data_8TKK # _entry.id 8TKK # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.402 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8TKK pdb_00008tkk 10.2210/pdb8tkk/pdb WWPDB D_1000275427 ? ? EMDB EMD-41354 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2025-02-19 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8TKK _pdbx_database_status.recvd_initial_deposition_date 2023-07-25 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _pdbx_database_related.db_name _pdbx_database_related.details _pdbx_database_related.db_id _pdbx_database_related.content_type PDB 'crystal structure, with ligand' 8syk unspecified PDB 'cryo-EM structure of the full-length, with ligand' 8t50 unspecified EMDB 'Cryo-EM structure of RNA device 43 truncation mutant 3, apo state' EMD-41354 'associated EM volume' # _pdbx_contact_author.id 2 _pdbx_contact_author.email wangyunx@mail.nih.gov _pdbx_contact_author.name_first Yun-Xing _pdbx_contact_author.name_last Wang _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-2175-0148 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Stagno, J.R.' 1 0000-0002-6464-7829 'Deme, J.C.' 2 0000-0001-8811-9871 'Lee, Y.-T.' 3 0000-0001-8123-6207 'Wang, Y.-X.' 4 0000-0002-2175-0148 'Lea, S.M.' 5 0000-0001-9287-8053 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Cryo-EM structure of RNA device 43 truncation mutant (U100C), apo state' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Stagno, J.R.' 1 0000-0002-6464-7829 primary 'Deme, J.C.' 2 0000-0001-8811-9871 primary 'Lee, Y.-T.' 3 0000-0001-8123-6207 primary 'Wang, Y.-X.' 4 0000-0002-2175-0148 primary 'Lea, S.M.' 5 0000-0001-9287-8053 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA device 43 truncation mutant 3 (U100C)' 34516.688 1 ? ? ? ? 2 non-polymer syn "GUANOSINE-5'-TRIPHOSPHATE" 523.180 1 ? ? ? ? 3 non-polymer syn 'MAGNESIUM ION' 24.305 10 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;CAGGUACAUCCAGCUGAUGAGUCCCAAAUAGGACAAAAAGGGAGAGGUGAAGAAUACGACCACCUAGGCUCGAAAGAGCC UAAAACAUACCCUUCCUGGAUUCCUGC ; _entity_poly.pdbx_seq_one_letter_code_can ;CAGGUACAUCCAGCUGAUGAGUCCCAAAUAGGACAAAAAGGGAGAGGUGAAGAAUACGACCACCUAGGCUCGAAAGAGCC UAAAACAUACCCUUCCUGGAUUCCUGC ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 "GUANOSINE-5'-TRIPHOSPHATE" GTP 3 'MAGNESIUM ION' MG # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 C n 1 2 A n 1 3 G n 1 4 G n 1 5 U n 1 6 A n 1 7 C n 1 8 A n 1 9 U n 1 10 C n 1 11 C n 1 12 A n 1 13 G n 1 14 C n 1 15 U n 1 16 G n 1 17 A n 1 18 U n 1 19 G n 1 20 A n 1 21 G n 1 22 U n 1 23 C n 1 24 C n 1 25 C n 1 26 A n 1 27 A n 1 28 A n 1 29 U n 1 30 A n 1 31 G n 1 32 G n 1 33 A n 1 34 C n 1 35 A n 1 36 A n 1 37 A n 1 38 A n 1 39 A n 1 40 G n 1 41 G n 1 42 G n 1 43 A n 1 44 G n 1 45 A n 1 46 G n 1 47 G n 1 48 U n 1 49 G n 1 50 A n 1 51 A n 1 52 G n 1 53 A n 1 54 A n 1 55 U n 1 56 A n 1 57 C n 1 58 G n 1 59 A n 1 60 C n 1 61 C n 1 62 A n 1 63 C n 1 64 C n 1 65 U n 1 66 A n 1 67 G n 1 68 G n 1 69 C n 1 70 U n 1 71 C n 1 72 G n 1 73 A n 1 74 A n 1 75 A n 1 76 G n 1 77 A n 1 78 G n 1 79 C n 1 80 C n 1 81 U n 1 82 A n 1 83 A n 1 84 A n 1 85 A n 1 86 C n 1 87 A n 1 88 U n 1 89 A n 1 90 C n 1 91 C n 1 92 C n 1 93 U n 1 94 U n 1 95 C n 1 96 C n 1 97 U n 1 98 G n 1 99 G n 1 100 A n 1 101 U n 1 102 U n 1 103 C n 1 104 C n 1 105 U n 1 106 G n 1 107 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 107 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 C 1 9 9 C C A . n A 1 2 A 2 10 10 A A A . n A 1 3 G 3 11 11 G G A . n A 1 4 G 4 12 12 G G A . n A 1 5 U 5 13 13 U U A . n A 1 6 A 6 14 14 A A A . n A 1 7 C 7 15 15 C C A . n A 1 8 A 8 16 16 A A A . n A 1 9 U 9 17 17 U U A . n A 1 10 C 10 18 18 C C A . n A 1 11 C 11 19 19 C C A . n A 1 12 A 12 20 20 A A A . n A 1 13 G 13 21 21 G G A . n A 1 14 C 14 22 22 C C A . n A 1 15 U 15 23 23 U U A . n A 1 16 G 16 24 24 G G A . n A 1 17 A 17 25 25 A A A . n A 1 18 U 18 26 26 U U A . n A 1 19 G 19 27 27 G G A . n A 1 20 A 20 28 28 A A A . n A 1 21 G 21 29 29 G G A . n A 1 22 U 22 30 30 U U A . n A 1 23 C 23 31 31 C C A . n A 1 24 C 24 32 32 C C A . n A 1 25 C 25 33 33 C C A . n A 1 26 A 26 34 34 A A A . n A 1 27 A 27 35 35 A A A . n A 1 28 A 28 36 36 A A A . n A 1 29 U 29 37 37 U U A . n A 1 30 A 30 38 38 A A A . n A 1 31 G 31 39 39 G G A . n A 1 32 G 32 40 40 G G A . n A 1 33 A 33 41 41 A A A . n A 1 34 C 34 42 42 C C A . n A 1 35 A 35 43 43 A A A . n A 1 36 A 36 44 44 A A A . n A 1 37 A 37 45 45 A A A . n A 1 38 A 38 46 46 A A A . n A 1 39 A 39 47 47 A A A . n A 1 40 G 40 48 48 G G A . n A 1 41 G 41 49 49 G G A . n A 1 42 G 42 50 50 G G A . n A 1 43 A 43 51 51 A A A . n A 1 44 G 44 52 52 G G A . n A 1 45 A 45 53 53 A A A . n A 1 46 G 46 54 54 G G A . n A 1 47 G 47 55 55 G G A . n A 1 48 U 48 56 56 U U A . n A 1 49 G 49 57 57 G G A . n A 1 50 A 50 58 58 A A A . n A 1 51 A 51 59 59 A A A . n A 1 52 G 52 60 60 G G A . n A 1 53 A 53 61 61 A A A . n A 1 54 A 54 62 62 A A A . n A 1 55 U 55 63 63 U U A . n A 1 56 A 56 64 64 A A A . n A 1 57 C 57 65 65 C C A . n A 1 58 G 58 66 66 G G A . n A 1 59 A 59 67 67 A A A . n A 1 60 C 60 68 68 C C A . n A 1 61 C 61 69 69 C C A . n A 1 62 A 62 70 70 A A A . n A 1 63 C 63 71 71 C C A . n A 1 64 C 64 72 72 C C A . n A 1 65 U 65 73 73 U U A . n A 1 66 A 66 74 74 A A A . n A 1 67 G 67 75 75 G G A . n A 1 68 G 68 76 76 G G A . n A 1 69 C 69 77 77 C C A . n A 1 70 U 70 78 78 U U A . n A 1 71 C 71 79 79 C C A . n A 1 72 G 72 80 80 G G A . n A 1 73 A 73 81 81 A A A . n A 1 74 A 74 82 82 A A A . n A 1 75 A 75 83 83 A A A . n A 1 76 G 76 84 84 G G A . n A 1 77 A 77 85 85 A A A . n A 1 78 G 78 86 86 G G A . n A 1 79 C 79 87 87 C C A . n A 1 80 C 80 88 88 C C A . n A 1 81 U 81 89 89 U U A . n A 1 82 A 82 90 90 A A A . n A 1 83 A 83 91 91 A A A . n A 1 84 A 84 92 92 A A A . n A 1 85 A 85 93 93 A A A . n A 1 86 C 86 94 94 C C A . n A 1 87 A 87 95 95 A A A . n A 1 88 U 88 96 96 U U A . n A 1 89 A 89 97 97 A A A . n A 1 90 C 90 98 98 C C A . n A 1 91 C 91 99 99 C C A . n A 1 92 C 92 100 100 C C A . n A 1 93 U 93 101 101 U U A . n A 1 94 U 94 102 102 U U A . n A 1 95 C 95 103 103 C C A . n A 1 96 C 96 104 104 C C A . n A 1 97 U 97 105 105 U U A . n A 1 98 G 98 106 106 G G A . n A 1 99 G 99 107 107 G G A . n A 1 100 A 100 108 108 A A A . n A 1 101 U 101 109 109 U U A . n A 1 102 U 102 110 110 U U A . n A 1 103 C 103 111 111 C C A . n A 1 104 C 104 112 112 C C A . n A 1 105 U 105 113 113 U U A . n A 1 106 G 106 114 114 G G A . n A 1 107 C 107 115 115 C C A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 GTP 1 201 8 GTP GTP A . C 3 MG 1 202 1 MG MG A . D 3 MG 1 203 3 MG MG A . E 3 MG 1 204 4 MG MG A . F 3 MG 1 205 5 MG MG A . G 3 MG 1 206 6 MG MG A . H 3 MG 1 207 7 MG MG A . I 3 MG 1 208 8 MG MG A . J 3 MG 1 209 9 MG MG A . K 3 MG 1 210 10 MG MG A . L 3 MG 1 211 11 MG MG A . # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 8TKK _cell.details ? _cell.formula_units_Z ? _cell.length_a 1.00 _cell.length_a_esd ? _cell.length_b 1.00 _cell.length_b_esd ? _cell.length_c 1.00 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB ? _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8TKK _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8TKK _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _refine.pdbx_refine_id 'ELECTRON MICROSCOPY' _refine.entry_id 8TKK _refine.pdbx_diffrn_id ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.ls_number_reflns_obs ? _refine.ls_number_reflns_all ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.ls_d_res_low ? _refine.ls_d_res_high . _refine.ls_percent_reflns_obs ? _refine.ls_R_factor_obs ? _refine.ls_R_factor_all ? _refine.ls_R_factor_R_work ? _refine.ls_R_factor_R_free ? _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_percent_reflns_R_free ? _refine.ls_number_reflns_R_free ? _refine.ls_number_parameters ? _refine.ls_number_restraints ? _refine.occupancy_min ? _refine.occupancy_max ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.B_iso_mean ? _refine.aniso_B[1][1] ? _refine.aniso_B[2][2] ? _refine.aniso_B[3][3] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][3] ? _refine.solvent_model_details ? _refine.solvent_model_param_ksol ? _refine.solvent_model_param_bsol ? _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_ls_cross_valid_method ? _refine.details ? _refine.pdbx_starting_model ? _refine.pdbx_method_to_determine_struct ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_stereochemistry_target_values ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_R_Free_selection_details ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.overall_SU_ML ? _refine.pdbx_overall_phase_error ? _refine.overall_SU_B ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'ELECTRON MICROSCOPY' ? 0.002 ? 2598 ? f_bond_d ? ? 'ELECTRON MICROSCOPY' ? 0.322 ? 4048 ? f_angle_d ? ? 'ELECTRON MICROSCOPY' ? 16.287 ? 1295 ? f_dihedral_angle_d ? ? 'ELECTRON MICROSCOPY' ? 0.014 ? 539 ? f_chiral_restr ? ? 'ELECTRON MICROSCOPY' ? 0.001 ? 108 ? f_plane_restr ? ? # _struct.entry_id 8TKK _struct.title 'Cryo-EM structure of RNA device 43 truncation mutant 3 (U100C), apo state' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8TKK _struct_keywords.text 'RNA device, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 3 ? E N N 3 ? F N N 3 ? G N N 3 ? H N N 3 ? I N N 3 ? J N N 3 ? K N N 3 ? L N N 3 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8TKK _struct_ref.pdbx_db_accession 8TKK _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8TKK _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 107 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 8TKK _struct_ref_seq.db_align_beg 9 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 115 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 9 _struct_ref_seq.pdbx_auth_seq_align_end 115 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J,K,L # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'electron microscopy' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0 _pdbx_struct_oper_list.matrix[1][2] 0.0 _pdbx_struct_oper_list.matrix[1][3] 0.0 _pdbx_struct_oper_list.vector[1] 0.0 _pdbx_struct_oper_list.matrix[2][1] 0.0 _pdbx_struct_oper_list.matrix[2][2] 1.0 _pdbx_struct_oper_list.matrix[2][3] 0.0 _pdbx_struct_oper_list.vector[2] 0.0 _pdbx_struct_oper_list.matrix[3][1] 0.0 _pdbx_struct_oper_list.matrix[3][2] 0.0 _pdbx_struct_oper_list.matrix[3][3] 1.0 _pdbx_struct_oper_list.vector[3] 0.0 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A C 1 P ? ? ? 1_555 B GTP . "O3'" ? ? A C 9 A GTP 201 1_555 ? ? ? ? ? ? ? 1.607 ? ? metalc1 metalc ? ? A A 45 OP1 ? ? ? 1_555 K MG . MG ? ? A A 53 A MG 210 1_555 ? ? ? ? ? ? ? 2.004 ? ? metalc2 metalc ? ? A G 46 OP2 ? ? ? 1_555 K MG . MG ? ? A G 54 A MG 210 1_555 ? ? ? ? ? ? ? 2.677 ? ? hydrog1 hydrog ? ? A C 1 N3 ? ? ? 1_555 A G 106 N1 ? ? A C 9 A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A C 1 N4 ? ? ? 1_555 A G 106 O6 ? ? A C 9 A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A C 1 O2 ? ? ? 1_555 A G 106 N2 ? ? A C 9 A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A A 2 N1 ? ? ? 1_555 A U 105 N3 ? ? A A 10 A U 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A A 2 N6 ? ? ? 1_555 A U 105 O4 ? ? A A 10 A U 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 104 N3 ? ? A G 11 A C 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 104 O2 ? ? A G 11 A C 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 104 N4 ? ? A G 11 A C 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 103 N3 ? ? A G 12 A C 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 103 O2 ? ? A G 12 A C 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 103 N4 ? ? A G 12 A C 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 27 N7 ? ? A U 13 A A 35 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog13 hydrog ? ? A C 7 N4 ? ? ? 1_555 A C 25 O2 ? ? A C 15 A C 33 1_555 ? ? ? ? ? ? TYPE_15_PAIR ? ? ? hydrog14 hydrog ? ? A C 7 O2 ? ? ? 1_555 A C 25 N4 ? ? A C 15 A C 33 1_555 ? ? ? ? ? ? TYPE_15_PAIR ? ? ? hydrog15 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 101 N3 ? ? A A 16 A U 109 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 101 O4 ? ? A A 16 A U 109 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 100 N1 ? ? A U 17 A A 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 9 O4 ? ? ? 1_555 A A 100 N6 ? ? A U 17 A A 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 99 N1 ? ? A C 18 A G 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 99 O6 ? ? A C 18 A G 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 99 N2 ? ? A C 18 A G 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 98 O6 ? ? A C 19 A G 106 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog23 hydrog ? ? A A 12 N1 ? ? ? 1_555 A U 97 N3 ? ? A A 20 A U 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A A 12 N6 ? ? ? 1_555 A U 97 O4 ? ? A A 20 A U 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 13 N1 ? ? ? 1_555 A C 96 N3 ? ? A G 21 A C 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 13 N2 ? ? ? 1_555 A C 96 O2 ? ? A G 21 A C 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 13 O6 ? ? ? 1_555 A C 96 N4 ? ? A G 21 A C 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 22 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 22 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 22 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 16 N2 ? ? ? 1_555 A A 37 N1 ? ? A G 24 A A 45 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog32 hydrog ? ? A A 20 N6 ? ? ? 1_555 A A 35 N3 ? ? A A 28 A A 43 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog33 hydrog ? ? A G 21 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 29 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 21 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 29 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 21 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 29 A C 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 33 N1 ? ? A U 30 A A 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 33 N6 ? ? A U 30 A A 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 23 N3 ? ? ? 1_555 A G 32 N1 ? ? A C 31 A G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 23 N4 ? ? ? 1_555 A G 32 O6 ? ? A C 31 A G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 23 O2 ? ? ? 1_555 A G 32 N2 ? ? A C 31 A G 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 24 N3 ? ? ? 1_555 A G 31 N1 ? ? A C 32 A G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 24 N4 ? ? ? 1_555 A G 31 O6 ? ? A C 32 A G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 31 N2 ? ? A C 32 A G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 25 N3 ? ? ? 1_555 A G 31 N1 ? ? A C 33 A G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 25 N4 ? ? ? 1_555 A G 31 O6 ? ? A C 33 A G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 25 O2 ? ? ? 1_555 A G 31 N2 ? ? A C 33 A G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A A 30 N6 ? ? ? 1_555 A U 102 O2 ? ? A A 38 A U 110 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog48 hydrog ? ? A A 30 N7 ? ? ? 1_555 A U 102 N3 ? ? A A 38 A U 110 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog49 hydrog ? ? A A 36 N6 ? ? ? 1_555 A C 95 O2 ? ? A A 44 A C 103 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog50 hydrog ? ? A A 38 N1 ? ? ? 1_555 A U 94 N3 ? ? A A 46 A U 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A A 38 N6 ? ? ? 1_555 A U 94 O4 ? ? A A 46 A U 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A A 39 N1 ? ? ? 1_555 A U 93 N3 ? ? A A 47 A U 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A A 39 N6 ? ? ? 1_555 A U 93 O4 ? ? A A 47 A U 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 40 N1 ? ? ? 1_555 A C 92 N3 ? ? A G 48 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 40 N2 ? ? ? 1_555 A C 92 O2 ? ? A G 48 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 40 O6 ? ? ? 1_555 A C 92 N4 ? ? A G 48 A C 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A G 41 O6 ? ? ? 1_555 A C 91 N4 ? ? A G 49 A C 99 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog58 hydrog ? ? A G 42 N1 ? ? ? 1_555 A C 90 N3 ? ? A G 50 A C 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 42 N2 ? ? ? 1_555 A C 90 O2 ? ? A G 50 A C 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 42 O6 ? ? ? 1_555 A C 90 N4 ? ? A G 50 A C 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A A 43 N1 ? ? ? 1_555 A A 89 N6 ? ? A A 51 A A 97 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog62 hydrog ? ? A G 44 N1 ? ? ? 1_555 A U 88 O4 ? ? A G 52 A U 96 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog63 hydrog ? ? A A 45 N6 ? ? ? 1_555 A A 85 N7 ? ? A A 53 A A 93 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog64 hydrog ? ? A A 45 N1 ? ? ? 1_555 A C 86 N4 ? ? A A 53 A C 94 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog65 hydrog ? ? A G 46 N1 ? ? ? 1_555 A C 64 N3 ? ? A G 54 A C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 46 N2 ? ? ? 1_555 A C 64 O2 ? ? A G 54 A C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A G 46 O6 ? ? ? 1_555 A C 64 N4 ? ? A G 54 A C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A G 47 N1 ? ? ? 1_555 A C 63 N3 ? ? A G 55 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A G 47 N2 ? ? ? 1_555 A C 63 O2 ? ? A G 55 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A G 47 O6 ? ? ? 1_555 A C 63 N4 ? ? A G 55 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A U 48 N3 ? ? ? 1_555 A A 62 N1 ? ? A U 56 A A 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A U 48 O4 ? ? ? 1_555 A A 62 N6 ? ? A U 56 A A 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A G 49 N1 ? ? ? 1_555 A C 61 N3 ? ? A G 57 A C 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A G 49 N2 ? ? ? 1_555 A C 61 O2 ? ? A G 57 A C 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A G 49 O6 ? ? ? 1_555 A C 61 N4 ? ? A G 57 A C 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A A 50 N1 ? ? ? 1_555 A C 60 N4 ? ? A A 58 A C 68 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog77 hydrog ? ? A A 56 N1 ? ? ? 1_555 A A 85 N6 ? ? A A 64 A A 93 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog78 hydrog ? ? A A 56 N6 ? ? ? 1_555 A A 85 N1 ? ? A A 64 A A 93 1_555 ? ? ? ? ? ? TYPE_1_PAIR ? ? ? hydrog79 hydrog ? ? A C 57 N4 ? ? ? 1_555 A C 86 O2 ? ? A C 65 A C 94 1_555 ? ? ? ? ? ? TYPE_15_PAIR ? ? ? hydrog80 hydrog ? ? A C 57 O2 ? ? ? 1_555 A C 86 N4 ? ? A C 65 A C 94 1_555 ? ? ? ? ? ? TYPE_15_PAIR ? ? ? hydrog81 hydrog ? ? A G 58 O6 ? ? ? 1_555 A A 87 N6 ? ? A G 66 A A 95 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog82 hydrog ? ? A U 65 N3 ? ? ? 1_555 A A 82 N1 ? ? A U 73 A A 90 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog83 hydrog ? ? A A 66 N1 ? ? ? 1_555 A U 81 N3 ? ? A A 74 A U 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A A 66 N6 ? ? ? 1_555 A U 81 O4 ? ? A A 74 A U 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A G 67 N1 ? ? ? 1_555 A C 80 N3 ? ? A G 75 A C 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A G 67 N2 ? ? ? 1_555 A C 80 O2 ? ? A G 75 A C 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A G 67 O6 ? ? ? 1_555 A C 80 N4 ? ? A G 75 A C 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A G 68 N1 ? ? ? 1_555 A C 79 N3 ? ? A G 76 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A G 68 N2 ? ? ? 1_555 A C 79 O2 ? ? A G 76 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A G 68 O6 ? ? ? 1_555 A C 79 N4 ? ? A G 76 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A C 69 N3 ? ? ? 1_555 A G 78 N1 ? ? A C 77 A G 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A C 69 N4 ? ? ? 1_555 A G 78 O6 ? ? A C 77 A G 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A C 69 O2 ? ? ? 1_555 A G 78 N2 ? ? A C 77 A G 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? A U 70 N3 ? ? ? 1_555 A A 77 N1 ? ? A U 78 A A 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A U 70 O4 ? ? ? 1_555 A A 77 N6 ? ? A U 78 A A 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A C 71 O2 ? ? ? 1_555 A G 76 N2 ? ? A C 79 A G 84 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog97 hydrog ? ? A G 72 N2 ? ? ? 1_555 A A 75 N7 ? ? A G 80 A A 83 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # _pdbx_struct_conn_angle.id 1 _pdbx_struct_conn_angle.ptnr1_label_atom_id OP1 _pdbx_struct_conn_angle.ptnr1_label_alt_id ? _pdbx_struct_conn_angle.ptnr1_label_asym_id A _pdbx_struct_conn_angle.ptnr1_label_comp_id A _pdbx_struct_conn_angle.ptnr1_label_seq_id 45 _pdbx_struct_conn_angle.ptnr1_auth_atom_id ? _pdbx_struct_conn_angle.ptnr1_auth_asym_id A _pdbx_struct_conn_angle.ptnr1_auth_comp_id A _pdbx_struct_conn_angle.ptnr1_auth_seq_id 53 _pdbx_struct_conn_angle.ptnr1_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr1_symmetry 1_555 _pdbx_struct_conn_angle.ptnr2_label_atom_id MG _pdbx_struct_conn_angle.ptnr2_label_alt_id ? _pdbx_struct_conn_angle.ptnr2_label_asym_id K _pdbx_struct_conn_angle.ptnr2_label_comp_id MG _pdbx_struct_conn_angle.ptnr2_label_seq_id . _pdbx_struct_conn_angle.ptnr2_auth_atom_id ? _pdbx_struct_conn_angle.ptnr2_auth_asym_id A _pdbx_struct_conn_angle.ptnr2_auth_comp_id MG _pdbx_struct_conn_angle.ptnr2_auth_seq_id 210 _pdbx_struct_conn_angle.ptnr2_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr2_symmetry 1_555 _pdbx_struct_conn_angle.ptnr3_label_atom_id OP2 _pdbx_struct_conn_angle.ptnr3_label_alt_id ? _pdbx_struct_conn_angle.ptnr3_label_asym_id A _pdbx_struct_conn_angle.ptnr3_label_comp_id G _pdbx_struct_conn_angle.ptnr3_label_seq_id 46 _pdbx_struct_conn_angle.ptnr3_auth_atom_id ? _pdbx_struct_conn_angle.ptnr3_auth_asym_id A _pdbx_struct_conn_angle.ptnr3_auth_comp_id G _pdbx_struct_conn_angle.ptnr3_auth_seq_id 54 _pdbx_struct_conn_angle.ptnr3_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr3_symmetry 1_555 _pdbx_struct_conn_angle.value 76.2 _pdbx_struct_conn_angle.value_esd ? # _pdbx_entry_details.entry_id 8TKK _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.has_protein_modification N # _space_group_symop.id 1 _space_group_symop.operation_xyz x,y,z # _em_3d_fitting.id 1 _em_3d_fitting.entry_id 8TKK _em_3d_fitting.method ? _em_3d_fitting.target_criteria ? _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_space ? _em_3d_fitting.ref_protocol ? # _em_3d_reconstruction.entry_id 8TKK _em_3d_reconstruction.id 1 _em_3d_reconstruction.method ? _em_3d_reconstruction.algorithm ? _em_3d_reconstruction.citation_id ? _em_3d_reconstruction.details ? _em_3d_reconstruction.resolution 3.37 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.magnification_calibration ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.num_particles 404781 _em_3d_reconstruction.euler_angles_details ? _em_3d_reconstruction.num_class_averages ? _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.symmetry_type POINT # _em_buffer.id 1 _em_buffer.specimen_id 1 _em_buffer.name ? _em_buffer.details ? _em_buffer.pH 6.8 # _em_entity_assembly.id 1 _em_entity_assembly.parent_id 0 _em_entity_assembly.source RECOMBINANT _em_entity_assembly.type COMPLEX _em_entity_assembly.name 'Synthetic RNA device containing hammerhead ribozyme and tetracycline-binding aptamer' _em_entity_assembly.details ? _em_entity_assembly.synonym ? _em_entity_assembly.oligomeric_details ? _em_entity_assembly.entity_id_list 1 # _em_imaging.entry_id 8TKK _em_imaging.id 1 _em_imaging.astigmatism ? _em_imaging.electron_beam_tilt_params ? _em_imaging.residual_tilt ? _em_imaging.microscope_model 'TFS KRIOS' _em_imaging.specimen_holder_type ? _em_imaging.specimen_holder_model ? _em_imaging.details ? _em_imaging.date ? _em_imaging.accelerating_voltage 300 _em_imaging.illumination_mode 'FLOOD BEAM' _em_imaging.mode 'BRIGHT FIELD' _em_imaging.nominal_cs ? _em_imaging.nominal_defocus_min 500 _em_imaging.nominal_defocus_max 2000 _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_defocus_max ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.nominal_magnification ? _em_imaging.calibrated_magnification ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.citation_id ? _em_imaging.temperature ? _em_imaging.detector_distance ? _em_imaging.recording_temperature_minimum ? _em_imaging.recording_temperature_maximum ? _em_imaging.alignment_procedure ? _em_imaging.c2_aperture_diameter ? _em_imaging.specimen_id 1 _em_imaging.cryogen ? # _em_sample_support.id 1 _em_sample_support.film_material ? _em_sample_support.method ? _em_sample_support.grid_material ? _em_sample_support.grid_mesh_size ? _em_sample_support.grid_type Quantifoil _em_sample_support.details '30s at 30mA on each side' _em_sample_support.specimen_id 1 _em_sample_support.citation_id ? # _em_vitrification.entry_id 8TKK _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.cryogen_name ETHANE _em_vitrification.humidity 100 _em_vitrification.temp ? _em_vitrification.chamber_temperature 284 _em_vitrification.instrument 'FEI VITROBOT MARK IV' _em_vitrification.method ? _em_vitrification.time_resolved_state ? _em_vitrification.citation_id ? _em_vitrification.details ? # _em_experiment.entry_id 8TKK _em_experiment.id 1 _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.aggregation_state PARTICLE _em_experiment.entity_assembly_id 1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GTP PG P N N 111 GTP O1G O N N 112 GTP O2G O N N 113 GTP O3G O N N 114 GTP O3B O N N 115 GTP PB P N N 116 GTP O1B O N N 117 GTP O2B O N N 118 GTP O3A O N N 119 GTP PA P N N 120 GTP O1A O N N 121 GTP O2A O N N 122 GTP "O5'" O N N 123 GTP "C5'" C N N 124 GTP "C4'" C N R 125 GTP "O4'" O N N 126 GTP "C3'" C N S 127 GTP "O3'" O N N 128 GTP "C2'" C N R 129 GTP "O2'" O N N 130 GTP "C1'" C N R 131 GTP N9 N Y N 132 GTP C8 C Y N 133 GTP N7 N Y N 134 GTP C5 C Y N 135 GTP C6 C N N 136 GTP O6 O N N 137 GTP N1 N N N 138 GTP C2 C N N 139 GTP N2 N N N 140 GTP N3 N N N 141 GTP C4 C Y N 142 GTP HOG2 H N N 143 GTP HOG3 H N N 144 GTP HOB2 H N N 145 GTP HOA2 H N N 146 GTP "H5'" H N N 147 GTP "H5''" H N N 148 GTP "H4'" H N N 149 GTP "H3'" H N N 150 GTP "HO3'" H N N 151 GTP "H2'" H N N 152 GTP "HO2'" H N N 153 GTP "H1'" H N N 154 GTP H8 H N N 155 GTP HN1 H N N 156 GTP HN21 H N N 157 GTP HN22 H N N 158 MG MG MG N N 159 U OP3 O N N 160 U P P N N 161 U OP1 O N N 162 U OP2 O N N 163 U "O5'" O N N 164 U "C5'" C N N 165 U "C4'" C N R 166 U "O4'" O N N 167 U "C3'" C N S 168 U "O3'" O N N 169 U "C2'" C N R 170 U "O2'" O N N 171 U "C1'" C N R 172 U N1 N N N 173 U C2 C N N 174 U O2 O N N 175 U N3 N N N 176 U C4 C N N 177 U O4 O N N 178 U C5 C N N 179 U C6 C N N 180 U HOP3 H N N 181 U HOP2 H N N 182 U "H5'" H N N 183 U "H5''" H N N 184 U "H4'" H N N 185 U "H3'" H N N 186 U "HO3'" H N N 187 U "H2'" H N N 188 U "HO2'" H N N 189 U "H1'" H N N 190 U H3 H N N 191 U H5 H N N 192 U H6 H N N 193 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GTP PG O1G doub N N 116 GTP PG O2G sing N N 117 GTP PG O3G sing N N 118 GTP PG O3B sing N N 119 GTP O2G HOG2 sing N N 120 GTP O3G HOG3 sing N N 121 GTP O3B PB sing N N 122 GTP PB O1B doub N N 123 GTP PB O2B sing N N 124 GTP PB O3A sing N N 125 GTP O2B HOB2 sing N N 126 GTP O3A PA sing N N 127 GTP PA O1A doub N N 128 GTP PA O2A sing N N 129 GTP PA "O5'" sing N N 130 GTP O2A HOA2 sing N N 131 GTP "O5'" "C5'" sing N N 132 GTP "C5'" "C4'" sing N N 133 GTP "C5'" "H5'" sing N N 134 GTP "C5'" "H5''" sing N N 135 GTP "C4'" "O4'" sing N N 136 GTP "C4'" "C3'" sing N N 137 GTP "C4'" "H4'" sing N N 138 GTP "O4'" "C1'" sing N N 139 GTP "C3'" "O3'" sing N N 140 GTP "C3'" "C2'" sing N N 141 GTP "C3'" "H3'" sing N N 142 GTP "O3'" "HO3'" sing N N 143 GTP "C2'" "O2'" sing N N 144 GTP "C2'" "C1'" sing N N 145 GTP "C2'" "H2'" sing N N 146 GTP "O2'" "HO2'" sing N N 147 GTP "C1'" N9 sing N N 148 GTP "C1'" "H1'" sing N N 149 GTP N9 C8 sing Y N 150 GTP N9 C4 sing Y N 151 GTP C8 N7 doub Y N 152 GTP C8 H8 sing N N 153 GTP N7 C5 sing Y N 154 GTP C5 C6 sing N N 155 GTP C5 C4 doub Y N 156 GTP C6 O6 doub N N 157 GTP C6 N1 sing N N 158 GTP N1 C2 sing N N 159 GTP N1 HN1 sing N N 160 GTP C2 N2 sing N N 161 GTP C2 N3 doub N N 162 GTP N2 HN21 sing N N 163 GTP N2 HN22 sing N N 164 GTP N3 C4 sing N N 165 U OP3 P sing N N 166 U OP3 HOP3 sing N N 167 U P OP1 doub N N 168 U P OP2 sing N N 169 U P "O5'" sing N N 170 U OP2 HOP2 sing N N 171 U "O5'" "C5'" sing N N 172 U "C5'" "C4'" sing N N 173 U "C5'" "H5'" sing N N 174 U "C5'" "H5''" sing N N 175 U "C4'" "O4'" sing N N 176 U "C4'" "C3'" sing N N 177 U "C4'" "H4'" sing N N 178 U "O4'" "C1'" sing N N 179 U "C3'" "O3'" sing N N 180 U "C3'" "C2'" sing N N 181 U "C3'" "H3'" sing N N 182 U "O3'" "HO3'" sing N N 183 U "C2'" "O2'" sing N N 184 U "C2'" "C1'" sing N N 185 U "C2'" "H2'" sing N N 186 U "O2'" "HO2'" sing N N 187 U "C1'" N1 sing N N 188 U "C1'" "H1'" sing N N 189 U N1 C2 sing N N 190 U N1 C6 sing N N 191 U C2 O2 doub N N 192 U C2 N3 sing N N 193 U N3 C4 sing N N 194 U N3 H3 sing N N 195 U C4 O4 doub N N 196 U C4 C5 sing N N 197 U C5 C6 doub N N 198 U C5 H5 sing N N 199 U C6 H6 sing N N 200 # _em_admin.current_status REL _em_admin.deposition_date 2023-07-25 _em_admin.deposition_site RCSB _em_admin.entry_id 8TKK _em_admin.last_update 2025-02-19 _em_admin.map_release_date 2025-02-19 _em_admin.title 'Cryo-EM structure of RNA device 43 truncation mutant 3 (U100C), apo state' # loop_ _em_buffer_component.buffer_id _em_buffer_component.concentration _em_buffer_component.concentration_units _em_buffer_component.formula _em_buffer_component.id _em_buffer_component.name 1 10 mM ? 1 Bis-Tris 1 100 mM ? 2 'potassium chloride' 1 1 mM ? 3 'magnesium chloride' # _em_ctf_correction.details ? _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.id 1 _em_ctf_correction.type 'PHASE FLIPPING AND AMPLITUDE CORRECTION' # _em_entity_assembly_molwt.entity_assembly_id 1 _em_entity_assembly_molwt.experimental_flag NO _em_entity_assembly_molwt.id 1 _em_entity_assembly_molwt.units MEGADALTONS _em_entity_assembly_molwt.value 0.035086 # _em_entity_assembly_naturalsource.cell ? _em_entity_assembly_naturalsource.cellular_location ? _em_entity_assembly_naturalsource.entity_assembly_id 1 _em_entity_assembly_naturalsource.id 2 _em_entity_assembly_naturalsource.ncbi_tax_id 32630 _em_entity_assembly_naturalsource.organism 'synthetic construct' _em_entity_assembly_naturalsource.organelle ? _em_entity_assembly_naturalsource.organ ? _em_entity_assembly_naturalsource.strain ? _em_entity_assembly_naturalsource.tissue ? _em_entity_assembly_naturalsource.details ? # _em_entity_assembly_recombinant.cell ? _em_entity_assembly_recombinant.entity_assembly_id 1 _em_entity_assembly_recombinant.id 2 _em_entity_assembly_recombinant.ncbi_tax_id 32630 _em_entity_assembly_recombinant.organism 'synthetic construct' _em_entity_assembly_recombinant.plasmid ? _em_entity_assembly_recombinant.strain ? # _em_image_processing.details ? _em_image_processing.id 1 _em_image_processing.image_recording_id 1 # _em_image_recording.average_exposure_time ? _em_image_recording.avg_electron_dose_per_subtomogram ? _em_image_recording.avg_electron_dose_per_image 54.5 _em_image_recording.details ? _em_image_recording.detector_mode ? _em_image_recording.film_or_detector_model 'FEI FALCON IV (4k x 4k)' _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged ? _em_image_recording.num_real_images ? # loop_ _em_software.category _em_software.details _em_software.id _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id _em_software.name _em_software.version 'PARTICLE SELECTION' ? 1 1 ? ? ? ? 'MODEL REFINEMENT' ? 2 ? ? ? PHENIX 1.21rc1_4924 'IMAGE ACQUISITION' ? 3 ? ? 1 ? ? MASKING ? 4 ? ? ? ? ? 'CTF CORRECTION' ? 5 1 ? ? ? ? 'LAYERLINE INDEXING' ? 6 ? ? ? ? ? 'DIFFRACTION INDEXING' ? 7 ? ? ? ? ? 'MODEL FITTING' ? 8 ? ? ? ? ? OTHER ? 9 ? ? ? ? ? 'INITIAL EULER ASSIGNMENT' ? 10 1 ? ? ? ? 'FINAL EULER ASSIGNMENT' ? 11 1 ? ? ? ? CLASSIFICATION ? 12 1 ? ? ? ? RECONSTRUCTION ? 13 1 ? ? ? ? 'VOLUME SELECTION' ? 14 1 1 1 ? ? 'SERIES ALIGNMENT' ? 15 1 1 1 ? ? 'MOLECULAR REPLACEMENT' ? 16 1 1 1 ? ? 'LATTICE DISTORTION CORRECTION' ? 17 1 1 1 ? ? 'SYMMETRY DETERMINATION' ? 18 1 1 1 ? ? 'CRYSTALLOGRAPHY MERGING' ? 19 1 1 1 ? ? # _em_specimen.concentration 1.2 _em_specimen.details 'in vitro transcribed RNA' _em_specimen.embedding_applied NO _em_specimen.experiment_id 1 _em_specimen.id 1 _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8TKK 'double helix' 8TKK 'a-form double helix' 8TKK 'parallel strands' 8TKK 'hairpin loop' 8TKK tetraloop 8TKK 'mismatched base pair' 8TKK 'internal loop' 8TKK 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A C 1 1_555 A G 106 1_555 -0.439 -0.696 -1.221 5.479 0.525 -2.057 1 A_C9:G114_A A 9 ? A 114 ? 19 1 1 A A 2 1_555 A U 105 1_555 -0.788 -0.392 -0.035 -10.001 -4.687 -1.313 2 A_A10:U113_A A 10 ? A 113 ? 20 1 1 A G 3 1_555 A C 104 1_555 -0.685 0.122 0.526 -4.573 -9.514 9.412 3 A_G11:C112_A A 11 ? A 112 ? 19 1 1 A G 4 1_555 A C 103 1_555 -0.105 -0.501 -0.502 -13.277 -21.153 -5.135 4 A_G12:C111_A A 12 ? A 111 ? 19 1 1 A U 5 1_555 A A 27 1_555 4.034 -0.611 -2.097 -10.166 -16.579 -109.031 5 A_U13:A35_A A 13 ? A 35 ? ? ? 1 A A 30 1_555 A U 102 1_555 -3.989 -2.155 -0.129 -1.027 -11.629 -94.059 6 A_A38:U110_A A 38 ? A 110 ? 24 4 1 A A 8 1_555 A U 101 1_555 0.318 -0.322 -0.306 -3.080 -37.822 -17.428 7 A_A16:U109_A A 16 ? A 109 ? 20 1 1 A U 9 1_555 A A 100 1_555 0.716 -0.007 -1.419 16.526 -46.246 -27.882 8 A_U17:A108_A A 17 ? A 108 ? 20 1 1 A C 10 1_555 A G 99 1_555 1.520 -0.766 1.478 5.949 -26.755 3.312 9 A_C18:G107_A A 18 ? A 107 ? 19 1 1 A C 11 1_555 A G 98 1_555 -1.980 -0.029 -2.315 19.735 -23.904 -25.704 10 A_C19:G106_A A 19 ? A 106 ? ? ? 1 A A 12 1_555 A U 97 1_555 1.166 0.309 -0.587 -7.436 14.052 3.209 11 A_A20:U105_A A 20 ? A 105 ? 20 1 1 A G 13 1_555 A C 96 1_555 -1.098 0.041 -0.673 -7.936 -20.312 -2.179 12 A_G21:C104_A A 21 ? A 104 ? 19 1 1 A C 14 1_555 A G 19 1_555 0.733 -0.468 -0.309 12.173 -0.316 3.175 13 A_C22:G27_A A 22 ? A 27 ? 19 1 1 A C 7 1_555 A C 25 1_555 -1.425 -1.313 1.286 -11.381 -18.862 -179.125 14 A_C15:C33_A A 15 ? A 33 ? 15 2 1 A G 31 1_555 A C 24 1_555 -0.645 -0.465 -0.850 -14.013 -10.910 -8.834 15 A_G39:C32_A A 39 ? A 32 ? 19 1 1 A G 32 1_555 A C 23 1_555 -0.350 -0.153 -0.090 -11.730 -4.933 5.335 16 A_G40:C31_A A 40 ? A 31 ? 19 1 1 A A 33 1_555 A U 22 1_555 0.908 -0.024 -0.834 -13.801 -22.425 -19.372 17 A_A41:U30_A A 41 ? A 30 ? 20 1 1 A C 34 1_555 A G 21 1_555 -0.024 -0.531 -0.342 13.586 -24.058 -2.428 18 A_C42:G29_A A 42 ? A 29 ? 19 1 1 A A 35 1_555 A A 20 1_555 6.311 -3.569 0.522 -0.658 -19.937 -5.228 19 A_A43:A28_A A 43 ? A 28 ? ? 5 1 A A 36 1_555 A C 95 1_555 -6.090 -3.134 -0.355 -16.114 2.885 -42.423 20 A_A44:C103_A A 44 ? A 103 ? ? ? 1 A A 37 1_555 A G 16 1_555 -4.716 3.173 -0.133 40.242 -47.621 79.630 21 A_A45:G24_A A 45 ? A 24 ? ? ? 1 A A 38 1_555 A U 94 1_555 0.416 0.034 0.710 -9.184 -6.931 -2.547 22 A_A46:U102_A A 46 ? A 102 ? 20 1 1 A A 39 1_555 A U 93 1_555 0.493 0.048 0.415 -2.094 -15.883 -7.089 23 A_A47:U101_A A 47 ? A 101 ? 20 1 1 A G 40 1_555 A C 92 1_555 -0.747 0.277 0.456 6.510 -18.538 0.394 24 A_G48:C100_A A 48 ? A 100 ? 19 1 1 A G 41 1_555 A C 91 1_555 -0.988 -0.422 -0.525 -0.517 -26.040 -12.728 25 A_G49:C99_A A 49 ? A 99 ? ? 1 1 A G 42 1_555 A C 90 1_555 -0.623 0.126 0.396 -13.953 -24.435 -2.063 26 A_G50:C98_A A 50 ? A 98 ? 19 1 1 A A 43 1_555 A A 89 1_555 2.340 1.520 0.312 -8.617 -16.634 -6.300 27 A_A51:A97_A A 51 ? A 97 ? ? 1 1 A G 44 1_555 A U 88 1_555 4.208 1.175 -0.934 -12.067 -19.939 -52.544 28 A_G52:U96_A A 52 ? A 96 ? ? ? 1 A G 58 1_555 A A 87 1_555 2.728 -5.636 0.170 21.452 4.966 136.086 29 A_G66:A95_A A 66 ? A 95 ? ? 3 1 A C 57 1_555 A C 86 1_555 1.936 1.913 1.173 13.579 10.840 177.489 30 A_C65:C94_A A 65 ? A 94 ? 15 2 1 A A 56 1_555 A A 85 1_555 0.643 2.707 1.629 -33.793 -2.998 -179.720 31 A_A64:A93_A A 64 ? A 93 ? 1 2 1 A C 60 1_555 A A 50 1_555 -1.760 0.743 0.737 37.457 -2.081 -6.148 32 A_C68:A58_A A 68 ? A 58 ? ? ? 1 A C 61 1_555 A G 49 1_555 -0.190 0.152 0.687 20.720 -16.350 4.221 33 A_C69:G57_A A 69 ? A 57 ? 19 1 1 A A 62 1_555 A U 48 1_555 0.886 -0.089 0.496 10.747 -14.379 3.041 34 A_A70:U56_A A 70 ? A 56 ? 20 1 1 A C 63 1_555 A G 47 1_555 -0.124 0.050 -0.883 30.990 -21.608 -15.694 35 A_C71:G55_A A 71 ? A 55 ? 19 1 1 A C 64 1_555 A G 46 1_555 1.079 -0.426 -0.187 -0.960 -8.371 3.944 36 A_C72:G54_A A 72 ? A 54 ? 19 1 1 A U 65 1_555 A A 82 1_555 0.892 0.633 -0.078 -5.081 2.720 17.588 37 A_U73:A90_A A 73 ? A 90 ? ? 1 1 A A 66 1_555 A U 81 1_555 0.525 -0.131 -0.646 -15.138 -10.986 2.291 38 A_A74:U89_A A 74 ? A 89 ? 20 1 1 A G 67 1_555 A C 80 1_555 -0.441 -0.267 -0.272 -9.998 -1.278 6.553 39 A_G75:C88_A A 75 ? A 88 ? 19 1 1 A G 68 1_555 A C 79 1_555 -1.199 -0.261 0.034 1.588 -3.701 5.677 40 A_G76:C87_A A 76 ? A 87 ? 19 1 1 A C 69 1_555 A G 78 1_555 0.782 0.023 -0.223 10.908 -5.463 10.315 41 A_C77:G86_A A 77 ? A 86 ? 19 1 1 A U 70 1_555 A A 77 1_555 0.396 -0.415 -0.351 2.541 -7.520 4.671 42 A_U78:A85_A A 78 ? A 85 ? 20 1 1 A C 71 1_555 A G 76 1_555 1.443 0.245 -0.242 9.616 -1.573 10.632 43 A_C79:G84_A A 79 ? A 84 ? ? 1 1 A G 72 1_555 A A 75 1_555 7.255 -3.598 0.736 32.173 -0.372 -48.639 44 A_G80:A83_A A 80 ? A 83 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A C 1 1_555 A G 106 1_555 A A 2 1_555 A U 105 1_555 0.069 -1.617 3.836 -4.457 8.728 30.621 -4.654 -1.008 3.224 16.019 8.180 32.115 1 AA_C9A10:U113G114_AA A 9 ? A 114 ? A 10 ? A 113 ? 1 A A 2 1_555 A U 105 1_555 A G 3 1_555 A C 104 1_555 0.697 -1.448 2.903 -3.222 7.091 32.272 -3.526 -1.670 2.459 12.530 5.694 33.174 2 AA_A10G11:C112U113_AA A 10 ? A 113 ? A 11 ? A 112 ? 1 A G 3 1_555 A C 104 1_555 A G 4 1_555 A C 103 1_555 -0.484 -2.004 3.367 6.831 8.827 35.559 -4.250 1.617 2.676 14.033 -10.859 37.215 3 AA_G11G12:C111C112_AA A 11 ? A 112 ? A 12 ? A 111 ? 1 A G 4 1_555 A C 103 1_555 A U 5 1_555 A A 27 1_555 -2.083 -1.632 2.780 9.754 -3.511 79.550 -1.191 1.831 2.612 -2.733 -7.593 80.111 4 AA_G12U13:A35C111_AA A 12 ? A 111 ? A 13 ? A 35 ? 1 A U 5 1_555 A A 27 1_555 A A 30 1_555 A U 102 1_555 4.107 -1.685 5.251 36.897 -63.293 -135.452 1.404 2.459 4.265 33.504 19.531 -144.583 5 AA_U13A38:U110A35_AA A 13 ? A 35 ? A 38 ? A 110 ? 1 A A 30 1_555 A U 102 1_555 A A 8 1_555 A U 101 1_555 1.267 -1.710 3.617 -9.636 12.182 82.135 -1.598 -1.200 3.249 9.198 7.276 83.334 6 AA_A38A16:U109U110_AA A 38 ? A 110 ? A 16 ? A 109 ? 1 A A 8 1_555 A U 101 1_555 A U 9 1_555 A A 100 1_555 -1.087 -1.751 2.737 3.125 6.206 33.953 -3.682 2.199 2.285 10.492 -5.283 34.636 7 AA_A16U17:A108U109_AA A 16 ? A 109 ? A 17 ? A 108 ? 1 A U 9 1_555 A A 100 1_555 A C 10 1_555 A G 99 1_555 1.096 -1.772 3.853 -13.968 9.545 36.364 -3.754 -3.303 2.738 14.377 21.040 39.985 8 AA_U17C18:G107A108_AA A 17 ? A 108 ? A 18 ? A 107 ? 1 A C 10 1_555 A G 99 1_555 A C 11 1_555 A G 98 1_555 -2.278 -2.066 2.568 16.677 14.726 15.279 -5.556 6.160 -1.059 37.026 -41.930 26.935 9 AA_C18C19:G106G107_AA A 18 ? A 107 ? A 19 ? A 106 ? 1 A C 11 1_555 A G 98 1_555 A A 12 1_555 A U 97 1_555 1.303 -1.743 4.471 -12.870 17.719 44.632 -3.705 -2.734 3.144 21.845 15.867 49.468 10 AA_C19A20:U105G106_AA A 19 ? A 106 ? A 20 ? A 105 ? 1 A A 12 1_555 A U 97 1_555 A G 13 1_555 A C 96 1_555 0.100 -1.663 3.229 4.877 12.884 23.659 -6.299 0.840 2.047 28.534 -10.801 27.328 11 AA_A20G21:C104U105_AA A 20 ? A 105 ? A 21 ? A 104 ? 1 A G 13 1_555 A C 96 1_555 A C 14 1_555 A G 19 1_555 0.480 -0.468 2.739 -2.327 19.256 37.893 -2.231 -0.855 2.229 27.560 3.331 42.405 12 AA_G21C22:G27C104_AA A 21 ? A 104 ? A 22 ? A 27 ? 1 A C 7 1_555 A C 25 1_555 A G 31 1_555 A C 24 1_555 -2.625 2.118 0.410 -139.398 -92.109 -143.235 -1.039 -1.345 0.069 46.235 -69.972 -175.933 13 AA_C15G39:C32C33_AA A 15 ? A 33 ? A 39 ? A 32 ? 1 A G 31 1_555 A C 24 1_555 A G 32 1_555 A C 23 1_555 0.732 -1.583 3.031 -4.814 6.547 34.553 -3.432 -1.815 2.575 10.838 7.968 35.467 14 AA_G39G40:C31C32_AA A 39 ? A 32 ? A 40 ? A 31 ? 1 A G 32 1_555 A C 23 1_555 A A 33 1_555 A U 22 1_555 -1.343 -1.343 3.373 3.737 10.403 40.297 -2.942 2.265 2.826 14.767 -5.305 41.725 15 AA_G40A41:U30C31_AA A 40 ? A 31 ? A 41 ? A 30 ? 1 A A 33 1_555 A U 22 1_555 A C 34 1_555 A G 21 1_555 1.027 -1.741 2.505 -1.270 -0.053 22.733 -4.396 -2.947 2.449 -0.135 3.220 22.768 16 AA_A41C42:G29U30_AA A 41 ? A 30 ? A 42 ? A 29 ? 1 A C 34 1_555 A G 21 1_555 A A 35 1_555 A A 20 1_555 0.559 -0.768 3.861 2.025 11.645 58.226 -1.464 -0.445 3.676 11.834 -2.058 59.311 17 AA_C42A43:A28G29_AA A 42 ? A 29 ? A 43 ? A 28 ? 1 A A 35 1_555 A A 20 1_555 A A 36 1_555 A C 95 1_555 0.425 -0.652 3.936 8.994 -4.148 20.024 0.259 3.115 3.825 -11.095 -24.056 22.317 18 AA_A43A44:C103A28_AA A 43 ? A 28 ? A 44 ? A 103 ? 1 A A 36 1_555 A C 95 1_555 A A 37 1_555 A G 16 1_555 0.709 -4.793 2.036 -27.638 33.733 -16.128 1.590 -2.785 4.609 -54.671 -44.793 -46.360 19 AA_A44A45:G24C103_AA A 44 ? A 103 ? A 45 ? A 24 ? 1 A A 37 1_555 A G 16 1_555 A A 38 1_555 A U 94 1_555 0.930 2.520 3.752 -4.293 -17.191 90.549 2.115 -0.737 3.306 -12.005 2.998 91.895 20 AA_A45A46:U102G24_AA A 45 ? A 24 ? A 46 ? A 102 ? 1 A A 38 1_555 A U 94 1_555 A A 39 1_555 A U 93 1_555 -0.499 -1.101 3.121 2.395 8.316 32.751 -3.110 1.208 2.725 14.436 -4.158 33.845 21 AA_A46A47:U101U102_AA A 46 ? A 102 ? A 47 ? A 101 ? 1 A A 39 1_555 A U 93 1_555 A G 40 1_555 A C 92 1_555 0.480 -1.279 2.923 0.829 2.460 27.432 -3.215 -0.830 2.812 5.173 -1.744 27.553 22 AA_A47G48:C100U101_AA A 47 ? A 101 ? A 48 ? A 100 ? 1 A G 40 1_555 A C 92 1_555 A G 41 1_555 A C 91 1_555 0.275 -1.967 3.595 5.189 8.259 25.351 -6.310 0.744 2.826 17.992 -11.305 27.134 23 AA_G48G49:C99C100_AA A 48 ? A 100 ? A 49 ? A 99 ? 1 A G 41 1_555 A C 91 1_555 A G 42 1_555 A C 90 1_555 0.751 -1.490 3.525 -2.400 9.157 39.131 -3.230 -1.371 3.064 13.434 3.520 40.216 24 AA_G49G50:C98C99_AA A 49 ? A 99 ? A 50 ? A 98 ? 1 A G 42 1_555 A C 90 1_555 A A 43 1_555 A A 89 1_555 0.093 -1.251 3.098 5.814 0.643 42.867 -1.757 0.411 3.066 0.874 -7.910 43.245 25 AA_G50A51:A97C98_AA A 50 ? A 98 ? A 51 ? A 97 ? 1 A A 43 1_555 A A 89 1_555 A G 44 1_555 A U 88 1_555 -1.583 -1.549 3.443 14.969 10.511 34.031 -3.517 4.064 2.048 16.560 -23.583 38.506 26 AA_A51G52:U96A97_AA A 51 ? A 97 ? A 52 ? A 96 ? 1 A G 44 1_555 A U 88 1_555 A G 58 1_555 A A 87 1_555 1.174 -3.166 1.981 -171.550 34.393 -81.546 1.376 -0.450 2.637 -17.368 -86.631 -176.187 27 AA_G52G66:A95U96_AA A 52 ? A 96 ? A 66 ? A 95 ? 1 A G 58 1_555 A A 87 1_555 A C 57 1_555 A C 86 1_555 0.739 3.471 -2.762 -26.994 -13.479 -12.563 -7.128 3.215 0.961 30.336 -60.754 -32.627 28 AA_G66C65:C94A95_AA A 66 ? A 95 ? A 65 ? A 94 ? 1 A C 57 1_555 A C 86 1_555 A A 56 1_555 A A 85 1_555 0.441 0.254 -3.025 -4.906 2.513 124.336 0.163 -0.211 -3.031 1.421 2.773 124.406 29 AA_C65A64:A93C94_AA A 65 ? A 94 ? A 64 ? A 93 ? 1 A C 60 1_555 A A 50 1_555 A C 61 1_555 A G 49 1_555 0.702 -1.399 3.431 -0.674 17.492 44.929 -3.064 -0.914 2.728 21.929 0.844 48.054 30 AA_C68C69:G57A58_AA A 68 ? A 58 ? A 69 ? A 57 ? 1 A C 61 1_555 A G 49 1_555 A A 62 1_555 A U 48 1_555 -0.648 -1.891 3.205 -3.510 5.487 33.873 -3.997 0.578 2.922 9.310 5.956 34.475 31 AA_C69A70:U56G57_AA A 69 ? A 57 ? A 70 ? A 56 ? 1 A A 62 1_555 A U 48 1_555 A C 63 1_555 A G 47 1_555 -0.258 -1.201 2.792 11.107 -4.112 25.133 -1.644 2.864 2.607 -8.850 -23.904 27.743 32 AA_A70C71:G55U56_AA A 70 ? A 56 ? A 71 ? A 55 ? 1 A C 63 1_555 A G 47 1_555 A C 64 1_555 A G 46 1_555 1.032 -1.867 4.118 -0.865 12.747 43.773 -3.741 -1.424 3.453 16.679 1.132 45.511 33 AA_C71C72:G54G55_AA A 71 ? A 55 ? A 72 ? A 54 ? 1 A C 64 1_555 A G 46 1_555 A U 65 1_555 A A 82 1_555 -1.665 -2.719 3.396 -2.664 5.384 10.688 -18.793 4.800 2.133 26.348 13.035 12.256 34 AA_C72U73:A90G54_AA A 72 ? A 54 ? A 73 ? A 90 ? 1 A U 65 1_555 A A 82 1_555 A A 66 1_555 A U 81 1_555 -0.994 -1.447 3.376 4.693 15.110 30.335 -4.658 2.374 2.251 26.713 -8.298 34.127 35 AA_U73A74:U89A90_AA A 73 ? A 90 ? A 74 ? A 89 ? 1 A A 66 1_555 A U 81 1_555 A G 67 1_555 A C 80 1_555 0.055 -1.282 2.974 -5.800 13.656 27.262 -4.567 -1.023 2.060 26.619 11.306 30.971 36 AA_A74G75:C88U89_AA A 74 ? A 89 ? A 75 ? A 88 ? 1 A G 67 1_555 A C 80 1_555 A G 68 1_555 A C 79 1_555 -0.060 -1.565 2.928 -3.119 1.179 27.587 -3.510 -0.539 2.849 2.461 6.511 27.784 37 AA_G75G76:C87C88_AA A 75 ? A 88 ? A 76 ? A 87 ? 1 A G 68 1_555 A C 79 1_555 A C 69 1_555 A G 78 1_555 0.187 -1.312 2.985 1.392 0.014 41.542 -1.851 -0.128 2.989 0.020 -1.962 41.564 38 AA_G76C77:G86C87_AA A 76 ? A 87 ? A 77 ? A 86 ? 1 A C 69 1_555 A G 78 1_555 A U 70 1_555 A A 77 1_555 -0.207 -1.620 3.268 3.205 6.753 31.790 -3.993 0.895 2.839 12.119 -5.752 32.635 39 AA_C77U78:A85G86_AA A 77 ? A 86 ? A 78 ? A 85 ? 1 A U 70 1_555 A A 77 1_555 A C 71 1_555 A G 76 1_555 0.477 -0.737 3.031 4.063 10.304 33.840 -2.567 -0.245 2.735 17.141 -6.760 35.556 40 AA_U78C79:G84A85_AA A 78 ? A 85 ? A 79 ? A 84 ? 1 A C 71 1_555 A G 76 1_555 A G 72 1_555 A A 75 1_555 -3.793 -0.574 2.765 2.500 16.578 46.801 -1.656 4.672 2.258 20.129 -3.035 49.554 41 AA_C79G80:A83G84_AA A 79 ? A 84 ? A 80 ? A 83 ? # _pdbx_audit_support.funding_organization 'National Institutes of Health/National Cancer Institute (NIH/NCI)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _space_group.crystal_system triclinic _space_group.name_H-M_alt 'P 1' _space_group.IT_number 1 _space_group.name_Hall 'P 1' _space_group.id 1 # _atom_sites.entry_id 8TKK _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ #