data_8UYE # _entry.id 8UYE # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.388 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8UYE pdb_00008uye 10.2210/pdb8uye/pdb WWPDB D_1000278682 ? ? EMDB EMD-42801 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-12-06 2 'Structure model' 1 1 2023-12-27 3 'Structure model' 1 2 2024-03-13 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 3 'Structure model' citation 3 3 'Structure model' citation_author # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.pdbx_database_id_PubMed' 2 2 'Structure model' '_citation.title' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8UYE _pdbx_database_status.recvd_initial_deposition_date 2023-11-13 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name EMDB _pdbx_database_related.details ;BtCoV-HKU5 5' proximal stem-loop 5, conformation 1 ; _pdbx_database_related.db_id EMD-42801 _pdbx_database_related.content_type 'associated EM volume' # loop_ _pdbx_contact_author.id _pdbx_contact_author.email _pdbx_contact_author.name_first _pdbx_contact_author.name_last _pdbx_contact_author.name_mi _pdbx_contact_author.role _pdbx_contact_author.identifier_ORCID 2 rhiju@stanford.edu Rhiju Das ? 'principal investigator/group leader' 0000-0001-7497-0972 3 wahc@stanford.edu Wah Chiu ? 'principal investigator/group leader' 0000-0002-8910-3078 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kretsch, R.C.' 1 0000-0002-6935-518X 'Xu, L.' 2 0000-0002-1200-8937 'Zheludev, I.N.' 3 0000-0002-9572-0574 'Zhou, X.' 4 0000-0002-0722-7334 'Huang, R.' 5 0009-0009-6136-8013 'Nye, G.' 6 0009-0001-6698-9988 'Li, S.' 7 0000-0002-7041-5960 'Zhang, K.' 8 0000-0003-0414-4776 'Chiu, W.' 9 0000-0002-8910-3078 'Das, R.' 10 0000-0001-7497-0972 # loop_ _citation.abstract _citation.abstract_id_CAS _citation.book_id_ISBN _citation.book_publisher _citation.book_publisher_city _citation.book_title _citation.coordinate_linkage _citation.country _citation.database_id_Medline _citation.details _citation.id _citation.journal_abbrev _citation.journal_id_ASTM _citation.journal_id_CSD _citation.journal_id_ISSN _citation.journal_full _citation.journal_issue _citation.journal_volume _citation.language _citation.page_first _citation.page_last _citation.title _citation.year _citation.database_id_CSD _citation.pdbx_database_id_DOI _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_patent _citation.unpublished_flag ? ? ? ? ? ? ? US ? ? primary Proc.Natl.Acad.Sci.USA PNASA6 0040 1091-6490 ? ? 121 ? e2320493121 e2320493121 ;Tertiary folds of the SL5 RNA from the 5' proximal region of SARS-CoV-2 and related coronaviruses. ; 2024 ? 10.1073/pnas.2320493121 38427602 ? ? ? ? ? ? ? ? ? US ? ? 1 Biorxiv ? ? 2692-8205 ? ? ? ? ? ? ;Tertiary folds of the SL5 RNA from the 5' proximal region of SARS-CoV-2 and related coronaviruses. ; 2023 ? 10.1101/2023.11.22.567964 38076883 ? ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Kretsch, R.C.' 1 0000-0002-6935-518X primary 'Xu, L.' 2 0000-0002-1200-8937 primary 'Zheludev, I.N.' 3 ? primary 'Zhou, X.' 4 0000-0002-0722-7334 primary 'Huang, R.' 5 ? primary 'Nye, G.' 6 ? primary 'Li, S.' 7 ? primary 'Zhang, K.' 8 ? primary 'Chiu, W.' 9 0000-0002-8910-3078 primary 'Das, R.' 10 0000-0001-7497-0972 1 'Kretsch, R.C.' 11 ? 1 'Xu, L.' 12 ? 1 'Zheludev, I.N.' 13 ? 1 'Zhou, X.' 14 ? 1 'Huang, R.' 15 ? 1 'Nye, G.' 16 ? 1 'Li, S.' 17 ? 1 'Zhang, K.' 18 ? 1 'Chiu, W.' 19 ? 1 'Das, R.' 20 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description ;BtCoV-HKU5 5' proximal stem-loop 5 ; _entity.formula_weight 43510.676 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGAGCAUCGUGUCUCAAGUGCUUCACGGUCACAAUAUACCGUUUCGUCGGGUGCGUGGCAAUUCGGUGCACAUCAUGUCU UUCGUGGCUGGUGUGGCUCCUCAAGGUGCGAGGGGCAAGUAUAGAGCAGAGCUCC ; _entity_poly.pdbx_seq_one_letter_code_can ;GGAGCAUCGUGUCUCAAGUGCUUCACGGUCACAAUAUACCGUUUCGUCGGGUGCGUGGCAAUUCGGUGCACAUCAUGUCU UUCGUGGCUGGUGUGGCUCCUCAAGGUGCGAGGGGCAAGUAUAGAGCAGAGCUCC ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 G n 1 5 C n 1 6 A n 1 7 U n 1 8 C n 1 9 G n 1 10 U n 1 11 G n 1 12 U n 1 13 C n 1 14 U n 1 15 C n 1 16 A n 1 17 A n 1 18 G n 1 19 U n 1 20 G n 1 21 C n 1 22 U n 1 23 U n 1 24 C n 1 25 A n 1 26 C n 1 27 G n 1 28 G n 1 29 U n 1 30 C n 1 31 A n 1 32 C n 1 33 A n 1 34 A n 1 35 U n 1 36 A n 1 37 U n 1 38 A n 1 39 C n 1 40 C n 1 41 G n 1 42 U n 1 43 U n 1 44 U n 1 45 C n 1 46 G n 1 47 U n 1 48 C n 1 49 G n 1 50 G n 1 51 G n 1 52 U n 1 53 G n 1 54 C n 1 55 G n 1 56 U n 1 57 G n 1 58 G n 1 59 C n 1 60 A n 1 61 A n 1 62 U n 1 63 U n 1 64 C n 1 65 G n 1 66 G n 1 67 U n 1 68 G n 1 69 C n 1 70 A n 1 71 C n 1 72 A n 1 73 U n 1 74 C n 1 75 A n 1 76 U n 1 77 G n 1 78 U n 1 79 C n 1 80 U n 1 81 U n 1 82 U n 1 83 C n 1 84 G n 1 85 U n 1 86 G n 1 87 G n 1 88 C n 1 89 U n 1 90 G n 1 91 G n 1 92 U n 1 93 G n 1 94 U n 1 95 G n 1 96 G n 1 97 C n 1 98 U n 1 99 C n 1 100 C n 1 101 U n 1 102 C n 1 103 A n 1 104 A n 1 105 G n 1 106 G n 1 107 U n 1 108 G n 1 109 C n 1 110 G n 1 111 A n 1 112 G n 1 113 G n 1 114 G n 1 115 G n 1 116 C n 1 117 A n 1 118 A n 1 119 G n 1 120 U n 1 121 A n 1 122 U n 1 123 A n 1 124 G n 1 125 A n 1 126 G n 1 127 C n 1 128 A n 1 129 G n 1 130 A n 1 131 G n 1 132 C n 1 133 U n 1 134 C n 1 135 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 135 _pdbx_entity_src_syn.organism_scientific 'Pipistrellus bat coronavirus HKU5' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 694008 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 187 187 G G A . n A 1 2 G 2 188 188 G G A . n A 1 3 A 3 189 189 A A A . n A 1 4 G 4 190 190 G G A . n A 1 5 C 5 191 191 C C A . n A 1 6 A 6 192 192 A A A . n A 1 7 U 7 193 193 U U A . n A 1 8 C 8 194 194 C C A . n A 1 9 G 9 195 195 G G A . n A 1 10 U 10 196 196 U U A . n A 1 11 G 11 197 197 G G A . n A 1 12 U 12 198 198 U U A . n A 1 13 C 13 199 199 C C A . n A 1 14 U 14 200 200 U U A . n A 1 15 C 15 201 201 C C A . n A 1 16 A 16 202 202 A A A . n A 1 17 A 17 203 203 A A A . n A 1 18 G 18 204 204 G G A . n A 1 19 U 19 205 205 U U A . n A 1 20 G 20 206 206 G G A . n A 1 21 C 21 207 207 C C A . n A 1 22 U 22 208 208 U U A . n A 1 23 U 23 209 209 U U A . n A 1 24 C 24 210 210 C C A . n A 1 25 A 25 211 211 A A A . n A 1 26 C 26 212 212 C C A . n A 1 27 G 27 213 213 G G A . n A 1 28 G 28 214 214 G G A . n A 1 29 U 29 215 215 U U A . n A 1 30 C 30 216 216 C C A . n A 1 31 A 31 217 217 A A A . n A 1 32 C 32 218 218 C C A . n A 1 33 A 33 219 219 A A A . n A 1 34 A 34 220 220 A A A . n A 1 35 U 35 221 221 U U A . n A 1 36 A 36 222 222 A A A . n A 1 37 U 37 223 223 U U A . n A 1 38 A 38 224 224 A A A . n A 1 39 C 39 225 225 C C A . n A 1 40 C 40 226 226 C C A . n A 1 41 G 41 227 227 G G A . n A 1 42 U 42 228 228 U U A . n A 1 43 U 43 229 229 U U A . n A 1 44 U 44 230 230 U U A . n A 1 45 C 45 231 231 C C A . n A 1 46 G 46 232 232 G G A . n A 1 47 U 47 233 233 U U A . n A 1 48 C 48 234 234 C C A . n A 1 49 G 49 235 235 G G A . n A 1 50 G 50 236 236 G G A . n A 1 51 G 51 237 237 G G A . n A 1 52 U 52 238 238 U U A . n A 1 53 G 53 239 239 G G A . n A 1 54 C 54 240 240 C C A . n A 1 55 G 55 241 241 G G A . n A 1 56 U 56 242 242 U U A . n A 1 57 G 57 243 243 G G A . n A 1 58 G 58 244 244 G G A . n A 1 59 C 59 245 245 C C A . n A 1 60 A 60 246 246 A A A . n A 1 61 A 61 247 247 A A A . n A 1 62 U 62 248 248 U U A . n A 1 63 U 63 249 249 U U A . n A 1 64 C 64 250 250 C C A . n A 1 65 G 65 251 251 G G A . n A 1 66 G 66 252 252 G G A . n A 1 67 U 67 253 253 U U A . n A 1 68 G 68 254 254 G G A . n A 1 69 C 69 255 255 C C A . n A 1 70 A 70 256 256 A A A . n A 1 71 C 71 257 257 C C A . n A 1 72 A 72 258 258 A A A . n A 1 73 U 73 259 259 U U A . n A 1 74 C 74 260 260 C C A . n A 1 75 A 75 261 261 A A A . n A 1 76 U 76 262 262 U U A . n A 1 77 G 77 263 263 G G A . n A 1 78 U 78 264 264 U U A . n A 1 79 C 79 265 265 C C A . n A 1 80 U 80 266 266 U U A . n A 1 81 U 81 267 267 U U A . n A 1 82 U 82 268 268 U U A . n A 1 83 C 83 269 269 C C A . n A 1 84 G 84 270 270 G G A . n A 1 85 U 85 271 271 U U A . n A 1 86 G 86 272 272 G G A . n A 1 87 G 87 273 273 G G A . n A 1 88 C 88 274 274 C C A . n A 1 89 U 89 275 275 U U A . n A 1 90 G 90 276 276 G G A . n A 1 91 G 91 277 277 G G A . n A 1 92 U 92 278 278 U U A . n A 1 93 G 93 279 279 G G A . n A 1 94 U 94 280 280 U U A . n A 1 95 G 95 281 281 G G A . n A 1 96 G 96 282 282 G G A . n A 1 97 C 97 283 283 C C A . n A 1 98 U 98 284 284 U U A . n A 1 99 C 99 285 285 C C A . n A 1 100 C 100 286 286 C C A . n A 1 101 U 101 287 287 U U A . n A 1 102 C 102 288 288 C C A . n A 1 103 A 103 289 289 A A A . n A 1 104 A 104 290 290 A A A . n A 1 105 G 105 291 291 G G A . n A 1 106 G 106 292 292 G G A . n A 1 107 U 107 293 293 U U A . n A 1 108 G 108 294 294 G G A . n A 1 109 C 109 295 295 C C A . n A 1 110 G 110 296 296 G G A . n A 1 111 A 111 297 297 A A A . n A 1 112 G 112 298 298 G G A . n A 1 113 G 113 299 299 G G A . n A 1 114 G 114 300 300 G G A . n A 1 115 G 115 301 301 G G A . n A 1 116 C 116 302 302 C C A . n A 1 117 A 117 303 303 A A A . n A 1 118 A 118 304 304 A A A . n A 1 119 G 119 305 305 G G A . n A 1 120 U 120 306 306 U U A . n A 1 121 A 121 307 307 A A A . n A 1 122 U 122 308 308 U U A . n A 1 123 A 123 309 309 A A A . n A 1 124 G 124 310 310 G G A . n A 1 125 A 125 311 311 A A A . n A 1 126 G 126 312 312 G G A . n A 1 127 C 127 313 313 C C A . n A 1 128 A 128 314 314 A A A . n A 1 129 G 129 315 315 G G A . n A 1 130 A 130 316 316 A A A . n A 1 131 G 131 317 317 G G A . n A 1 132 C 132 318 318 C C A . n A 1 133 U 133 319 319 U U A . n A 1 134 C 134 320 320 C C A . n A 1 135 C 135 321 321 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8UYE _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _struct.entry_id 8UYE _struct.title ;BtCoV-HKU5 5' proximal stem-loop 5, conformation 1 ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8UYE _struct_keywords.text ;SL5, coronavirus, 5' UTR, RNA ; _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8UYE _struct_ref.pdbx_db_accession 8UYE _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8UYE _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 135 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 8UYE _struct_ref_seq.db_align_beg 187 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 321 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 187 _struct_ref_seq.pdbx_auth_seq_align_end 321 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'electron microscopy' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 135 N3 ? ? A G 187 A C 321 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 135 O2 ? ? A G 187 A C 321 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 135 N4 ? ? A G 187 A C 321 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 134 N3 ? ? A G 188 A C 320 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 134 O2 ? ? A G 188 A C 320 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 134 N4 ? ? A G 188 A C 320 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 133 N3 ? ? A A 189 A U 319 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 133 O4 ? ? A A 189 A U 319 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 132 N3 ? ? A G 190 A C 318 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 132 O2 ? ? A G 190 A C 318 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 132 N4 ? ? A G 190 A C 318 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 131 N1 ? ? A C 191 A G 317 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 131 O6 ? ? A C 191 A G 317 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 131 N2 ? ? A C 191 A G 317 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 6 N1 ? ? ? 1_555 A A 130 N6 ? ? A A 192 A A 316 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog16 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 130 N1 ? ? A U 193 A A 316 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 130 N6 ? ? A U 193 A A 316 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 129 N1 ? ? A C 194 A G 315 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 129 O6 ? ? A C 194 A G 315 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 129 N2 ? ? A C 194 A G 315 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 9 N1 ? ? ? 1_555 A A 128 N1 ? ? A G 195 A A 314 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog22 hydrog ? ? A G 9 O6 ? ? ? 1_555 A A 128 N6 ? ? A G 195 A A 314 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog23 hydrog ? ? A U 10 N3 ? ? ? 1_555 A A 128 N1 ? ? A U 196 A A 314 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A U 10 O4 ? ? ? 1_555 A A 128 N6 ? ? A U 196 A A 314 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 127 N3 ? ? A G 197 A C 313 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 127 O2 ? ? A G 197 A C 313 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 127 N4 ? ? A G 197 A C 313 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 126 N1 ? ? A C 199 A G 312 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 126 O6 ? ? A C 199 A G 312 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 126 N2 ? ? A C 199 A G 312 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 125 N1 ? ? A U 200 A A 311 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 125 N6 ? ? A U 200 A A 311 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 124 N1 ? ? A C 201 A G 310 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 124 O6 ? ? A C 201 A G 310 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 124 N2 ? ? A C 201 A G 310 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A A 16 N6 ? ? ? 1_555 A A 123 N1 ? ? A A 202 A A 309 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog37 hydrog ? ? A A 17 N6 ? ? ? 1_555 A U 122 O4 ? ? A A 203 A U 308 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog38 hydrog ? ? A G 18 N1 ? ? ? 1_555 A U 122 O2 ? ? A G 204 A U 308 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog39 hydrog ? ? A G 18 O6 ? ? ? 1_555 A U 122 N3 ? ? A G 204 A U 308 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog40 hydrog ? ? A U 19 N3 ? ? ? 1_555 A A 121 N1 ? ? A U 205 A A 307 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A U 19 O4 ? ? ? 1_555 A A 121 N6 ? ? A U 205 A A 307 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 20 N1 ? ? ? 1_555 A U 120 O2 ? ? A G 206 A U 306 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog43 hydrog ? ? A G 20 O6 ? ? ? 1_555 A U 120 N3 ? ? A G 206 A U 306 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog44 hydrog ? ? A C 21 N3 ? ? ? 1_555 A G 119 N1 ? ? A C 207 A G 305 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 21 N4 ? ? ? 1_555 A G 119 O6 ? ? A C 207 A G 305 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 21 O2 ? ? ? 1_555 A G 119 N2 ? ? A C 207 A G 305 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 118 N1 ? ? A U 208 A A 304 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 118 N6 ? ? A U 208 A A 304 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A U 23 N3 ? ? ? 1_555 A A 117 N1 ? ? A U 209 A A 303 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A U 23 O4 ? ? ? 1_555 A A 117 N6 ? ? A U 209 A A 303 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A C 24 N3 ? ? ? 1_555 A G 68 N1 ? ? A C 210 A G 254 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 24 N4 ? ? ? 1_555 A G 68 O6 ? ? A C 210 A G 254 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 68 N2 ? ? A C 210 A G 254 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A A 25 N1 ? ? ? 1_555 A U 67 N3 ? ? A A 211 A U 253 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A A 25 N6 ? ? ? 1_555 A U 67 O4 ? ? A A 211 A U 253 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A C 26 N3 ? ? ? 1_555 A G 66 N1 ? ? A C 212 A G 252 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 26 N4 ? ? ? 1_555 A G 66 O6 ? ? A C 212 A G 252 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 26 O2 ? ? ? 1_555 A G 66 N2 ? ? A C 212 A G 252 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 64 N3 ? ? A G 213 A C 250 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 64 O2 ? ? A G 213 A C 250 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 64 N4 ? ? A G 213 A C 250 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 28 N1 ? ? ? 1_555 A C 59 N3 ? ? A G 214 A C 245 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 59 O2 ? ? A G 214 A C 245 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 28 O6 ? ? ? 1_555 A C 59 N4 ? ? A G 214 A C 245 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A U 29 N3 ? ? ? 1_555 A G 58 O6 ? ? A U 215 A G 244 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog66 hydrog ? ? A U 29 O2 ? ? ? 1_555 A G 58 N1 ? ? A U 215 A G 244 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog67 hydrog ? ? A C 30 N3 ? ? ? 1_555 A G 57 N1 ? ? A C 216 A G 243 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A C 30 N4 ? ? ? 1_555 A G 57 O6 ? ? A C 216 A G 243 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A C 30 O2 ? ? ? 1_555 A G 57 N2 ? ? A C 216 A G 243 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A A 31 N1 ? ? ? 1_555 A U 56 N3 ? ? A A 217 A U 242 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A A 31 N6 ? ? ? 1_555 A U 56 O4 ? ? A A 217 A U 242 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A C 32 N3 ? ? ? 1_555 A G 55 N1 ? ? A C 218 A G 241 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A C 32 N4 ? ? ? 1_555 A G 55 O6 ? ? A C 218 A G 241 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A C 32 O2 ? ? ? 1_555 A G 55 N2 ? ? A C 218 A G 241 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A A 33 N1 ? ? ? 1_555 A C 54 N4 ? ? A A 219 A C 240 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog76 hydrog ? ? A U 35 N3 ? ? ? 1_555 A G 53 O6 ? ? A U 221 A G 239 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog77 hydrog ? ? A U 35 N3 ? ? ? 1_555 A C 54 O2 ? ? A U 221 A C 240 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog78 hydrog ? ? A A 36 N1 ? ? ? 1_555 A U 52 N3 ? ? A A 222 A U 238 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A A 36 N6 ? ? ? 1_555 A U 52 O4 ? ? A A 222 A U 238 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A U 37 N3 ? ? ? 1_555 A G 51 O6 ? ? A U 223 A G 237 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog81 hydrog ? ? A U 37 O2 ? ? ? 1_555 A G 51 N1 ? ? A U 223 A G 237 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog82 hydrog ? ? A C 39 N3 ? ? ? 1_555 A G 50 N1 ? ? A C 225 A G 236 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A C 39 N4 ? ? ? 1_555 A G 50 O6 ? ? A C 225 A G 236 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A C 39 O2 ? ? ? 1_555 A G 50 N2 ? ? A C 225 A G 236 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A C 40 N3 ? ? ? 1_555 A G 49 N1 ? ? A C 226 A G 235 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A C 40 N4 ? ? ? 1_555 A G 49 O6 ? ? A C 226 A G 235 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A C 40 O2 ? ? ? 1_555 A G 49 N2 ? ? A C 226 A G 235 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A G 41 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 227 A C 234 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A G 41 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 227 A C 234 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A G 41 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 227 A C 234 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A U 42 N3 ? ? ? 1_555 A U 47 O4 ? ? A U 228 A U 233 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog92 hydrog ? ? A U 42 O2 ? ? ? 1_555 A U 47 N3 ? ? A U 228 A U 233 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog93 hydrog ? ? A U 43 N3 ? ? ? 1_555 A G 46 O6 ? ? A U 229 A G 232 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog94 hydrog ? ? A U 43 O2 ? ? ? 1_555 A G 46 N1 ? ? A U 229 A G 232 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog95 hydrog ? ? A C 69 N3 ? ? ? 1_555 A G 95 N1 ? ? A C 255 A G 281 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A C 69 N4 ? ? ? 1_555 A G 95 O6 ? ? A C 255 A G 281 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? A C 69 O2 ? ? ? 1_555 A G 95 N2 ? ? A C 255 A G 281 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? A A 70 N1 ? ? ? 1_555 A U 94 N3 ? ? A A 256 A U 280 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? A A 70 N6 ? ? ? 1_555 A U 94 O4 ? ? A A 256 A U 280 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? A C 71 N3 ? ? ? 1_555 A G 93 N1 ? ? A C 257 A G 279 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog101 hydrog ? ? A C 71 N4 ? ? ? 1_555 A G 93 O6 ? ? A C 257 A G 279 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog102 hydrog ? ? A C 71 O2 ? ? ? 1_555 A G 93 N2 ? ? A C 257 A G 279 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog103 hydrog ? ? A A 72 N1 ? ? ? 1_555 A U 92 N3 ? ? A A 258 A U 278 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog104 hydrog ? ? A A 72 N6 ? ? ? 1_555 A U 92 O4 ? ? A A 258 A U 278 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog105 hydrog ? ? A U 73 N3 ? ? ? 1_555 A G 91 O6 ? ? A U 259 A G 277 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog106 hydrog ? ? A U 73 O2 ? ? ? 1_555 A G 91 N1 ? ? A U 259 A G 277 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog107 hydrog ? ? A C 74 N3 ? ? ? 1_555 A G 90 N1 ? ? A C 260 A G 276 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog108 hydrog ? ? A C 74 N4 ? ? ? 1_555 A G 90 O6 ? ? A C 260 A G 276 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog109 hydrog ? ? A C 74 O2 ? ? ? 1_555 A G 90 N2 ? ? A C 260 A G 276 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog110 hydrog ? ? A A 75 N1 ? ? ? 1_555 A U 89 N3 ? ? A A 261 A U 275 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog111 hydrog ? ? A A 75 N6 ? ? ? 1_555 A U 89 O4 ? ? A A 261 A U 275 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog112 hydrog ? ? A G 77 N1 ? ? ? 1_555 A C 88 N3 ? ? A G 263 A C 274 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog113 hydrog ? ? A G 77 N2 ? ? ? 1_555 A C 88 O2 ? ? A G 263 A C 274 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog114 hydrog ? ? A G 77 O6 ? ? ? 1_555 A C 88 N4 ? ? A G 263 A C 274 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog115 hydrog ? ? A U 78 N3 ? ? ? 1_555 A G 87 O6 ? ? A U 264 A G 273 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog116 hydrog ? ? A U 78 O2 ? ? ? 1_555 A G 87 N1 ? ? A U 264 A G 273 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog117 hydrog ? ? A C 79 N3 ? ? ? 1_555 A G 86 N1 ? ? A C 265 A G 272 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog118 hydrog ? ? A C 79 N4 ? ? ? 1_555 A G 86 O6 ? ? A C 265 A G 272 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog119 hydrog ? ? A C 79 O2 ? ? ? 1_555 A G 86 N2 ? ? A C 265 A G 272 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog120 hydrog ? ? A U 80 N3 ? ? ? 1_555 A U 85 O4 ? ? A U 266 A U 271 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog121 hydrog ? ? A G 96 N1 ? ? ? 1_555 A C 116 N3 ? ? A G 282 A C 302 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog122 hydrog ? ? A G 96 N2 ? ? ? 1_555 A C 116 O2 ? ? A G 282 A C 302 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog123 hydrog ? ? A G 96 O6 ? ? ? 1_555 A C 116 N4 ? ? A G 282 A C 302 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog124 hydrog ? ? A C 97 N3 ? ? ? 1_555 A G 115 N1 ? ? A C 283 A G 301 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog125 hydrog ? ? A C 97 N4 ? ? ? 1_555 A G 115 O6 ? ? A C 283 A G 301 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog126 hydrog ? ? A C 97 O2 ? ? ? 1_555 A G 115 N2 ? ? A C 283 A G 301 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog127 hydrog ? ? A U 98 N3 ? ? ? 1_555 A G 114 O6 ? ? A U 284 A G 300 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog128 hydrog ? ? A U 98 O2 ? ? ? 1_555 A G 114 N1 ? ? A U 284 A G 300 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog129 hydrog ? ? A C 99 N3 ? ? ? 1_555 A G 113 N1 ? ? A C 285 A G 299 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog130 hydrog ? ? A C 99 N4 ? ? ? 1_555 A G 113 O6 ? ? A C 285 A G 299 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog131 hydrog ? ? A C 99 O2 ? ? ? 1_555 A G 113 N2 ? ? A C 285 A G 299 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog132 hydrog ? ? A C 100 N3 ? ? ? 1_555 A G 112 N1 ? ? A C 286 A G 298 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog133 hydrog ? ? A C 100 N4 ? ? ? 1_555 A G 112 O6 ? ? A C 286 A G 298 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog134 hydrog ? ? A C 100 O2 ? ? ? 1_555 A G 112 N2 ? ? A C 286 A G 298 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog135 hydrog ? ? A U 101 N3 ? ? ? 1_555 A A 111 N1 ? ? A U 287 A A 297 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog136 hydrog ? ? A U 101 O4 ? ? ? 1_555 A A 111 N6 ? ? A U 287 A A 297 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog137 hydrog ? ? A C 102 N3 ? ? ? 1_555 A G 110 N1 ? ? A C 288 A G 296 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog138 hydrog ? ? A C 102 N4 ? ? ? 1_555 A G 110 O6 ? ? A C 288 A G 296 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog139 hydrog ? ? A C 102 O2 ? ? ? 1_555 A G 110 N2 ? ? A C 288 A G 296 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog140 hydrog ? ? A A 103 N1 ? ? ? 1_555 A C 109 N4 ? ? A A 289 A C 295 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog141 hydrog ? ? A A 104 N6 ? ? ? 1_555 A C 109 O2 ? ? A A 290 A C 295 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog142 hydrog ? ? A G 105 N1 ? ? ? 1_555 A C 109 O2 ? ? A G 291 A C 295 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _em_3d_fitting.id 1 _em_3d_fitting.entry_id 8UYE _em_3d_fitting.method ? _em_3d_fitting.target_criteria ? _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_space REAL _em_3d_fitting.ref_protocol OTHER # _em_3d_reconstruction.entry_id 8UYE _em_3d_reconstruction.id 1 _em_3d_reconstruction.method ? _em_3d_reconstruction.algorithm 'FOURIER SPACE' _em_3d_reconstruction.citation_id ? _em_3d_reconstruction.details ? _em_3d_reconstruction.resolution 5.9 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.magnification_calibration ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.num_particles 163382 _em_3d_reconstruction.euler_angles_details ? _em_3d_reconstruction.num_class_averages 1 _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.symmetry_type POINT # _em_buffer.id 1 _em_buffer.specimen_id 1 _em_buffer.name ? _em_buffer.details ? _em_buffer.pH 8.0 # _em_entity_assembly.id 1 _em_entity_assembly.parent_id 0 _em_entity_assembly.source RECOMBINANT _em_entity_assembly.type COMPLEX _em_entity_assembly.name ;BtCoV-HKU5 5' proximal stem-loop 5, conformation 1 ; _em_entity_assembly.details ? _em_entity_assembly.synonym ? _em_entity_assembly.oligomeric_details ? _em_entity_assembly.entity_id_list 1 # _em_image_scans.entry_id 8UYE _em_image_scans.id 1 _em_image_scans.number_digital_images ? _em_image_scans.details ? _em_image_scans.scanner_model ? _em_image_scans.sampling_size ? _em_image_scans.od_range ? _em_image_scans.quant_bit_size ? _em_image_scans.citation_id ? _em_image_scans.dimension_height 4096 _em_image_scans.dimension_width 4096 _em_image_scans.frames_per_image ? _em_image_scans.image_recording_id 1 _em_image_scans.used_frames_per_image ? # _em_imaging.entry_id 8UYE _em_imaging.id 1 _em_imaging.astigmatism ? _em_imaging.electron_beam_tilt_params ? _em_imaging.residual_tilt ? _em_imaging.microscope_model 'TFS KRIOS' _em_imaging.specimen_holder_type ? _em_imaging.specimen_holder_model 'FEI TITAN KRIOS AUTOGRID HOLDER' _em_imaging.details ? _em_imaging.date ? _em_imaging.accelerating_voltage 300 _em_imaging.illumination_mode 'FLOOD BEAM' _em_imaging.mode 'BRIGHT FIELD' _em_imaging.nominal_cs 2.7 _em_imaging.nominal_defocus_min 1000 _em_imaging.nominal_defocus_max 2000 _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_defocus_max ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.nominal_magnification 96000 _em_imaging.calibrated_magnification ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.citation_id ? _em_imaging.temperature ? _em_imaging.detector_distance ? _em_imaging.recording_temperature_minimum ? _em_imaging.recording_temperature_maximum ? _em_imaging.alignment_procedure 'COMA FREE' _em_imaging.c2_aperture_diameter 70 _em_imaging.specimen_id 1 _em_imaging.cryogen NITROGEN # _em_sample_support.id 1 _em_sample_support.film_material ? _em_sample_support.method ? _em_sample_support.grid_material COPPER _em_sample_support.grid_mesh_size 300 _em_sample_support.grid_type 'Quantifoil R1.2/1.3' _em_sample_support.details ? _em_sample_support.specimen_id 1 _em_sample_support.citation_id ? # _em_vitrification.entry_id 8UYE _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.cryogen_name ETHANE _em_vitrification.humidity 100 _em_vitrification.temp ? _em_vitrification.chamber_temperature 278 _em_vitrification.instrument 'FEI VITROBOT MARK IV' _em_vitrification.method ? _em_vitrification.time_resolved_state ? _em_vitrification.citation_id ? _em_vitrification.details ? # _em_experiment.entry_id 8UYE _em_experiment.id 1 _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.aggregation_state PARTICLE _em_experiment.entity_assembly_id 1 # _em_single_particle_entity.entry_id 8UYE _em_single_particle_entity.id 1 _em_single_particle_entity.image_processing_id 1 _em_single_particle_entity.point_symmetry C1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _em_buffer_component.buffer_id _em_buffer_component.concentration _em_buffer_component.concentration_units _em_buffer_component.formula _em_buffer_component.id _em_buffer_component.name 1 50 mM Na-C8H18N2O4S 1 'Sodium HEPES' 1 10 mM MgCl2 2 'Magnesium Chloride' # _em_ctf_correction.details ? _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.id 1 _em_ctf_correction.type 'PHASE FLIPPING AND AMPLITUDE CORRECTION' # _em_entity_assembly_molwt.entity_assembly_id 1 _em_entity_assembly_molwt.experimental_flag NO _em_entity_assembly_molwt.id 1 _em_entity_assembly_molwt.units MEGADALTONS _em_entity_assembly_molwt.value 0.04373 # _em_entity_assembly_naturalsource.cell ? _em_entity_assembly_naturalsource.cellular_location ? _em_entity_assembly_naturalsource.entity_assembly_id 1 _em_entity_assembly_naturalsource.id 2 _em_entity_assembly_naturalsource.ncbi_tax_id 694008 _em_entity_assembly_naturalsource.organism 'Pipistrellus bat coronavirus HKU5' _em_entity_assembly_naturalsource.organelle ? _em_entity_assembly_naturalsource.organ ? _em_entity_assembly_naturalsource.strain ? _em_entity_assembly_naturalsource.tissue ? _em_entity_assembly_naturalsource.details ? # _em_entity_assembly_recombinant.cell ? _em_entity_assembly_recombinant.entity_assembly_id 1 _em_entity_assembly_recombinant.id 2 _em_entity_assembly_recombinant.ncbi_tax_id 32630 _em_entity_assembly_recombinant.organism 'synthetic construct' _em_entity_assembly_recombinant.plasmid ? _em_entity_assembly_recombinant.strain ? # _em_image_processing.details ? _em_image_processing.id 1 _em_image_processing.image_recording_id 1 # _em_image_recording.average_exposure_time 4.10 _em_image_recording.avg_electron_dose_per_subtomogram ? _em_image_recording.avg_electron_dose_per_image 50.0 _em_image_recording.details ;Data was collected in two session, 5,728 images were collected with a 4.74s exposure time, 12,411 images where collected with a 3.81s exposure time. ; _em_image_recording.detector_mode ? _em_image_recording.film_or_detector_model 'FEI FALCON IV (4k x 4k)' _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged 2 _em_image_recording.num_real_images 18139 # _em_particle_selection.details ? _em_particle_selection.id 1 _em_particle_selection.image_processing_id 1 _em_particle_selection.method ? _em_particle_selection.num_particles_selected 5109283 _em_particle_selection.reference_model ? # loop_ _em_software.category _em_software.details _em_software.id _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id _em_software.name _em_software.version 'PARTICLE SELECTION' Template 1 1 ? ? cryoSPARC 3.2.0 'IMAGE ACQUISITION' ? 2 ? ? 1 EPU ? MASKING ? 3 ? ? ? ? ? 'CTF CORRECTION' 'Patch CTF Estimation' 4 1 ? ? cryoSPARC 3.2.0 'LAYERLINE INDEXING' ? 5 ? ? ? ? ? 'DIFFRACTION INDEXING' ? 6 ? ? ? ? ? 'MODEL FITTING' auto-DRRAFTER 7 ? 1 ? Rosetta 2020.42 OTHER ? 8 ? ? ? ? ? 'INITIAL EULER ASSIGNMENT' 'Ab initio reconstruction multi-class' 9 1 ? ? cryoSPARC 3.2.0 'FINAL EULER ASSIGNMENT' 'Non-uniform Refinement' 10 1 ? ? cryoSPARC 3.2.0 CLASSIFICATION '3D variability' 11 1 ? ? cryoSPARC 3.2.0 RECONSTRUCTION 'Non-uniform Refinement' 12 1 ? ? cryoSPARC 3.2.0 'MODEL REFINEMENT' phenix.real_space_refine 13 ? 1 ? ERRASER 2 'VOLUME SELECTION' ? 14 1 1 1 ? ? 'SERIES ALIGNMENT' ? 15 1 1 1 ? ? 'MOLECULAR REPLACEMENT' ? 16 1 1 1 ? ? 'LATTICE DISTORTION CORRECTION' ? 17 1 1 1 ? ? 'SYMMETRY DETERMINATION' ? 18 1 1 1 ? ? 'CRYSTALLOGRAPHY MERGING' ? 19 1 1 1 ? ? # _em_specimen.concentration 1.31 _em_specimen.details ? _em_specimen.embedding_applied NO _em_specimen.experiment_id 1 _em_specimen.id 1 _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8UYE 'double helix' 8UYE 'a-form double helix' 8UYE 'hairpin loop' 8UYE tetraloop 8UYE 'bulge loop' 8UYE 'mismatched base pair' 8UYE 'internal loop' 8UYE 'triple helix' 8UYE 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 135 1_555 -0.168 -0.062 -0.018 3.237 -0.578 -4.191 1 A_G187:C321_A A 187 ? A 321 ? 19 1 1 A G 2 1_555 A C 134 1_555 -0.264 -0.193 -0.251 1.470 -9.822 -0.169 2 A_G188:C320_A A 188 ? A 320 ? 19 1 1 A A 3 1_555 A U 133 1_555 -0.064 -0.156 -0.337 -3.969 -11.709 -2.888 3 A_A189:U319_A A 189 ? A 319 ? 20 1 1 A G 4 1_555 A C 132 1_555 -0.111 -0.161 -0.118 -5.753 -11.441 -3.033 4 A_G190:C318_A A 190 ? A 318 ? 19 1 1 A C 5 1_555 A G 131 1_555 -0.098 0.006 0.159 0.987 -3.642 -9.197 5 A_C191:G317_A A 191 ? A 317 ? 19 1 1 A U 7 1_555 A A 130 1_555 0.017 -0.228 0.711 -4.574 -6.577 -4.462 6 A_U193:A316_A A 193 ? A 316 ? 20 1 1 A C 8 1_555 A G 129 1_555 -0.108 -0.050 0.264 6.789 -9.047 -9.281 7 A_C194:G315_A A 194 ? A 315 ? 19 1 1 A U 10 1_555 A A 128 1_555 0.079 -0.238 0.758 -11.447 -13.161 1.174 8 A_U196:A314_A A 196 ? A 314 ? 20 1 1 A G 11 1_555 A C 127 1_555 -0.029 -0.139 0.317 -8.536 -13.429 -5.422 9 A_G197:C313_A A 197 ? A 313 ? 19 1 1 A C 13 1_555 A G 126 1_555 0.209 -0.066 -0.613 15.607 -10.054 0.653 10 A_C199:G312_A A 199 ? A 312 ? 19 1 1 A U 14 1_555 A A 125 1_555 0.087 -0.226 -0.519 -2.679 -10.292 1.754 11 A_U200:A311_A A 200 ? A 311 ? 20 1 1 A C 15 1_555 A G 124 1_555 -0.088 -0.011 0.173 -8.511 0.301 -5.111 12 A_C201:G310_A A 201 ? A 310 ? 19 1 1 A A 16 1_555 A A 123 1_555 -1.876 1.496 -0.297 -0.133 -8.579 -16.675 13 A_A202:A309_A A 202 ? A 309 ? ? 1 1 A G 18 1_555 A U 122 1_555 -1.765 -0.557 1.037 8.299 -11.922 -19.058 14 A_G204:U308_A A 204 ? A 308 ? 28 1 1 A U 19 1_555 A A 121 1_555 -0.175 -0.231 0.578 4.953 -17.263 -9.488 15 A_U205:A307_A A 205 ? A 307 ? 20 1 1 A G 20 1_555 A U 120 1_555 -1.804 -0.408 0.338 7.468 -12.706 -6.929 16 A_G206:U306_A A 206 ? A 306 ? 28 1 1 A C 21 1_555 A G 119 1_555 0.043 -0.100 0.114 8.812 -14.322 -2.908 17 A_C207:G305_A A 207 ? A 305 ? 19 1 1 A U 22 1_555 A A 118 1_555 0.020 -0.150 -0.054 7.749 -18.936 -3.345 18 A_U208:A304_A A 208 ? A 304 ? 20 1 1 A U 23 1_555 A A 117 1_555 -0.023 -0.132 -0.096 -3.923 -26.127 -3.174 19 A_U209:A303_A A 209 ? A 303 ? 20 1 1 A G 96 1_555 A C 116 1_555 -0.114 -0.148 -0.097 1.799 -9.790 -7.256 20 A_G282:C302_A A 282 ? A 302 ? 19 1 1 A C 97 1_555 A G 115 1_555 0.148 -0.219 -0.298 0.623 -13.729 -0.831 21 A_C283:G301_A A 283 ? A 301 ? 19 1 1 A U 98 1_555 A G 114 1_555 1.907 -0.419 -0.098 -3.857 -7.812 -2.583 22 A_U284:G300_A A 284 ? A 300 ? 28 1 1 A C 99 1_555 A G 113 1_555 0.243 -0.199 -0.348 0.905 -6.068 -0.156 23 A_C285:G299_A A 285 ? A 299 ? 19 1 1 A C 100 1_555 A G 112 1_555 0.105 -0.168 -0.415 1.681 -3.969 -1.964 24 A_C286:G298_A A 286 ? A 298 ? 19 1 1 A U 101 1_555 A A 111 1_555 0.033 -0.120 -0.384 0.960 -3.281 -4.045 25 A_U287:A297_A A 287 ? A 297 ? 20 1 1 A C 102 1_555 A G 110 1_555 0.028 -0.021 -0.220 1.177 -1.922 -3.492 26 A_C288:G296_A A 288 ? A 296 ? 19 1 1 A A 103 1_555 A C 109 1_555 1.877 0.313 -0.429 -4.562 -4.300 -4.128 27 A_A289:C295_A A 289 ? A 295 ? ? 1 1 A C 64 1_555 A G 27 1_555 -0.243 0.109 -0.025 2.322 7.611 -6.870 28 A_C250:G213_A A 250 ? A 213 ? 19 1 1 A G 66 1_555 A C 26 1_555 -0.295 -0.286 0.844 2.896 -7.584 -0.509 29 A_G252:C212_A A 252 ? A 212 ? 19 1 1 A U 67 1_555 A A 25 1_555 -0.163 -0.160 0.224 9.803 -14.981 -6.054 30 A_U253:A211_A A 253 ? A 211 ? 20 1 1 A G 68 1_555 A C 24 1_555 -0.162 -0.137 -0.083 -4.365 -16.920 -2.584 31 A_G254:C210_A A 254 ? A 210 ? 19 1 1 A C 69 1_555 A G 95 1_555 -0.087 -0.147 0.209 4.820 -11.382 -4.740 32 A_C255:G281_A A 255 ? A 281 ? 19 1 1 A A 70 1_555 A U 94 1_555 -0.089 -0.096 -0.096 3.673 -11.869 -5.554 33 A_A256:U280_A A 256 ? A 280 ? 20 1 1 A C 71 1_555 A G 93 1_555 0.101 -0.163 -0.044 5.140 -12.042 -2.272 34 A_C257:G279_A A 257 ? A 279 ? 19 1 1 A A 72 1_555 A U 92 1_555 0.059 -0.080 -0.169 -5.026 -13.702 -4.180 35 A_A258:U278_A A 258 ? A 278 ? 20 1 1 A U 73 1_555 A G 91 1_555 1.868 -0.383 0.011 -5.423 -11.816 -3.128 36 A_U259:G277_A A 259 ? A 277 ? 28 1 1 A C 74 1_555 A G 90 1_555 0.133 -0.180 0.088 -2.347 -10.144 -2.349 37 A_C260:G276_A A 260 ? A 276 ? 19 1 1 A A 75 1_555 A U 89 1_555 0.152 0.022 -0.003 -0.549 -5.852 -10.361 38 A_A261:U275_A A 261 ? A 275 ? 20 1 1 A G 77 1_555 A C 88 1_555 -0.103 -0.169 -0.496 -2.450 -10.522 -2.479 39 A_G263:C274_A A 263 ? A 274 ? 19 1 1 A U 78 1_555 A G 87 1_555 1.980 -0.540 -0.370 -2.985 -10.118 -2.683 40 A_U264:G273_A A 264 ? A 273 ? 28 1 1 A C 79 1_555 A G 86 1_555 0.334 -0.236 -0.386 -7.626 0.951 -2.097 41 A_C265:G272_A A 265 ? A 272 ? 19 1 1 A U 80 1_555 A U 85 1_555 3.312 -1.181 -0.276 -8.783 10.482 -32.167 42 A_U266:U271_A A 266 ? A 271 ? ? ? 1 A G 28 1_555 A C 59 1_555 -0.178 -0.187 -0.398 -6.941 -9.939 -2.504 43 A_G214:C245_A A 214 ? A 245 ? 19 1 1 A U 29 1_555 A G 58 1_555 1.911 -0.450 -0.139 -4.621 -9.124 -3.058 44 A_U215:G244_A A 215 ? A 244 ? 28 1 1 A C 30 1_555 A G 57 1_555 0.222 -0.209 -0.109 -1.834 -9.066 -0.883 45 A_C216:G243_A A 216 ? A 243 ? 19 1 1 A A 31 1_555 A U 56 1_555 0.227 -0.088 -0.051 -9.279 -13.608 -7.216 46 A_A217:U242_A A 217 ? A 242 ? 20 1 1 A C 32 1_555 A G 55 1_555 -0.066 -0.001 0.256 -5.319 -12.736 -8.656 47 A_C218:G241_A A 218 ? A 241 ? 19 1 1 A A 33 1_555 A C 54 1_555 2.496 0.425 -0.359 -14.715 -12.326 -20.354 48 A_A219:C240_A A 219 ? A 240 ? ? ? 1 A U 35 1_555 A G 53 1_555 1.345 -0.304 -1.031 -8.362 -9.715 -31.186 49 A_U221:G239_A A 221 ? A 239 ? ? ? 1 A A 36 1_555 A U 52 1_555 0.143 -0.110 0.547 -9.931 -3.786 -11.074 50 A_A222:U238_A A 222 ? A 238 ? 20 1 1 A U 37 1_555 A G 51 1_555 2.124 -0.578 0.663 1.793 2.071 -6.965 51 A_U223:G237_A A 223 ? A 237 ? 28 1 1 A C 39 1_555 A G 50 1_555 -0.015 -0.173 0.539 3.579 -2.259 -4.255 52 A_C225:G236_A A 225 ? A 236 ? 19 1 1 A C 40 1_555 A G 49 1_555 0.060 -0.146 -0.039 10.298 -11.900 -3.367 53 A_C226:G235_A A 226 ? A 235 ? 19 1 1 A G 41 1_555 A C 48 1_555 -0.092 -0.191 -0.324 -1.324 -8.561 0.287 54 A_G227:C234_A A 227 ? A 234 ? 19 1 1 A U 42 1_555 A U 47 1_555 2.565 -1.564 0.304 -4.792 -2.754 -3.278 55 A_U228:U233_A A 228 ? A 233 ? 16 1 1 A U 43 1_555 A G 46 1_555 0.394 -2.375 -1.028 -54.090 -19.948 -95.836 56 A_U229:G232_A A 229 ? A 232 ? 28 2 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 135 1_555 A G 2 1_555 A C 134 1_555 0.060 -1.928 3.508 0.218 10.293 30.886 -5.210 -0.069 2.741 18.687 -0.395 32.517 1 AA_G187G188:C320C321_AA A 187 ? A 321 ? A 188 ? A 320 ? 1 A G 2 1_555 A C 134 1_555 A A 3 1_555 A U 133 1_555 -0.303 -1.723 3.546 -0.396 12.796 32.585 -4.785 0.446 2.703 21.786 0.674 34.947 2 AA_G188A189:U319C320_AA A 188 ? A 320 ? A 189 ? A 319 ? 1 A A 3 1_555 A U 133 1_555 A G 4 1_555 A C 132 1_555 -0.073 -1.680 3.414 -1.338 12.481 31.475 -4.806 -0.080 2.582 21.946 2.353 33.827 3 AA_A189G190:C318U319_AA A 189 ? A 319 ? A 190 ? A 318 ? 1 A G 4 1_555 A C 132 1_555 A C 5 1_555 A G 131 1_555 -0.273 -1.702 3.298 -1.223 6.232 32.319 -4.026 0.281 2.936 11.063 2.170 32.921 4 AA_G190C191:G317C318_AA A 190 ? A 318 ? A 191 ? A 317 ? 1 A C 5 1_555 A G 131 1_555 A U 7 1_555 A A 130 1_555 -0.871 -2.549 5.732 21.572 15.661 44.850 -4.607 3.327 3.930 18.707 -25.768 51.820 5 AA_C191U193:A316G317_AA A 191 ? A 317 ? A 193 ? A 316 ? 1 A U 7 1_555 A A 130 1_555 A C 8 1_555 A G 129 1_555 0.086 -1.619 3.070 3.636 5.604 30.892 -3.907 0.447 2.733 10.369 -6.727 31.589 6 AA_U193C194:G315A316_AA A 193 ? A 316 ? A 194 ? A 315 ? 1 A C 8 1_555 A G 129 1_555 A U 10 1_555 A A 128 1_555 -0.748 -2.544 5.956 20.496 16.849 48.368 -4.470 2.886 4.305 19.001 -23.114 54.781 7 AA_C194U196:A314G315_AA A 194 ? A 315 ? A 196 ? A 314 ? 1 A U 10 1_555 A A 128 1_555 A G 11 1_555 A C 127 1_555 -0.219 -1.625 3.130 3.511 13.608 31.340 -4.589 0.845 2.218 23.753 -6.128 34.274 8 AA_U196G197:C313A314_AA A 196 ? A 314 ? A 197 ? A 313 ? 1 A G 11 1_555 A C 127 1_555 A C 13 1_555 A G 126 1_555 -0.616 -1.476 3.072 12.994 13.533 40.012 -3.052 1.861 2.194 18.592 -17.852 44.028 9 AA_G197C199:G312C313_AA A 197 ? A 313 ? A 199 ? A 312 ? 1 A C 13 1_555 A G 126 1_555 A U 14 1_555 A A 125 1_555 -0.176 -2.092 3.868 -0.263 18.229 32.115 -5.857 0.243 2.381 30.114 0.434 36.809 10 AA_C199U200:A311G312_AA A 199 ? A 312 ? A 200 ? A 311 ? 1 A U 14 1_555 A A 125 1_555 A C 15 1_555 A G 124 1_555 -0.457 -1.904 3.656 -2.272 13.265 31.035 -5.451 0.414 2.669 23.457 4.018 33.761 11 AA_U200C201:G310A311_AA A 200 ? A 311 ? A 201 ? A 310 ? 1 A C 15 1_555 A G 124 1_555 A A 16 1_555 A A 123 1_555 -0.621 -1.788 3.213 5.166 7.208 23.365 -6.034 2.797 2.374 17.031 -12.207 24.970 12 AA_C201A202:A309G310_AA A 201 ? A 310 ? A 202 ? A 309 ? 1 A A 16 1_555 A A 123 1_555 A G 18 1_555 A U 122 1_555 -1.710 -2.849 4.881 9.024 18.807 44.190 -5.320 2.970 3.111 23.509 -11.281 48.642 13 AA_A202G204:U308A309_AA A 202 ? A 309 ? A 204 ? A 308 ? 1 A G 18 1_555 A U 122 1_555 A U 19 1_555 A A 121 1_555 0.429 -1.532 3.608 0.200 12.176 40.363 -3.443 -0.575 3.044 17.180 -0.282 42.086 14 AA_G204U205:A307U308_AA A 204 ? A 308 ? A 205 ? A 307 ? 1 A U 19 1_555 A A 121 1_555 A G 20 1_555 A U 120 1_555 0.057 -1.856 3.021 -2.214 13.622 27.299 -5.678 -0.458 1.891 26.800 4.355 30.530 15 AA_U205G206:U306A307_AA A 205 ? A 307 ? A 206 ? A 306 ? 1 A G 20 1_555 A U 120 1_555 A C 21 1_555 A G 119 1_555 0.174 -1.445 3.451 -0.212 6.713 38.155 -3.017 -0.289 3.161 10.173 0.321 38.720 16 AA_G206C207:G305U306_AA A 206 ? A 306 ? A 207 ? A 305 ? 1 A C 21 1_555 A G 119 1_555 A U 22 1_555 A A 118 1_555 0.048 -1.647 3.390 1.267 6.894 31.275 -4.207 0.138 2.968 12.590 -2.313 32.031 17 AA_C207U208:A304G305_AA A 207 ? A 305 ? A 208 ? A 304 ? 1 A U 22 1_555 A A 118 1_555 A U 23 1_555 A A 117 1_555 0.091 -1.607 3.639 1.818 9.410 33.906 -4.130 0.133 3.097 15.749 -3.043 35.196 18 AA_U208U209:A303A304_AA A 208 ? A 304 ? A 209 ? A 303 ? 1 A U 23 1_555 A A 117 1_555 A G 96 1_555 A C 116 1_555 0.842 -1.920 3.299 5.638 21.902 24.522 -6.379 -0.693 1.344 41.910 -10.788 33.241 19 AA_U209G282:C302A303_AA A 209 ? A 303 ? A 282 ? A 302 ? 1 A G 96 1_555 A C 116 1_555 A C 97 1_555 A G 115 1_555 0.269 -1.801 3.404 0.573 7.504 35.130 -3.979 -0.355 2.972 12.259 -0.935 35.903 20 AA_G282C283:G301C302_AA A 282 ? A 302 ? A 283 ? A 301 ? 1 A C 97 1_555 A G 115 1_555 A U 98 1_555 A G 114 1_555 0.071 -1.508 3.558 1.096 10.647 38.158 -3.512 0.027 3.047 15.908 -1.638 39.577 21 AA_C283U284:G300G301_AA A 283 ? A 301 ? A 284 ? A 300 ? 1 A U 98 1_555 A G 114 1_555 A C 99 1_555 A G 113 1_555 0.246 -2.026 3.185 4.471 9.585 23.776 -6.786 0.516 2.223 21.927 -10.229 25.991 22 AA_U284C285:G299G300_AA A 284 ? A 300 ? A 285 ? A 299 ? 1 A C 99 1_555 A G 113 1_555 A C 100 1_555 A G 112 1_555 -0.046 -1.842 3.425 0.999 11.069 28.417 -5.593 0.276 2.542 21.535 -1.943 30.472 23 AA_C285C286:G298G299_AA A 285 ? A 299 ? A 286 ? A 298 ? 1 A C 100 1_555 A G 112 1_555 A U 101 1_555 A A 111 1_555 0.006 -1.878 3.515 0.474 12.470 29.028 -5.687 0.074 2.514 23.553 -0.895 31.544 24 AA_C286U287:A297G298_AA A 286 ? A 298 ? A 287 ? A 297 ? 1 A U 101 1_555 A A 111 1_555 A C 102 1_555 A G 110 1_555 0.256 -1.951 3.503 0.254 10.875 30.045 -5.469 -0.422 2.655 20.165 -0.471 31.911 25 AA_U287C288:G296A297_AA A 287 ? A 297 ? A 288 ? A 296 ? 1 A C 102 1_555 A G 110 1_555 A A 103 1_555 A C 109 1_555 0.102 -1.743 3.807 3.738 5.300 35.436 -3.670 0.434 3.511 8.618 -6.079 36.006 26 AA_C288A289:C295G296_AA A 288 ? A 296 ? A 289 ? A 295 ? 1 A C 64 1_555 A G 27 1_555 A G 66 1_555 A C 26 1_555 -1.191 -2.397 5.962 18.729 4.720 41.785 -3.783 4.331 4.758 6.234 -24.735 45.851 27 AA_C250G252:C212G213_AA A 250 ? A 213 ? A 252 ? A 212 ? 1 A G 66 1_555 A C 26 1_555 A U 67 1_555 A A 25 1_555 -0.229 -1.644 3.383 3.029 0.779 29.841 -3.341 1.081 3.301 1.508 -5.861 30.000 28 AA_G252U253:A211C212_AA A 252 ? A 212 ? A 253 ? A 211 ? 1 A U 67 1_555 A A 25 1_555 A G 68 1_555 A C 24 1_555 0.286 -1.811 3.681 1.395 12.156 33.487 -4.796 -0.258 2.880 20.275 -2.327 35.592 29 AA_U253G254:C210A211_AA A 253 ? A 211 ? A 254 ? A 210 ? 1 A G 68 1_555 A C 24 1_555 A C 69 1_555 A G 95 1_555 0.989 -1.198 3.175 -2.326 0.945 41.244 -1.794 -1.641 3.090 1.340 3.298 41.317 30 AA_G254C255:G281C210_AA A 254 ? A 210 ? A 255 ? A 281 ? 1 A C 69 1_555 A G 95 1_555 A A 70 1_555 A U 94 1_555 -0.227 -1.666 3.369 0.507 12.954 30.848 -4.900 0.474 2.485 23.115 -0.904 33.400 31 AA_C255A256:U280G281_AA A 255 ? A 281 ? A 256 ? A 280 ? 1 A A 70 1_555 A U 94 1_555 A C 71 1_555 A G 93 1_555 0.170 -1.642 3.428 -0.483 8.444 31.512 -4.372 -0.386 2.899 15.208 0.871 32.600 32 AA_A256C257:G279U280_AA A 256 ? A 280 ? A 257 ? A 279 ? 1 A C 71 1_555 A G 93 1_555 A A 72 1_555 A U 92 1_555 0.001 -1.778 3.577 1.061 15.428 31.686 -5.190 0.152 2.472 26.380 -1.815 35.171 33 AA_C257A258:U278G279_AA A 257 ? A 279 ? A 258 ? A 278 ? 1 A A 72 1_555 A U 92 1_555 A U 73 1_555 A G 91 1_555 0.133 -1.557 3.497 0.667 7.223 37.604 -3.307 -0.117 3.158 11.079 -1.024 38.272 34 AA_A258U259:G277U278_AA A 258 ? A 278 ? A 259 ? A 277 ? 1 A U 73 1_555 A G 91 1_555 A C 74 1_555 A G 90 1_555 0.018 -1.981 3.167 2.866 10.994 24.610 -6.584 0.575 2.094 24.212 -6.312 27.069 35 AA_U259C260:G276G277_AA A 259 ? A 277 ? A 260 ? A 276 ? 1 A C 74 1_555 A G 90 1_555 A A 75 1_555 A U 89 1_555 -0.487 -1.570 3.333 1.463 15.994 30.929 -4.845 1.017 2.250 27.768 -2.539 34.760 36 AA_C260A261:U275G276_AA A 260 ? A 276 ? A 261 ? A 275 ? 1 A A 75 1_555 A U 89 1_555 A G 77 1_555 A C 88 1_555 -0.875 -1.553 3.408 1.156 10.699 40.952 -3.229 1.329 2.906 14.982 -1.619 42.283 37 AA_A261G263:C274U275_AA A 261 ? A 275 ? A 263 ? A 274 ? 1 A G 77 1_555 A C 88 1_555 A U 78 1_555 A G 87 1_555 0.046 -1.651 3.465 0.604 5.674 40.665 -2.988 0.001 3.217 8.116 -0.863 41.046 38 AA_G263U264:G273C274_AA A 263 ? A 274 ? A 264 ? A 273 ? 1 A U 78 1_555 A G 87 1_555 A C 79 1_555 A G 86 1_555 0.176 -2.213 3.546 3.644 9.563 25.419 -6.975 0.503 2.560 20.694 -7.885 27.370 39 AA_U264C265:G272G273_AA A 264 ? A 273 ? A 265 ? A 272 ? 1 A C 79 1_555 A G 86 1_555 A U 80 1_555 A U 85 1_555 -1.584 -1.827 3.790 5.204 13.773 41.927 -3.766 2.607 2.875 18.574 -7.017 44.327 40 AA_C265U266:U271G272_AA A 265 ? A 272 ? A 266 ? A 271 ? 1 A G 28 1_555 A C 59 1_555 A U 29 1_555 A G 58 1_555 0.027 -1.541 3.388 0.233 7.386 39.956 -3.038 -0.012 3.067 10.698 -0.338 40.606 41 AA_G214U215:G244C245_AA A 214 ? A 245 ? A 215 ? A 244 ? 1 A U 29 1_555 A G 58 1_555 A C 30 1_555 A G 57 1_555 0.238 -2.022 3.197 3.801 9.398 24.751 -6.513 0.350 2.298 20.841 -8.430 26.717 42 AA_U215C216:G243G244_AA A 215 ? A 244 ? A 216 ? A 243 ? 1 A C 30 1_555 A G 57 1_555 A A 31 1_555 A U 56 1_555 -0.178 -1.735 3.673 1.230 9.338 30.873 -4.863 0.550 3.024 17.051 -2.246 32.244 43 AA_C216A217:U242G243_AA A 216 ? A 243 ? A 217 ? A 242 ? 1 A A 31 1_555 A U 56 1_555 A C 32 1_555 A G 55 1_555 -0.008 -1.808 3.399 -0.128 -0.736 31.059 -3.229 -0.011 3.440 -1.374 0.240 31.068 44 AA_A217C218:G241U242_AA A 217 ? A 242 ? A 218 ? A 241 ? 1 A C 32 1_555 A G 55 1_555 A A 33 1_555 A C 54 1_555 -0.645 -1.555 3.815 6.717 10.035 41.854 -3.167 1.586 3.241 13.708 -9.176 43.486 45 AA_C218A219:C240G241_AA A 218 ? A 241 ? A 219 ? A 240 ? 1 A A 33 1_555 A C 54 1_555 A U 35 1_555 A G 53 1_555 -3.197 -1.533 2.897 1.734 6.652 48.029 -2.297 4.005 2.566 8.123 -2.118 48.490 46 AA_A219U221:G239C240_AA A 219 ? A 240 ? A 221 ? A 239 ? 1 A U 35 1_555 A G 53 1_555 A A 36 1_555 A U 52 1_555 1.235 -1.866 3.505 -5.539 10.675 29.525 -5.244 -3.207 2.435 19.936 10.345 31.830 47 AA_U221A222:U238G239_AA A 221 ? A 239 ? A 222 ? A 238 ? 1 A A 36 1_555 A U 52 1_555 A U 37 1_555 A G 51 1_555 0.408 -1.572 3.281 0.267 3.115 37.222 -2.859 -0.602 3.146 4.870 -0.418 37.348 48 AA_A222U223:G237U238_AA A 222 ? A 238 ? A 223 ? A 237 ? 1 A U 37 1_555 A G 51 1_555 A C 39 1_555 A G 50 1_555 -2.394 -1.300 4.603 17.355 20.360 45.922 -3.085 4.076 2.821 23.870 -20.347 52.779 49 AA_U223C225:G236G237_AA A 223 ? A 237 ? A 225 ? A 236 ? 1 A C 39 1_555 A G 50 1_555 A C 40 1_555 A G 49 1_555 0.208 -1.675 3.306 3.293 6.487 30.618 -4.259 0.209 2.904 12.072 -6.129 31.451 50 AA_C225C226:G235G236_AA A 225 ? A 236 ? A 226 ? A 235 ? 1 A C 40 1_555 A G 49 1_555 A G 41 1_555 A C 48 1_555 0.253 -1.848 3.805 0.270 12.236 29.837 -5.643 -0.405 2.848 22.604 -0.498 32.197 51 AA_C226G227:C234G235_AA A 226 ? A 235 ? A 227 ? A 234 ? 1 A G 41 1_555 A C 48 1_555 A U 42 1_555 A U 47 1_555 -0.140 -1.492 3.733 -2.317 11.825 41.165 -3.323 -0.059 3.208 16.399 3.213 42.819 52 AA_G227U228:U233C234_AA A 227 ? A 234 ? A 228 ? A 233 ? 1 A U 42 1_555 A U 47 1_555 A U 43 1_555 A G 46 1_555 -5.170 0.096 -2.307 101.977 122.480 23.536 1.931 1.059 -3.642 67.532 -56.227 159.814 53 AA_U228U229:G232U233_AA A 228 ? A 233 ? A 229 ? A 232 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R35GM122579 1 'Howard Hughes Medical Institute (HHMI)' 'United States' ? 2 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' U24GM129541 3 'National Science Foundation (NSF, United States)' 'United States' GRFPDGE1656518 4 'Other government' ? 'National Key R&D Program of China 2022YFC2303700' 5 'Other government' ? 'National Key R&D Program of China 2022YFA1302700' 6 'Other private' ? 'BioX Bowes fellowship' 7 'Other private' ? 'BioX Interdisciplinary Initiative Program' 8 'Other private' ? 'ChEM-H COVID-19 Drug and Vaccine Prototyping seed grant' 9 'Department of Energy (DOE, United States)' 'United States' 'Coronavirus CARES Act' 10 'National Institutes of Health/National Institute Of Allergy and Infectious Diseases (NIH/NIAID)' 'United States' '#U19AI171421' 11 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code ? _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 8UYE _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_