data_8THV # _entry.id 8THV # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.392 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8THV pdb_00008thv 10.2210/pdb8thv/pdb WWPDB D_1000275897 ? ? BMRB 31099 ? 10.13018/BMR31099 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-08-02 2 'Structure model' 1 1 2023-10-25 3 'Structure model' 1 2 2023-11-01 4 'Structure model' 1 3 2024-05-15 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Data collection' 2 2 'Structure model' 'Database references' 3 3 'Structure model' 'Database references' 4 4 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' chem_comp_atom 2 2 'Structure model' chem_comp_bond 3 2 'Structure model' citation 4 2 'Structure model' citation_author 5 3 'Structure model' citation 6 4 'Structure model' database_2 # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_abbrev' 2 2 'Structure model' '_citation.journal_id_CSD' 3 2 'Structure model' '_citation.journal_id_ISSN' 4 2 'Structure model' '_citation.pdbx_database_id_DOI' 5 2 'Structure model' '_citation.pdbx_database_id_PubMed' 6 2 'Structure model' '_citation.title' 7 2 'Structure model' '_citation.year' 8 2 'Structure model' '_citation_author.identifier_ORCID' 9 3 'Structure model' '_citation.journal_volume' 10 3 'Structure model' '_citation.page_first' 11 3 'Structure model' '_citation.page_last' 12 4 'Structure model' '_database_2.pdbx_DOI' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr . _pdbx_database_status.entry_id 8THV _pdbx_database_status.recvd_initial_deposition_date 2023-07-18 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs . _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name BMRB _pdbx_database_related.details 'FARFAR-NMR ensemble of HIV-1 TAR with apical loop capturing ground and excited conformational states' _pdbx_database_related.db_id 31099 _pdbx_database_related.content_type unspecified # _pdbx_contact_author.id 2 _pdbx_contact_author.email ha2639@cumc.columbia.edu _pdbx_contact_author.name_first Hashim _pdbx_contact_author.name_last Al-Hashimi _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0003-0681-1747 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Roy, R.' 1 0000-0001-8569-3245 'Geng, A.' 2 ? 'Shi, H.' 3 ? 'Merriman, D.K.' 4 ? 'Dethoff, E.A.' 5 ? 'Salmon, L.' 6 ? 'Al-Hashimi, H.M.' 7 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev J.Am.Chem.Soc. _citation.journal_id_ASTM JACSAT _citation.journal_id_CSD ? _citation.journal_id_ISSN 1520-5126 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 145 _citation.language ? _citation.page_first 22964 _citation.page_last 22978 _citation.title 'Kinetic Resolution of the Atomic 3D Structures Formed by Ground and Excited Conformational States in an RNA Dynamic Ensemble.' _citation.year 2023 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1021/jacs.3c04614 _citation.pdbx_database_id_PubMed 37831584 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Roy, R.' 1 0000-0001-8569-3245 primary 'Geng, A.' 2 ? primary 'Shi, H.' 3 ? primary 'Merriman, D.K.' 4 ? primary 'Dethoff, E.A.' 5 ? primary 'Salmon, L.' 6 0000-0002-0249-6279 primary 'Al-Hashimi, H.M.' 7 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (29-MER)' _entity.formula_weight 9307.555 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCAGAUCUGAGCCUGGGAGCUCUCUGCC _entity_poly.pdbx_seq_one_letter_code_can GGCAGAUCUGAGCCUGGGAGCUCUCUGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 A n 1 5 G n 1 6 A n 1 7 U n 1 8 C n 1 9 U n 1 10 G n 1 11 A n 1 12 G n 1 13 C n 1 14 C n 1 15 U n 1 16 G n 1 17 G n 1 18 G n 1 19 A n 1 20 G n 1 21 C n 1 22 U n 1 23 C n 1 24 U n 1 25 C n 1 26 U n 1 27 G n 1 28 C n 1 29 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 29 _pdbx_entity_src_syn.organism_scientific 'Human immunodeficiency virus 1' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 11676 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 17 17 G G A . n A 1 2 G 2 18 18 G G A . n A 1 3 C 3 19 19 C C A . n A 1 4 A 4 20 20 A A A . n A 1 5 G 5 21 21 G G A . n A 1 6 A 6 22 22 A A A . n A 1 7 U 7 23 23 U U A . n A 1 8 C 8 24 24 C C A . n A 1 9 U 9 25 25 U U A . n A 1 10 G 10 26 26 G G A . n A 1 11 A 11 27 27 A A A . n A 1 12 G 12 28 28 G G A . n A 1 13 C 13 29 29 C C A . n A 1 14 C 14 30 30 C C A . n A 1 15 U 15 31 31 U U A . n A 1 16 G 16 32 32 G G A . n A 1 17 G 17 33 33 G G A . n A 1 18 G 18 34 34 G G A . n A 1 19 A 19 35 35 A A A . n A 1 20 G 20 36 36 G G A . n A 1 21 C 21 37 37 C C A . n A 1 22 U 22 38 38 U U A . n A 1 23 C 23 39 39 C C A . n A 1 24 U 24 40 40 U U A . n A 1 25 C 25 41 41 C C A . n A 1 26 U 26 42 42 U U A . n A 1 27 G 27 43 43 G G A . n A 1 28 C 28 44 44 C C A . n A 1 29 C 29 45 45 C C A . n # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 2 2 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 3 3 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 4 4 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 5 5 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 6 6 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 7 7 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 8 8 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 9 9 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 10 10 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 11 11 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 12 12 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 13 13 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 14 14 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 15 15 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 16 16 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 17 17 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 18 18 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 19 19 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" 20 20 Y 1 A G 17 ? "O5'" ? A G 1 "O5'" # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8THV _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 8THV _struct.title 'FARFAR-NMR ensemble of HIV-1 TAR with apical loop capturing ground and excited conformational states' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8THV _struct_keywords.text 'Viral RNA, HIV-1 TAR, Excited Conformational States, RNA' _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8THV _struct_ref.pdbx_db_accession 8THV _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8THV _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 29 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 8THV _struct_ref_seq.db_align_beg 17 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 45 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 17 _struct_ref_seq.pdbx_auth_seq_align_end 45 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'NMR Distance Restraints' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 29 N3 ? ? A G 17 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 29 O2 ? ? A G 17 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 29 N4 ? ? A G 17 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 28 N3 ? ? A G 18 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 28 O2 ? ? A G 18 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 28 N4 ? ? A G 18 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 19 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 19 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 19 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 26 N3 ? ? A A 20 A U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 26 O4 ? ? A A 20 A U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 25 N3 ? ? A G 21 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 25 O2 ? ? A G 21 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 25 N4 ? ? A G 21 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 19 N3 ? ? A U 23 A A 35 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog16 hydrog ? ? A U 9 O4 ? ? ? 1_555 A U 24 N3 ? ? A U 25 A U 40 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog17 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 26 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 26 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 26 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A A 11 N1 ? ? ? 1_555 A U 22 N3 ? ? A A 27 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A A 11 N6 ? ? ? 1_555 A U 22 O4 ? ? A A 27 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 28 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 28 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 28 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 20 N1 ? ? A C 29 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 20 O6 ? ? A C 29 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 29 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 18 N1 ? ? A C 30 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 18 O6 ? ? A C 30 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 18 N2 ? ? A C 30 A G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 2 "O2'" A G 34 ? ? OP1 A A 35 ? ? 1.60 2 4 "O2'" A C 24 ? ? OP2 A U 25 ? ? 1.71 3 7 H61 A A 22 ? ? O4 A U 40 ? ? 1.60 4 7 "O2'" A C 30 ? ? OP2 A U 31 ? ? 1.61 5 14 "O2'" A C 24 ? ? OP1 A U 25 ? ? 1.79 6 16 "O2'" A A 22 ? ? OP1 A C 24 ? ? 2.18 7 18 "HO2'" A G 34 ? ? OP2 A A 35 ? ? 1.29 8 18 "O2'" A G 34 ? ? OP2 A A 35 ? ? 1.69 9 19 "H4'" A U 23 ? ? OP2 A C 24 ? ? 1.58 # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 9 C6 A A 20 ? ? N1 A A 20 ? ? 1.308 1.351 -0.043 0.007 N 2 9 C6 A A 22 ? ? N1 A A 22 ? ? 1.309 1.351 -0.042 0.007 N 3 9 C6 A A 35 ? ? N1 A A 35 ? ? 1.308 1.351 -0.043 0.007 N 4 18 "O3'" A G 34 ? ? P A A 35 ? ? 1.524 1.607 -0.083 0.012 Y # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C3'" A A 22 ? ? "O3'" A A 22 ? ? P A U 23 ? ? 131.20 119.70 11.50 1.20 Y 2 8 "C5'" A A 22 ? ? "C4'" A A 22 ? ? "O4'" A A 22 ? ? 115.22 109.80 5.42 0.90 N 3 9 OP1 A C 19 ? ? P A C 19 ? ? OP2 A C 19 ? ? 110.51 119.60 -9.09 1.50 N 4 9 "O4'" A C 19 ? ? "C1'" A C 19 ? ? N1 A C 19 ? ? 112.72 108.50 4.22 0.70 N 5 9 OP1 A A 20 ? ? P A A 20 ? ? OP2 A A 20 ? ? 110.42 119.60 -9.18 1.50 N 6 9 OP1 A G 21 ? ? P A G 21 ? ? OP2 A G 21 ? ? 110.19 119.60 -9.41 1.50 N 7 9 C2 A G 21 ? ? N3 A G 21 ? ? C4 A G 21 ? ? 114.94 111.90 3.04 0.50 N 8 9 OP1 A A 22 ? ? P A A 22 ? ? OP2 A A 22 ? ? 110.44 119.60 -9.16 1.50 N 9 9 OP1 A C 24 ? ? P A C 24 ? ? OP2 A C 24 ? ? 107.36 119.60 -12.24 1.50 N 10 9 "O4'" A U 25 ? ? "C1'" A U 25 ? ? N1 A U 25 ? ? 113.01 108.50 4.51 0.70 N 11 9 OP1 A G 26 ? ? P A G 26 ? ? OP2 A G 26 ? ? 110.20 119.60 -9.40 1.50 N 12 9 OP1 A A 27 ? ? P A A 27 ? ? OP2 A A 27 ? ? 110.06 119.60 -9.54 1.50 N 13 9 OP1 A G 28 ? ? P A G 28 ? ? OP2 A G 28 ? ? 110.13 119.60 -9.47 1.50 N 14 9 OP1 A C 29 ? ? P A C 29 ? ? OP2 A C 29 ? ? 110.10 119.60 -9.50 1.50 N 15 9 OP1 A C 30 ? ? P A C 30 ? ? OP2 A C 30 ? ? 110.13 119.60 -9.47 1.50 N 16 9 OP1 A U 31 ? ? P A U 31 ? ? OP2 A U 31 ? ? 109.85 119.60 -9.75 1.50 N 17 9 OP1 A G 34 ? ? P A G 34 ? ? OP2 A G 34 ? ? 110.01 119.60 -9.59 1.50 N 18 9 OP1 A A 35 ? ? P A A 35 ? ? OP2 A A 35 ? ? 108.32 119.60 -11.28 1.50 N 19 9 OP1 A G 36 ? ? P A G 36 ? ? OP2 A G 36 ? ? 109.57 119.60 -10.03 1.50 N 20 9 OP1 A C 37 ? ? P A C 37 ? ? OP2 A C 37 ? ? 110.55 119.60 -9.05 1.50 N 21 9 OP1 A U 38 ? ? P A U 38 ? ? OP2 A U 38 ? ? 110.48 119.60 -9.12 1.50 N 22 9 OP1 A C 39 ? ? P A C 39 ? ? OP2 A C 39 ? ? 110.42 119.60 -9.18 1.50 N 23 9 "O4'" A C 39 ? ? "C1'" A C 39 ? ? N1 A C 39 ? ? 112.90 108.50 4.40 0.70 N 24 9 OP1 A U 40 ? ? P A U 40 ? ? OP2 A U 40 ? ? 110.29 119.60 -9.31 1.50 N 25 9 "O4'" A U 40 ? ? "C1'" A U 40 ? ? N1 A U 40 ? ? 112.99 108.50 4.49 0.70 N 26 9 OP1 A C 41 ? ? P A C 41 ? ? OP2 A C 41 ? ? 108.78 119.60 -10.82 1.50 N 27 9 OP1 A U 42 ? ? P A U 42 ? ? OP2 A U 42 ? ? 110.31 119.60 -9.29 1.50 N 28 9 OP1 A G 43 ? ? P A G 43 ? ? OP2 A G 43 ? ? 110.13 119.60 -9.47 1.50 N 29 9 OP1 A C 44 ? ? P A C 44 ? ? OP2 A C 44 ? ? 110.09 119.60 -9.51 1.50 N 30 9 "O4'" A C 44 ? ? "C1'" A C 44 ? ? N1 A C 44 ? ? 112.71 108.50 4.21 0.70 N 31 9 OP1 A C 45 ? ? P A C 45 ? ? OP2 A C 45 ? ? 110.05 119.60 -9.55 1.50 N # _pdbx_nmr_ensemble.entry_id 8THV _pdbx_nmr_ensemble.conformers_calculated_total_number 20 _pdbx_nmr_ensemble.conformers_submitted_total_number 20 _pdbx_nmr_ensemble.conformer_selection_criteria 'target function' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 8THV _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'target function' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 '1.0 mM 13C, 15N E0_wt_TAR RNA (29-MER), 90% H2O/10% D2O' '90% H2O/10% D2O' E0_wt_TAR solution ? 2 '1.0 mM 13C, 15N EI22_wt_TAR RNA (29-MER), 90% H2O/10% D2O' '90% H2O/10% D2O' EI22_wt_TAR solution ? 3 '1.0 mM 13C, 15N EII3_wt_TAR RNA (29-MER), 90% H2O/10% D2O' '90% H2O/10% D2O' EII3_wt_TAR solution ? 4 '1.0 mM 13C, 15N EII13_wt_TAR RNA (29-MER), 90% H2O/10% D2O' '90% H2O/10% D2O' EII13_wt_TAR solution ? # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 'E0_wt_TAR RNA (29-MER)' 1.0 ? mM '13C, 15N' 2 'EI22_wt_TAR RNA (29-MER)' 1.0 ? mM '13C, 15N' 3 'EII3_wt_TAR RNA (29-MER)' 1.0 ? mM '13C, 15N' 4 'EII13_wt_TAR RNA (29-MER)' 1.0 ? mM '13C, 15N' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 6.4 _pdbx_nmr_exptl_sample_conditions.ionic_strength 25 _pdbx_nmr_exptl_sample_conditions.details ;15 mM Na3PO4, 25 mM NaCl, 0.1 mM EDTA, 10% D2O ; _pdbx_nmr_exptl_sample_conditions.ionic_strength_err ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_units mM _pdbx_nmr_exptl_sample_conditions.label 'wt-TAR in NMR buffer' _pdbx_nmr_exptl_sample_conditions.pH_err ? _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.pressure_err ? _pdbx_nmr_exptl_sample_conditions.temperature_err ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 13C-1H S3CT HSQC' 1 isotropic 2 1 1 '2D 13C-1H S3CT HSQC' 1 anisotropic 3 1 2 '2D 13C-1H S3CT HSQC' 2 isotropic 4 1 2 '2D 13C-1H S3CT HSQC' 2 anisotropic 5 1 3 '2D 13C-1H S3CT HSQC' 3 isotropic 6 1 3 '2D 13C-1H S3CT HSQC' 3 anisotropic 17 1 4 '2D 13C-1H S3CT HSQC' 1 isotropic 16 1 4 '2D 13C-1H S3CT HSQC' 1 anisotropic 15 1 1 '2D 13C-1H TROSY HSQC' 1 isotropic 14 1 1 '2D 13C-1H TROSY HSQC' 1 anisotropic 13 1 2 '2D 13C-1H TROSY HSQC' 2 isotropic 12 1 2 '2D 13C-1H TROSY HSQC' 2 anisotropic 11 1 3 '2D 13C-1H TROSY HSQC' 3 isotropic 10 1 3 '2D 13C-1H TROSY HSQC' 3 anisotropic 9 1 4 '2D 13C-1H TROSY HSQC' 1 isotropic 8 1 4 '2D 13C-1H TROSY HSQC' 1 anisotropic 18 1 1 '2D 1H-1H NOESY' 1 isotropic # _pdbx_nmr_refine.entry_id 8THV _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details FARFAR-NMR _pdbx_nmr_refine.software_ordinal 2 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 processing NMRPipe ? 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' 2 'structure calculation' Rosetta ? 'Shi et al' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8THV 'double helix' 8THV 'a-form double helix' 8THV 'hairpin loop' 8THV 'bulge loop' 8THV 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 29 1_555 -0.068 -0.160 -0.425 -6.420 -0.622 -3.772 1 A_G17:C45_A A 17 ? A 45 ? 19 1 1 A G 2 1_555 A C 28 1_555 -0.136 -0.136 -0.112 -4.989 -5.512 -1.071 2 A_G18:C44_A A 18 ? A 44 ? 19 1 1 A C 3 1_555 A G 27 1_555 0.156 -0.132 -0.031 -0.494 -1.888 -0.874 3 A_C19:G43_A A 19 ? A 43 ? 19 1 1 A A 4 1_555 A U 26 1_555 0.035 -0.075 -0.156 -3.925 -2.690 -3.803 4 A_A20:U42_A A 20 ? A 42 ? 20 1 1 A G 5 1_555 A C 25 1_555 -0.110 -0.120 -0.123 -5.161 -4.368 -1.624 5 A_G21:C41_A A 21 ? A 41 ? 19 1 1 A U 9 1_555 A U 24 1_555 -2.533 -1.498 -0.391 2.592 -15.063 -13.951 6 A_U25:U40_A A 25 ? A 40 ? ? ? 1 A G 10 1_555 A C 23 1_555 -0.139 -0.139 -0.116 -4.871 -5.029 -0.979 7 A_G26:C39_A A 26 ? A 39 ? 19 1 1 A A 11 1_555 A U 22 1_555 0.014 -0.082 -0.150 -5.138 -2.356 -3.091 8 A_A27:U38_A A 27 ? A 38 ? 20 1 1 A G 12 1_555 A C 21 1_555 -0.108 -0.122 -0.127 -5.416 -4.505 -1.677 9 A_G28:C37_A A 28 ? A 37 ? 19 1 1 A C 13 1_555 A G 20 1_555 0.163 -0.127 -0.045 0.680 -2.839 -1.133 10 A_C29:G36_A A 29 ? A 36 ? 19 1 1 A C 14 1_555 A G 18 1_555 -0.008 -0.167 0.100 -27.850 -9.499 6.156 11 A_C30:G34_A A 30 ? A 34 ? 19 1 1 A U 7 1_555 A A 19 1_555 -2.598 1.564 -0.106 -2.834 36.465 122.918 12 A_U23:A35_A A 23 ? A 35 ? ? 5 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 29 1_555 A G 2 1_555 A C 28 1_555 0.078 -2.043 3.189 -2.014 8.569 31.774 -4.910 -0.445 2.557 15.288 3.593 32.941 1 AA_G17G18:C44C45_AA A 17 ? A 45 ? A 18 ? A 44 ? 1 A G 2 1_555 A C 28 1_555 A C 3 1_555 A G 27 1_555 0.045 -1.747 3.111 -0.079 4.527 33.863 -3.631 -0.088 2.860 7.730 0.135 34.155 2 AA_G18C19:G43C44_AA A 18 ? A 44 ? A 19 ? A 43 ? 1 A C 3 1_555 A G 27 1_555 A A 4 1_555 A U 26 1_555 -0.054 -1.755 3.356 1.392 8.441 30.898 -4.637 0.338 2.787 15.475 -2.551 32.032 3 AA_C19A20:U42G43_AA A 19 ? A 43 ? A 20 ? A 42 ? 1 A A 4 1_555 A U 26 1_555 A G 5 1_555 A C 25 1_555 0.343 -1.717 3.332 -0.141 7.439 31.402 -4.360 -0.641 2.859 13.509 0.256 32.250 4 AA_A20G21:C41U42_AA A 20 ? A 42 ? A 21 ? A 41 ? 1 A G 5 1_555 A C 25 1_555 A U 9 1_555 A U 24 1_555 -5.263 -2.209 3.625 9.090 6.701 60.810 -2.455 5.538 2.658 6.560 -8.898 61.751 5 AA_G21U25:U40C41_AA A 21 ? A 41 ? A 25 ? A 40 ? 1 A U 9 1_555 A U 24 1_555 A G 10 1_555 A C 23 1_555 0.796 -1.584 3.552 -2.809 9.349 41.790 -3.126 -1.377 3.087 12.895 3.875 42.866 6 AA_U25G26:C39U40_AA A 25 ? A 40 ? A 26 ? A 39 ? 1 A G 10 1_555 A C 23 1_555 A A 11 1_555 A U 22 1_555 -0.145 -1.744 3.236 -0.112 7.752 33.207 -4.123 0.231 2.771 13.339 0.192 34.075 7 AA_G26A27:U38C39_AA A 26 ? A 39 ? A 27 ? A 38 ? 1 A A 11 1_555 A U 22 1_555 A G 12 1_555 A C 21 1_555 0.249 -1.734 3.300 0.055 7.026 31.097 -4.377 -0.445 2.850 12.899 -0.101 31.862 8 AA_A27G28:C37U38_AA A 27 ? A 38 ? A 28 ? A 37 ? 1 A G 12 1_555 A C 21 1_555 A C 13 1_555 A G 20 1_555 0.231 -1.635 3.092 -0.109 4.739 33.267 -3.536 -0.415 2.837 8.225 0.189 33.594 9 AA_G28C29:G36C37_AA A 28 ? A 37 ? A 29 ? A 36 ? 1 A C 13 1_555 A G 20 1_555 A C 14 1_555 A G 18 1_555 1.281 -1.250 6.998 9.282 10.240 26.535 -6.989 1.650 6.203 20.627 -18.696 29.862 10 AA_C29C30:G34G36_AA A 29 ? A 36 ? A 30 ? A 34 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R01GM132899 1 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' 'U54 AI150470' 2 # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 AVANCE ? Bruker 600 'HCN cryoprobe' 2 Varian ? Agilent 800 'HCN cryoprobe' 3 Varian ? Agilent 600 'HCN cryoprobe' # _atom_sites.entry_id 8THV _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_