N 44 DA H61 H N N 45 DA H62 H N N 46 DA H2 H N N 47 DC OP3 O N N 48 DC P P N N 49 DC OP1 O N N 50 DC OP2 O N N 51 DC "O5'" O N N 52 DC "C5'" C N N 53 DC "C4'" C N R 54 DC "O4'" O N N 55 DC "C3'" C N S 56 DC "O3'" O N N 57 DC "C2'" C N N 58 DC "C1'" C N R 59 DC N1 N N N 60 DC C2 C N N 61 DC O2 O N N 62 DC N3 N N N 63 DC C4 C N N 64 DC N4 N N N 65 DC C5 C N N 66 DC C6 C N N 67 DC HOP3 H N N 68 DC HOP2 H N N 69 DC "H5'" H N N 70 DC "H5''" H N N 71 DC "H4'" H N N 72 DC "H3'" H N N 73 DC "HO3'" H N N 74 DC "H2'" H N N 75 DC "H2''" H N N 76 DC "H1'" H N N 77 DC H41 H N N 78 DC H42 H N N 79 DC H5 H N N 80 DC H6 H N N 81 DG OP3 O N N 82 DG P P N N 83 DG OP1 O N N 84 DG OP2 O N N 85 DG "O5'" O N N 86 DG "C5'" C N N 87 DG "C4'" C N R 88 DG "O4'" O N N 89 DG "C3'" C N S 90 DG "O3'" O N N 91 DG "C2'" C N N 92 DG "C1'" C N R 93 DG N9 N Y N 94 DG C8 C Y N 95 DG N7 N Y N 96 DG C5 C Y N 97 DG C6 C N N 98 DG O6 O N N 99 DG N1 N N N 100 DG C2 C N N 101 DG N2 N N N 102 DG N3 N N N 103 DG C4 C Y N 104 DG HOP3 H N N 105 DG HOP2 H N N 106 DG "H5'" H N N 107 DG "H5''" H N N 108 DG "H4'" H N N 109 DG "H3'" H N N 110 DG "HO3'" H N N 111 DG "H2'" H N N 112 DG "H2''" H N N 113 DG "H1'" H N N 114 DG H8 H N N 115 DG H1 H N N 116 DG H21 H N N 117 DG H22 H N N 118 DT OP3 O N N 119 DT P P N N 120 DT OP1 O N N 121 DT OP2 O N N 122 DT "O5'" O N N 123 DT "C5'" C N N 124 DT "C4'" C N R 125 DT "O4'" O N N 126 DT "C3'" C N S 127 DT "O3'" O N N 128 DT "C2'" C N N 129 DT "C1'" C N R 130 DT N1 N N N 131 DT C2 C N N 132 DT O2 O N N 133 DT N3 N N N 134 DT C4 C N N 135 DT O4 O N N 136 DT C5 C N N 137 DT C7 C N N 138 DT C6 C N N 139 DT HOP3 H N N 140 DT HOP2 H N N 141 DT "H5'" H N N 142 DT "H5''" H N N 143 DT "H4'" H N N 144 DT "H3'" H N N 145 DT "HO3'" H N N 146 DT "H2'" H N N 147 DT "H2''" H N N 148 DT "H1'" H N N 149 DT H3 H N N 150 DT H71 H N N 151 DT H72 H N N 152 DT H73 H N N 153 DT H6 H N N 154 HOH O O N N 155 HOH H1 H N N 156 HOH H2 H N N 157 NT C1 C N N 158 NT N1 N N N 159 NT N2 N N N 160 NT N3 N N N 161 NT C2 C N N 162 NT C3 C N N 163 NT O1 O N N 164 NT N4 N N N 165 NT C4 C Y N 166 NT C5 C Y N 167 NT C6 C Y N 168 NT N5 N Y N 169 NT C8 C N N 170 NT C7 C Y N 171 NT C9 C N N 172 NT O2 O N N 173 NT N6 N N N 174 NT C10 C Y N 175 NT C11 C Y N 176 NT C12 C Y N 177 NT N7 N Y N 178 NT C14 C N N 179 NT C13 C Y N 180 NT C15 C N N 181 NT O3 O N N 182 NT N8 N N N 183 NT C16 C N N 184 NT C17 C N N 185 NT C18 C N N 186 NT N9 N N N 187 NT N10 N N N 188 NT HN1 H N N 189 NT HN21 H N N 190 NT HN22 H N N 191 NT HN3 H N N 192 NT H21 H N N 193 NT H22 H N N 194 NT HN4 H N N 195 NT H5 H N N 196 NT H81 H N N 197 NT H82 H N N 198 NT H83 H N N 199 NT H7 H N N 200 NT HN6 H N N 201 NT H11 H N N 202 NT H141 H N N 203 NT H142 H N N 204 NT H143 H N N 205 NT H13 H N N 206 NT HN8 H N N 207 NT H161 H N N 208 NT H162 H N N 209 NT H171 H N N 210 NT H172 H N N 211 NT HN9 H N N 212 NT HN01 H N N 213 NT HN02 H N N 214 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal CAC AS O1 doub N N 1 CAC AS O2 sing N N 2 CAC AS C1 sing N N 3 CAC AS C2 sing N N 4 CAC C1 H11 sing N N 5 CAC C1 H12 sing N N 6 CAC C1 H13 sing N N 7 CAC C2 H21 sing N N 8 CAC C2 H22 sing N N 9 CAC C2 H23 sing N N 10 DA OP3 P sing N N 11 DA OP3 HOP3 sing N N 12 DA P OP1 doub N N 13 DA P OP2 sing N N 14 DA P "O5'" sing N N 15 DA OP2 HOP2 sing N N 16 DA "O5'" "C5'" sing N N 17 DA "C5'" "C4'" sing N N 18 DA "C5'" "H5'" sing N N 19 DA "C5'" "H5''" sing N N 20 DA "C4'" "O4'" sing N N 21 DA "C4'" "C3'" sing N N 22 DA "C4'" "H4'" sing N N 23 DA "O4'" "C1'" sing N N 24 DA "C3'" "O3'" sing N N 25 DA "C3'" "C2'" sing N N 26 DA "C3'" "H3'" sing N N 27 DA "O3'" "HO3'" sing N N 28 DA "C2'" "C1'" sing N N 29 DA "C2'" "H2'" sing N N 30 DA "C2'" "H2''" sing N N 31 DA "C1'" N9 sing N N 32 DA "C1'" "H1'" sing N N 33 DA N9 C8 sing Y N 34 DA N9 C4 sing Y N 35 DA C8 N7 doub Y N 36 DA C8 H8 sing N N 37 DA N7 C5 sing Y N 38 DA C5 C6 sing Y N 39 DA C5 C4 doub Y N 40 DA C6 N6 sing N N 41 DA C6 N1 doub Y N 42 DA N6 H61 sing N N 43 DA N6 H62 sing N N 44 DA N1 C2 sing Y N 45 DA C2 N3 doub Y N 46 DA C2 H2 sing N N 47 DA N3 C4 sing Y N 48 DC OP3 P sing N N 49 DC OP3 HOP3 sing N N 50 DC P OP1 doub N N 51 DC P OP2 sing N N 52 DC P "O5'" sing N N 53 DC OP2 HOP2 sing N N 54 DC "O5'" "C5'" sing N N 55 DC "C5'" "C4'" sing N N 56 DC "C5'" "H5'" sing N N 57 DC "C5'" "H5''" sing N N 58 DC "C4'" "O4'" sing N N 59 DC "C4'" "C3'" sing N N 60 DC "C4'" "H4'" sing N N 61 DC "O4'" "C1'" sing N N 62 DC "C3'" "O3'" sing N N 63 DC "C3'" "C2'" sing N N 64 DC "C3'" "H3'" sing N N 65 DC "O3'" "HO3'" sing N N 66 DC "C2'" "C1'" sing N N 67 DC "C2'" "H2'" sing N N 68 DC "C2'" "H2''" sing N N 69 DC "C1'" N1 sing N N 70 DC "C1'" "H1'" sing N N 71 DC N1 C2 sing N N 72 DC N1 C6 sing N N 73 DC C2 O2 doub N N 74 DC C2 N3 sing N N 75 DC N3 C4 doub N N 76 DC C4 N4 sing N N 77 DC C4 C5 sing N N 78 DC N4 H41 sing N N 79 DC N4 H42 sing N N 80 DC C5 C6 doub N N 81 DC C5 H5 sing N N 82 DC C6 H6 sing N N 83 DG OP3 P sing N N 84 DG OP3 HOP3 sing N N 85 DG P OP1 doub N N 86 DG P OP2 sing N N 87 DG P "O5'" sing N N 88 DG OP2 HOP2 sing N N 89 DG "O5'" "C5'" sing N N 90 DG "C5'" "C4'" sing N N 91 DG "C5'" "H5'" sing N N 92 DG "C5'" "H5''" sing N N 93 DG "C4'" "O4'" sing N N 94 DG "C4'" "C3'" sing N N 95 DG "C4'" "H4'" sing N N 96 DG "O4'" "C1'" sing N N 97 DG "C3'" "O3'" sing N N 98 DG "C3'" "C2'" sing N N 99 DG "C3'" "H3'" sing N N 100 DG "O3'" "HO3'" sing N N 101 DG "C2'" "C1'" sing N N 102 DG "C2'" "H2'" sing N N 103 DG "C2'" "H2''" sing N N 104 DG "C1'" N9 sing N N 105 DG "C1'" "H1'" sing N N 106 DG N9 C8 sing Y N 107 DG N9 C4 sing Y N 108 DG C8 N7 doub Y N 109 DG C8 H8 sing N N 110 DG N7 C5 sing Y N 111 DG C5 C6 sing N N 112 DG C5 C4 doub Y N 113 DG C6 O6 doub N N 114 DG C6 N1 sing N N 115 DG N1 C2 sing N N 116 DG N1 H1 sing N N 117 DG C2 N2 sing N N 118 DG C2 N3 doub N N 119 DG N2 H21 sing N N 120 DG N2 H22 sing N N 121 DG N3 C4 sing N N 122 DT OP3 P sing N N 123 DT OP3 HOP3 sing N N 124 DT P OP1 doub N N 125 DT P OP2 sing N N 126 DT P "O5'" sing N N 127 DT OP2 HOP2 sing N N 128 DT "O5'" "C5'" sing N N 129 DT "C5'" "C4'" sing N N 130 DT "C5'" "H5'" sing N N 131 DT "C5'" "H5''" sing N N 132 DT "C4'" "O4'" sing N N 133 DT "C4'" "C3'" sing N N 134 DT "C4'" "H4'" sing N N 135 DT "O4'" "C1'" sing N N 136 DT "C3'" "O3'" sing N N 137 DT "C3'" "C2'" sing N N 138 DT "C3'" "H3'" sing N N 139 DT "O3'" "HO3'" sing N N 140 DT "C2'" "C1'" sing N N 141 DT "C2'" "H2'" sing N N 142 DT "C2'" "H2''" sing N N 143 DT "C1'" N1 sing N N 144 DT "C1'" "H1'" sing N N 145 DT N1 C2 sing N N 146 DT N1 C6 sing N N 147 DT C2 O2 doub N N 148 DT C2 N3 sing N N 149 DT N3 C4 sing N N 150 DT N3 H3 sing N N 151 DT C4 O4 doub N N 152 DT C4 C5 sing N N 153 DT C5 C7 sing N N 154 DT C5 C6 doub N N 155 DT C7 H71 sing N N 156 DT C7 H72 sing N N 157 DT C7 H73 sing N N 158 DT C6 H6 sing N N 159 HOH O H1 sing N N 160 HOH O H2 sing N N 161 NT C1 N1 doub N N 162 NT C1 N2 sing N N 163 NT C1 N3 sing N N 164 NT N1 HN1 sing N N 165 NT N2 HN21 sing N N 166 NT N2 HN22 sing N N 167 NT N3 C2 sing N N 168 NT N3 HN3 sing N N 169 NT C2 C3 sing N N 170 NT C2 H21 sing N N 171 NT C2 H22 sing N N 172 NT C3 O1 doub N N 173 NT C3 N4 sing N N 174 NT N4 C4 sing N N 175 NT N4 HN4 sing N N 176 NT C4 C5 sing Y N 177 NT C4 C7 doub Y N 178 NT C5 C6 doub Y N 179 NT C5 H5 sing N N 180 NT C6 N5 sing Y N 181 NT C6 C9 sing N N 182 NT N5 C8 sing N N 183 NT N5 C7 sing Y N 184 NT C8 H81 sing N N 185 NT C8 H82 sing N N 186 NT C8 H83 sing N N 187 NT C7 H7 sing N N 188 NT C9 O2 doub N N 189 NT C9 N6 sing N N 190 NT N6 C10 sing N N 191 NT N6 HN6 sing N N 192 NT C10 C11 sing Y N 193 NT C10 C13 doub Y N 194 NT C11 C12 doub Y N 195 NT C11 H11 sing N N 196 NT C12 N7 sing Y N 197 NT C12 C15 sing N N 198 NT N7 C14 sing N N 199 NT N7 C13 sing Y N 200 NT C14 H141 sing N N 201 NT C14 H142 sing N N 202 NT C14 H143 sing N N 203 NT C13 H13 sing N N 204 NT C15 O3 doub N N 205 NT C15 N8 sing N N 206 NT N8 C16 sing N N 207 NT N8 HN8 sing N N 208 NT C16 C17 sing N N 209 NT C16 H161 sing N N 210 NT C16 H162 sing N N 211 NT C17 C18 sing N N 212 NT C17 H171 sing N N 213 NT C17 H172 sing N N 214 NT C18 N9 doub N N 215 NT C18 N10 sing N N 216 NT N9 HN9 sing N N 217 NT N10 HN01 sing N N 218 NT N10 HN02 sing N N 219 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8TBO 'double helix' 8TBO 'a-form double helix' 8TBO 'b-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DC 3 1_555 D DG 7 1_555 0.153 -0.195 -0.019 0.711 -5.454 -0.232 1 A_DC3:DG16_D A 3 ? D 16 ? 19 1 1 A DA 4 1_555 D DT 6 1_555 0.160 0.162 -0.085 4.532 -8.632 9.277 2 A_DA4:DT15_D A 4 ? D 15 ? 20 1 1 A DA 5 1_555 D DT 5 1_555 0.121 -0.202 0.442 11.150 -16.180 3.059 3 A_DA5:DT14_D A 5 ? D 14 ? 20 1 1 A DT 6 1_555 D DA 4 1_555 -0.129 -0.286 0.355 -0.723 -15.912 -0.188 4 A_DT6:DA13_D A 6 ? D 13 ? 20 1 1 A DT 7 1_555 D DA 3 1_555 -0.209 -0.302 0.208 -2.697 -7.326 -2.336 5 A_DT7:DA12_D A 7 ? D 12 ? 20 1 1 A DG 8 1_555 D DC 2 1_555 -0.239 -0.191 -0.256 -6.349 -4.565 0.124 6 A_DG8:DC11_D A 8 ? D 11 ? 19 1 1 A DC 9 1_555 D DG 1 1_555 0.252 -0.149 0.414 -4.495 -7.879 1.610 7 A_DC9:DG10_D A 9 ? D 10 ? 19 1 1 A DT 10 1_555 B DA 5 1_555 -0.129 -0.183 0.327 -3.231 -3.059 -1.194 8 A_DT10:DA5_B A 10 ? B 5 ? 20 1 1 A DG 11 1_555 B DC 4 1_555 -0.110 -0.074 0.537 8.325 -6.757 1.227 9 A_DG11:DC4_B A 11 ? B 4 ? 19 1 1 A DA 12 1_555 B DT 3 1_555 0.249 -0.220 0.127 4.559 -7.775 -1.877 10 A_DA12:DT3_B A 12 ? B 3 ? 20 1 1 A DC 13 1_555 B DG 2 1_555 0.202 -0.260 0.238 7.004 -8.011 1.038 11 A_DC13:DG2_B A 13 ? B 2 ? 19 1 1 A DG 14 1_555 B DC 1 1_555 -0.255 -0.180 0.047 1.169 -8.599 0.359 12 A_DG14:DC1_B A 14 ? B 1 ? 19 1 1 A DA 15 1_555 C DT 9 1_555 0.087 -0.078 0.280 -0.730 -2.386 -2.030 13 A_DA15:DT9_C A 15 ? C 9 ? 20 1 1 A DC 16 1_555 C DG 8 1_555 0.195 -0.146 0.279 2.616 -2.515 1.010 14 A_DC16:DG8_C A 16 ? C 8 ? 19 1 1 A DA 17 1_555 C DT 7 1_555 0.331 -0.194 0.471 4.431 -7.715 -5.298 15 A_DA17:DT7_C A 17 ? C 7 ? 20 1 1 A DC 18 1_555 C DG 6 1_555 0.112 -0.248 0.016 -0.322 -8.317 0.270 16 A_DC18:DG6_C A 18 ? C 6 ? 19 1 1 A DT 19 1_555 C DA 5 1_555 -0.087 -0.119 0.053 -0.397 -8.294 0.543 17 A_DT19:DA5_C A 19 ? C 5 ? 20 1 1 A DC 20 1_555 C DG 4 1_555 0.335 -0.053 0.290 4.091 -6.269 0.738 18 A_DC20:DG4_C A 20 ? C 4 ? 19 1 1 A DA 21 1_555 C DT 3 1_555 0.037 0.276 0.440 9.068 -12.721 5.575 19 A_DA21:DT3_C A 21 ? C 3 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DC 3 1_555 D DG 7 1_555 A DA 4 1_555 D DT 6 1_555 0.210 0.105 3.251 2.788 6.643 34.628 -0.808 0.065 3.222 11.014 -4.621 35.347 1 AA_DC3DA4:DT15DG16_DD A 3 ? D 16 ? A 4 ? D 15 ? 1 A DA 4 1_555 D DT 6 1_555 A DA 5 1_555 D DT 5 1_555 -0.403 0.043 2.976 -4.719 2.611 36.524 -0.257 0.051 2.999 4.138 7.480 36.907 2 AA_DA4DA5:DT14DT15_DD A 4 ? D 15 ? A 5 ? D 14 ? 1 A DA 5 1_555 D DT 5 1_555 A DT 6 1_555 D DA 4 1_555 -0.076 -1.010 3.484 -0.160 -4.840 34.006 -0.887 0.102 3.590 -8.224 0.271 34.339 3 AA_DA5DT6:DA13DT14_DD A 5 ? D 14 ? A 6 ? D 13 ? 1 A DT 6 1_555 D DA 4 1_555 A DT 7 1_555 D DA 3 1_555 0.355 -0.306 3.350 1.375 -2.290 34.064 -0.148 -0.380 3.374 -3.902 -2.343 34.165 4 AA_DT6DT7:DA12DA13_DD A 6 ? D 13 ? A 7 ? D 12 ? 1 A DT 7 1_555 D DA 3 1_555 A DG 8 1_555 D DC 2 1_555 -0.031 -0.584 3.400 0.817 3.199 33.581 -1.542 0.189 3.330 5.520 -1.410 33.738 5 AA_DT7DG8:DC11DA12_DD A 7 ? D 12 ? A 8 ? D 11 ? 1 A DG 8 1_555 D DC 2 1_555 A DC 9 1_555 D DG 1 1_555 -0.489 -0.839 3.258 -9.947 3.521 40.656 -1.540 -0.358 3.206 4.967 14.032 41.946 6 AA_DG8DC9:DG10DC11_DD A 8 ? D 11 ? A 9 ? D 10 ? 1 A DC 9 1_555 D DG 1 1_555 A DT 10 1_555 B DA 5 1_555 -1.030 -0.964 3.229 -1.257 -1.581 24.897 -1.757 2.005 3.330 -3.660 2.910 24.978 7 AA_DC9DT10:DA5DG10_BD A 9 ? D 10 ? A 10 ? B 5 ? 1 A DT 10 1_555 B DA 5 1_555 A DG 11 1_555 B DC 4 1_555 -0.289 0.908 3.087 -3.808 8.115 29.289 0.135 -0.197 3.228 15.594 7.317 30.602 8 AA_DT10DG11:DC4DA5_BB A 10 ? B 5 ? A 11 ? B 4 ? 1 A DG 11 1_555 B DC 4 1_555 A DA 12 1_555 B DT 3 1_555 -0.253 -0.095 3.362 0.371 4.692 38.825 -0.721 0.423 3.326 7.027 -0.556 39.098 9 AA_DG11DA12:DT3DC4_BB A 11 ? B 4 ? A 12 ? B 3 ? 1 A DA 12 1_555 B DT 3 1_555 A DC 13 1_555 B DG 2 1_555 0.896 -0.917 3.305 -2.259 1.279 30.140 -2.014 -2.171 3.191 2.454 4.335 30.249 10 AA_DA12DC13:DG2DT3_BB A 12 ? B 3 ? A 13 ? B 2 ? 1 A DC 13 1_555 B DG 2 1_555 A DG 14 1_555 B DC 1 1_555 -0.347 -1.199 3.352 -2.819 6.294 32.987 -3.090 0.141 3.095 10.936 4.898 33.680 11 AA_DC13DG14:DC1DG2_BB A 13 ? B 2 ? A 14 ? B 1 ? 1 A DG 14 1_555 B DC 1 1_555 A DA 15 1_555 C DT 9 1_555 -1.172 -0.674 3.234 -3.775 -3.711 35.152 -0.553 1.359 3.389 -6.102 6.208 35.536 12 AA_DG14DA15:DT9DC1_CB A 14 ? B 1 ? A 15 ? C 9 ? 1 A DA 15 1_555 C DT 9 1_555 A DC 16 1_555 C DG 8 1_555 0.320 -0.470 3.299 -0.358 3.771 28.936 -1.753 -0.713 3.209 7.506 0.713 29.178 13 AA_DA15DC16:DG8DT9_CC A 15 ? C 9 ? A 16 ? C 8 ? 1 A DC 16 1_555 C DG 8 1_555 A DA 17 1_555 C DT 7 1_555 -0.304 0.107 3.197 -2.564 4.547 37.707 -0.404 0.147 3.201 6.994 3.944 38.054 14 AA_DC16DA17:DT7DG8_CC A 16 ? C 8 ? A 17 ? C 7 ? 1 A DA 17 1_555 C DT 7 1_555 A DC 18 1_555 C DG 6 1_555 0.385 -0.938 3.425 2.612 -0.244 29.323 -1.791 -0.169 3.453 -0.480 -5.147 29.437 15 AA_DA17DC18:DG6DT7_CC A 17 ? C 7 ? A 18 ? C 6 ? 1 A DC 18 1_555 C DG 6 1_555 A DT 19 1_555 C DA 5 1_555 -0.144 -0.524 3.320 1.448 5.906 32.694 -1.904 0.494 3.170 10.380 -2.544 33.240 16 AA_DC18DT19:DA5DG6_CC A 18 ? C 6 ? A 19 ? C 5 ? 1 A DT 19 1_555 C DA 5 1_555 A DC 20 1_555 C DG 4 1_555 0.581 1.004 3.362 1.509 4.471 35.321 0.958 -0.719 3.480 7.329 -2.474 35.625 17 AA_DT19DC20:DG4DA5_CC A 19 ? C 5 ? A 20 ? C 4 ? 1 A DC 20 1_555 C DG 4 1_555 A DA 21 1_555 C DT 3 1_555 -0.235 1.887 3.221 -0.682 -4.529 42.684 3.009 0.256 3.018 -6.200 0.934 42.917 18 AA_DC20DA21:DT3DG4_CC A 20 ? C 4 ? A 21 ? C 3 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Science Foundation (NSF, United States)' 'United States' 1360635 1 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R01GM104960 2 'National Science Foundation (NSF, United States)' 'United States' NSF2004250 3 # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 5 NETROPSIN NT 6 'CACODYLATE ION' CAC 7 water HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 5KEK _pdbx_initial_refinement_model.details ? #