data_8UYK # _entry.id 8UYK # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.388 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8UYK pdb_00008uyk 10.2210/pdb8uyk/pdb WWPDB D_1000279169 ? ? EMDB EMD-42809 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-12-06 2 'Structure model' 1 1 2023-12-27 3 'Structure model' 1 2 2024-03-13 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 3 'Structure model' citation 3 3 'Structure model' citation_author # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.pdbx_database_id_PubMed' 2 2 'Structure model' '_citation.title' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8UYK _pdbx_database_status.recvd_initial_deposition_date 2023-11-13 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _pdbx_database_related.db_name _pdbx_database_related.details _pdbx_database_related.db_id _pdbx_database_related.content_type EMDB . EMD-42801 'other EM volume' EMDB . EMD-42805 'other EM volume' EMDB . EMD-42802 'other EM volume' EMDB . EMD-42808 'other EM volume' EMDB . EMD-42803 'other EM volume' PDB . 8UYE unspecified PDB . 8UYG unspecified PDB . 8UYJ unspecified EMDB ;MERS 5' proximal stem-loop 5, conformation 1 ; EMD-42809 'associated EM volume' # loop_ _pdbx_contact_author.id _pdbx_contact_author.email _pdbx_contact_author.name_first _pdbx_contact_author.name_last _pdbx_contact_author.name_mi _pdbx_contact_author.role _pdbx_contact_author.identifier_ORCID 2 rhiju@stanford.edu Rhiju Das ? 'principal investigator/group leader' 0000-0001-7497-0972 3 wahc@stanford.edu Wah Chiu ? 'principal investigator/group leader' 0000-0002-8910-3078 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kretsch, R.C.' 1 0000-0002-6935-518X 'Xu, L.' 2 0000-0002-1200-8937 'Zheludev, I.N.' 3 0000-0002-9572-0574 'Zhou, X.' 4 0000-0002-0722-7334 'Huang, R.' 5 0009-0009-6136-8013 'Nye, G.' 6 0009-0001-6698-9988 'Li, S.' 7 0000-0002-7041-5960 'Zhang, K.' 8 0000-0003-0414-4776 'Chiu, W.' 9 0000-0002-8910-3078 'Das, R.' 10 0000-0001-7497-0972 # loop_ _citation.abstract _citation.abstract_id_CAS _citation.book_id_ISBN _citation.book_publisher _citation.book_publisher_city _citation.book_title _citation.coordinate_linkage _citation.country _citation.database_id_Medline _citation.details _citation.id _citation.journal_abbrev _citation.journal_id_ASTM _citation.journal_id_CSD _citation.journal_id_ISSN _citation.journal_full _citation.journal_issue _citation.journal_volume _citation.language _citation.page_first _citation.page_last _citation.title _citation.year _citation.database_id_CSD _citation.pdbx_database_id_DOI _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_patent _citation.unpublished_flag ? ? ? ? ? ? ? US ? ? primary Proc.Natl.Acad.Sci.USA PNASA6 0040 1091-6490 ? ? 121 ? e2320493121 e2320493121 ;Tertiary folds of the SL5 RNA from the 5' proximal region of SARS-CoV-2 and related coronaviruses. ; 2024 ? 10.1073/pnas.2320493121 38427602 ? ? ? ? ? ? ? ? ? US ? ? 1 Biorxiv ? ? 2692-8205 ? ? ? ? ? ? ;Tertiary folds of the SL5 RNA from the 5' proximal region of SARS-CoV-2 and related coronaviruses. ; 2023 ? 10.1101/2023.11.22.567964 38076883 ? ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Kretsch, R.C.' 1 0000-0002-6935-518X primary 'Xu, L.' 2 0000-0002-1200-8937 primary 'Zheludev, I.N.' 3 ? primary 'Zhou, X.' 4 0000-0002-0722-7334 primary 'Huang, R.' 5 ? primary 'Nye, G.' 6 ? primary 'Li, S.' 7 ? primary 'Zhang, K.' 8 ? primary 'Chiu, W.' 9 0000-0002-8910-3078 primary 'Das, R.' 10 0000-0001-7497-0972 1 'Kretsch, R.C.' 11 ? 1 'Xu, L.' 12 ? 1 'Zheludev, I.N.' 13 ? 1 'Zhou, X.' 14 ? 1 'Huang, R.' 15 ? 1 'Nye, G.' 16 ? 1 'Li, S.' 17 ? 1 'Zhang, K.' 18 ? 1 'Chiu, W.' 19 ? 1 'Das, R.' 20 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description ;MERS 5' proximal stem-loop 5 ; _entity.formula_weight 43445.586 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGAGCGUCGUGUCUCUUGUACGUCUCGGUCACAAUACACGGUUUCGUCCGGUGCGUGGCAAUUCGGGGCACAUCAUGUCU UUCGUGGCUGGUGUGACCGCGCAAGGUGCGCGCGGUACGUAUCGAGCAGCGCUCC ; _entity_poly.pdbx_seq_one_letter_code_can ;GGAGCGUCGUGUCUCUUGUACGUCUCGGUCACAAUACACGGUUUCGUCCGGUGCGUGGCAAUUCGGGGCACAUCAUGUCU UUCGUGGCUGGUGUGACCGCGCAAGGUGCGCGCGGUACGUAUCGAGCAGCGCUCC ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 G n 1 5 C n 1 6 G n 1 7 U n 1 8 C n 1 9 G n 1 10 U n 1 11 G n 1 12 U n 1 13 C n 1 14 U n 1 15 C n 1 16 U n 1 17 U n 1 18 G n 1 19 U n 1 20 A n 1 21 C n 1 22 G n 1 23 U n 1 24 C n 1 25 U n 1 26 C n 1 27 G n 1 28 G n 1 29 U n 1 30 C n 1 31 A n 1 32 C n 1 33 A n 1 34 A n 1 35 U n 1 36 A n 1 37 C n 1 38 A n 1 39 C n 1 40 G n 1 41 G n 1 42 U n 1 43 U n 1 44 U n 1 45 C n 1 46 G n 1 47 U n 1 48 C n 1 49 C n 1 50 G n 1 51 G n 1 52 U n 1 53 G n 1 54 C n 1 55 G n 1 56 U n 1 57 G n 1 58 G n 1 59 C n 1 60 A n 1 61 A n 1 62 U n 1 63 U n 1 64 C n 1 65 G n 1 66 G n 1 67 G n 1 68 G n 1 69 C n 1 70 A n 1 71 C n 1 72 A n 1 73 U n 1 74 C n 1 75 A n 1 76 U n 1 77 G n 1 78 U n 1 79 C n 1 80 U n 1 81 U n 1 82 U n 1 83 C n 1 84 G n 1 85 U n 1 86 G n 1 87 G n 1 88 C n 1 89 U n 1 90 G n 1 91 G n 1 92 U n 1 93 G n 1 94 U n 1 95 G n 1 96 A n 1 97 C n 1 98 C n 1 99 G n 1 100 C n 1 101 G n 1 102 C n 1 103 A n 1 104 A n 1 105 G n 1 106 G n 1 107 U n 1 108 G n 1 109 C n 1 110 G n 1 111 C n 1 112 G n 1 113 C n 1 114 G n 1 115 G n 1 116 U n 1 117 A n 1 118 C n 1 119 G n 1 120 U n 1 121 A n 1 122 U n 1 123 C n 1 124 G n 1 125 A n 1 126 G n 1 127 C n 1 128 A n 1 129 G n 1 130 C n 1 131 G n 1 132 C n 1 133 U n 1 134 C n 1 135 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 135 _pdbx_entity_src_syn.organism_scientific 'Middle East respiratory syndrome-related coronavirus' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 1335626 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 205 205 G G A . n A 1 2 G 2 206 206 G G A . n A 1 3 A 3 207 207 A A A . n A 1 4 G 4 208 208 G G A . n A 1 5 C 5 209 209 C C A . n A 1 6 G 6 210 210 G G A . n A 1 7 U 7 211 211 U U A . n A 1 8 C 8 212 212 C C A . n A 1 9 G 9 213 213 G G A . n A 1 10 U 10 214 214 U U A . n A 1 11 G 11 215 215 G G A . n A 1 12 U 12 216 216 U U A . n A 1 13 C 13 217 217 C C A . n A 1 14 U 14 218 218 U U A . n A 1 15 C 15 219 219 C C A . n A 1 16 U 16 220 220 U U A . n A 1 17 U 17 221 221 U U A . n A 1 18 G 18 222 222 G G A . n A 1 19 U 19 223 223 U U A . n A 1 20 A 20 224 224 A A A . n A 1 21 C 21 225 225 C C A . n A 1 22 G 22 226 226 G G A . n A 1 23 U 23 227 227 U U A . n A 1 24 C 24 228 228 C C A . n A 1 25 U 25 229 229 U U A . n A 1 26 C 26 230 230 C C A . n A 1 27 G 27 231 231 G G A . n A 1 28 G 28 232 232 G G A . n A 1 29 U 29 233 233 U U A . n A 1 30 C 30 234 234 C C A . n A 1 31 A 31 235 235 A A A . n A 1 32 C 32 236 236 C C A . n A 1 33 A 33 237 237 A A A . n A 1 34 A 34 238 238 A A A . n A 1 35 U 35 239 239 U U A . n A 1 36 A 36 240 240 A A A . n A 1 37 C 37 241 241 C C A . n A 1 38 A 38 242 242 A A A . n A 1 39 C 39 243 243 C C A . n A 1 40 G 40 244 244 G G A . n A 1 41 G 41 245 245 G G A . n A 1 42 U 42 246 246 U U A . n A 1 43 U 43 247 247 U U A . n A 1 44 U 44 248 248 U U A . n A 1 45 C 45 249 249 C C A . n A 1 46 G 46 250 250 G G A . n A 1 47 U 47 251 251 U U A . n A 1 48 C 48 252 252 C C A . n A 1 49 C 49 253 253 C C A . n A 1 50 G 50 254 254 G G A . n A 1 51 G 51 255 255 G G A . n A 1 52 U 52 256 256 U U A . n A 1 53 G 53 257 257 G G A . n A 1 54 C 54 258 258 C C A . n A 1 55 G 55 259 259 G G A . n A 1 56 U 56 260 260 U U A . n A 1 57 G 57 261 261 G G A . n A 1 58 G 58 262 262 G G A . n A 1 59 C 59 263 263 C C A . n A 1 60 A 60 264 264 A A A . n A 1 61 A 61 265 265 A A A . n A 1 62 U 62 266 266 U U A . n A 1 63 U 63 267 267 U U A . n A 1 64 C 64 268 268 C C A . n A 1 65 G 65 269 269 G G A . n A 1 66 G 66 270 270 G G A . n A 1 67 G 67 271 271 G G A . n A 1 68 G 68 272 272 G G A . n A 1 69 C 69 273 273 C C A . n A 1 70 A 70 274 274 A A A . n A 1 71 C 71 275 275 C C A . n A 1 72 A 72 276 276 A A A . n A 1 73 U 73 277 277 U U A . n A 1 74 C 74 278 278 C C A . n A 1 75 A 75 279 279 A A A . n A 1 76 U 76 280 280 U U A . n A 1 77 G 77 281 281 G G A . n A 1 78 U 78 282 282 U U A . n A 1 79 C 79 283 283 C C A . n A 1 80 U 80 284 284 U U A . n A 1 81 U 81 285 285 U U A . n A 1 82 U 82 286 286 U U A . n A 1 83 C 83 287 287 C C A . n A 1 84 G 84 288 288 G G A . n A 1 85 U 85 289 289 U U A . n A 1 86 G 86 290 290 G G A . n A 1 87 G 87 291 291 G G A . n A 1 88 C 88 292 292 C C A . n A 1 89 U 89 293 293 U U A . n A 1 90 G 90 294 294 G G A . n A 1 91 G 91 295 295 G G A . n A 1 92 U 92 296 296 U U A . n A 1 93 G 93 297 297 G G A . n A 1 94 U 94 298 298 U U A . n A 1 95 G 95 299 299 G G A . n A 1 96 A 96 300 300 A A A . n A 1 97 C 97 301 301 C C A . n A 1 98 C 98 302 302 C C A . n A 1 99 G 99 303 303 G G A . n A 1 100 C 100 304 304 C C A . n A 1 101 G 101 305 305 G G A . n A 1 102 C 102 306 306 C C A . n A 1 103 A 103 307 307 A A A . n A 1 104 A 104 308 308 A A A . n A 1 105 G 105 309 309 G G A . n A 1 106 G 106 310 310 G G A . n A 1 107 U 107 311 311 U U A . n A 1 108 G 108 312 312 G G A . n A 1 109 C 109 313 313 C C A . n A 1 110 G 110 314 314 G G A . n A 1 111 C 111 315 315 C C A . n A 1 112 G 112 316 316 G G A . n A 1 113 C 113 317 317 C C A . n A 1 114 G 114 318 318 G G A . n A 1 115 G 115 319 319 G G A . n A 1 116 U 116 320 320 U U A . n A 1 117 A 117 321 321 A A A . n A 1 118 C 118 322 322 C C A . n A 1 119 G 119 323 323 G G A . n A 1 120 U 120 324 324 U U A . n A 1 121 A 121 325 325 A A A . n A 1 122 U 122 326 326 U U A . n A 1 123 C 123 327 327 C C A . n A 1 124 G 124 328 328 G G A . n A 1 125 A 125 329 329 A A A . n A 1 126 G 126 330 330 G G A . n A 1 127 C 127 331 331 C C A . n A 1 128 A 128 332 332 A A A . n A 1 129 G 129 333 333 G G A . n A 1 130 C 130 334 334 C C A . n A 1 131 G 131 335 335 G G A . n A 1 132 C 132 336 336 C C A . n A 1 133 U 133 337 337 U U A . n A 1 134 C 134 338 338 C C A . n A 1 135 C 135 339 339 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8UYK _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _struct.entry_id 8UYK _struct.title ;MERS 5' proximal stem-loop 5, conformation 1 ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8UYK _struct_keywords.text ;SL5, coronavirus, 5' UTR, RNA ; _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name GB _struct_ref.db_code NC_019843.3 _struct_ref.pdbx_db_accession NC_019843.3 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ;AGAGCGUCGUGUCUCUUGUACGUCUCGGUCACAAUACACGGUUUCGUCCGGUGCGUGGCAAUUCGGGGCACAUCAUGUCU UUCGUGGCUGGUGUGACCGCGCAAGGUGCGCGCGGUACGUAUCGAGCAGCGCUCA ; _struct_ref.pdbx_align_begin 205 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8UYK _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 135 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession NC_019843.3 _struct_ref_seq.db_align_beg 205 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 339 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 205 _struct_ref_seq.pdbx_auth_seq_align_end 339 # loop_ _struct_ref_seq_dif.align_id _struct_ref_seq_dif.pdbx_pdb_id_code _struct_ref_seq_dif.mon_id _struct_ref_seq_dif.pdbx_pdb_strand_id _struct_ref_seq_dif.seq_num _struct_ref_seq_dif.pdbx_pdb_ins_code _struct_ref_seq_dif.pdbx_seq_db_name _struct_ref_seq_dif.pdbx_seq_db_accession_code _struct_ref_seq_dif.db_mon_id _struct_ref_seq_dif.pdbx_seq_db_seq_num _struct_ref_seq_dif.details _struct_ref_seq_dif.pdbx_auth_seq_num _struct_ref_seq_dif.pdbx_ordinal 1 8UYK G A 1 ? GB NC_019843.3 A 205 conflict 205 1 1 8UYK C A 135 ? GB NC_019843.3 A 339 conflict 339 2 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'electron microscopy' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 135 N3 ? ? A G 205 A C 339 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 135 O2 ? ? A G 205 A C 339 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 135 N4 ? ? A G 205 A C 339 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 134 N3 ? ? A G 206 A C 338 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 134 O2 ? ? A G 206 A C 338 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 134 N4 ? ? A G 206 A C 338 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 133 N3 ? ? A A 207 A U 337 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 133 O4 ? ? A A 207 A U 337 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 132 N3 ? ? A G 208 A C 336 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 132 O2 ? ? A G 208 A C 336 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 132 N4 ? ? A G 208 A C 336 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 131 N1 ? ? A C 209 A G 335 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 131 O6 ? ? A C 209 A G 335 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 131 N2 ? ? A C 209 A G 335 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 130 N3 ? ? A G 210 A C 334 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 130 O2 ? ? A G 210 A C 334 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 130 N4 ? ? A G 210 A C 334 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 7 N3 ? ? ? 1_555 A G 129 O6 ? ? A U 211 A G 333 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog19 hydrog ? ? A U 7 O2 ? ? ? 1_555 A G 129 N1 ? ? A U 211 A G 333 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog20 hydrog ? ? A G 9 O6 ? ? ? 1_555 A G 129 N1 ? ? A G 213 A G 333 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog21 hydrog ? ? A U 10 N3 ? ? ? 1_555 A A 128 N1 ? ? A U 214 A A 332 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A U 10 O4 ? ? ? 1_555 A A 128 N6 ? ? A U 214 A A 332 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 127 N3 ? ? A G 215 A C 331 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 127 O2 ? ? A G 215 A C 331 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 127 N4 ? ? A G 215 A C 331 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A U 12 N3 ? ? ? 1_555 A C 127 O2 ? ? A U 216 A C 331 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog27 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 126 N1 ? ? A C 217 A G 330 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 126 O6 ? ? A C 217 A G 330 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 126 N2 ? ? A C 217 A G 330 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 125 N1 ? ? A U 218 A A 329 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 125 N6 ? ? A U 218 A A 329 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 124 N1 ? ? A C 219 A G 328 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 124 O6 ? ? A C 219 A G 328 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 124 N2 ? ? A C 219 A G 328 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A U 16 O4 ? ? ? 1_555 A C 123 N4 ? ? A U 220 A C 327 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog36 hydrog ? ? A U 17 N3 ? ? ? 1_555 A C 123 N3 ? ? A U 221 A C 327 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog37 hydrog ? ? A U 17 O4 ? ? ? 1_555 A C 123 N4 ? ? A U 221 A C 327 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog38 hydrog ? ? A G 18 N1 ? ? ? 1_555 A U 122 O2 ? ? A G 222 A U 326 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog39 hydrog ? ? A G 18 O6 ? ? ? 1_555 A U 122 N3 ? ? A G 222 A U 326 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog40 hydrog ? ? A U 19 N3 ? ? ? 1_555 A A 121 N1 ? ? A U 223 A A 325 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A U 19 O4 ? ? ? 1_555 A A 121 N6 ? ? A U 223 A A 325 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A A 20 N1 ? ? ? 1_555 A U 120 N3 ? ? A A 224 A U 324 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A A 20 N6 ? ? ? 1_555 A U 120 O4 ? ? A A 224 A U 324 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 21 N3 ? ? ? 1_555 A G 119 N1 ? ? A C 225 A G 323 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 21 N4 ? ? ? 1_555 A G 119 O6 ? ? A C 225 A G 323 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 21 O2 ? ? ? 1_555 A G 119 N2 ? ? A C 225 A G 323 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 22 N1 ? ? ? 1_555 A C 118 N3 ? ? A G 226 A C 322 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 22 N2 ? ? ? 1_555 A C 118 O2 ? ? A G 226 A C 322 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 22 O6 ? ? ? 1_555 A C 118 N4 ? ? A G 226 A C 322 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A U 23 N3 ? ? ? 1_555 A A 117 N1 ? ? A U 227 A A 321 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A U 23 O4 ? ? ? 1_555 A A 117 N6 ? ? A U 227 A A 321 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 24 N3 ? ? ? 1_555 A G 68 N1 ? ? A C 228 A G 272 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 24 N4 ? ? ? 1_555 A G 68 O6 ? ? A C 228 A G 272 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 68 N2 ? ? A C 228 A G 272 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A U 25 N3 ? ? ? 1_555 A G 67 O6 ? ? A U 229 A G 271 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog56 hydrog ? ? A U 25 O2 ? ? ? 1_555 A G 67 N1 ? ? A U 229 A G 271 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog57 hydrog ? ? A C 26 N3 ? ? ? 1_555 A G 66 N1 ? ? A C 230 A G 270 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 26 N4 ? ? ? 1_555 A G 66 O6 ? ? A C 230 A G 270 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A C 26 O2 ? ? ? 1_555 A G 66 N2 ? ? A C 230 A G 270 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 64 N3 ? ? A G 231 A C 268 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 64 O2 ? ? A G 231 A C 268 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 64 N4 ? ? A G 231 A C 268 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 28 N1 ? ? ? 1_555 A C 59 N3 ? ? A G 232 A C 263 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 59 O2 ? ? A G 232 A C 263 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 28 O6 ? ? ? 1_555 A C 59 N4 ? ? A G 232 A C 263 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A U 29 N3 ? ? ? 1_555 A G 58 O6 ? ? A U 233 A G 262 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog67 hydrog ? ? A U 29 O2 ? ? ? 1_555 A G 58 N1 ? ? A U 233 A G 262 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog68 hydrog ? ? A C 30 N3 ? ? ? 1_555 A G 57 N1 ? ? A C 234 A G 261 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A C 30 N4 ? ? ? 1_555 A G 57 O6 ? ? A C 234 A G 261 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A C 30 O2 ? ? ? 1_555 A G 57 N2 ? ? A C 234 A G 261 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A A 31 N1 ? ? ? 1_555 A U 56 N3 ? ? A A 235 A U 260 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A A 31 N6 ? ? ? 1_555 A U 56 O4 ? ? A A 235 A U 260 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A C 32 N3 ? ? ? 1_555 A G 55 N1 ? ? A C 236 A G 259 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A C 32 N4 ? ? ? 1_555 A G 55 O6 ? ? A C 236 A G 259 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A C 32 O2 ? ? ? 1_555 A G 55 N2 ? ? A C 236 A G 259 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A A 33 N6 ? ? ? 1_555 A C 54 N3 ? ? A A 237 A C 258 1_555 ? ? ? ? ? ? TYPE_25_PAIR ? ? ? hydrog77 hydrog ? ? A A 33 N7 ? ? ? 1_555 A C 54 N4 ? ? A A 237 A C 258 1_555 ? ? ? ? ? ? TYPE_25_PAIR ? ? ? hydrog78 hydrog ? ? A U 35 N3 ? ? ? 1_555 A G 53 O6 ? ? A U 239 A G 257 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog79 hydrog ? ? A U 35 O2 ? ? ? 1_555 A G 53 N1 ? ? A U 239 A G 257 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog80 hydrog ? ? A A 36 N1 ? ? ? 1_555 A U 52 N3 ? ? A A 240 A U 256 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A A 36 N6 ? ? ? 1_555 A U 52 O4 ? ? A A 240 A U 256 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A C 37 N3 ? ? ? 1_555 A G 51 N1 ? ? A C 241 A G 255 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A C 37 N4 ? ? ? 1_555 A G 51 O6 ? ? A C 241 A G 255 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A C 37 O2 ? ? ? 1_555 A G 51 N2 ? ? A C 241 A G 255 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A A 38 N1 ? ? ? 1_555 A G 50 N1 ? ? A A 242 A G 254 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog86 hydrog ? ? A A 38 N6 ? ? ? 1_555 A G 50 O6 ? ? A A 242 A G 254 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog87 hydrog ? ? A C 39 N3 ? ? ? 1_555 A G 50 N1 ? ? A C 243 A G 254 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A C 39 N4 ? ? ? 1_555 A G 50 O6 ? ? A C 243 A G 254 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A C 39 O2 ? ? ? 1_555 A G 50 N2 ? ? A C 243 A G 254 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A G 40 N1 ? ? ? 1_555 A C 49 N3 ? ? A G 244 A C 253 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A G 40 N2 ? ? ? 1_555 A C 49 O2 ? ? A G 244 A C 253 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A G 40 O6 ? ? ? 1_555 A C 49 N4 ? ? A G 244 A C 253 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A G 41 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 245 A C 252 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? A G 41 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 245 A C 252 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A G 41 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 245 A C 252 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A U 42 N3 ? ? ? 1_555 A U 47 O4 ? ? A U 246 A U 251 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog97 hydrog ? ? A C 69 N3 ? ? ? 1_555 A G 95 N1 ? ? A C 273 A G 299 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? A C 69 N4 ? ? ? 1_555 A G 95 O6 ? ? A C 273 A G 299 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? A C 69 O2 ? ? ? 1_555 A G 95 N2 ? ? A C 273 A G 299 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? A A 70 N1 ? ? ? 1_555 A U 94 N3 ? ? A A 274 A U 298 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog101 hydrog ? ? A A 70 N6 ? ? ? 1_555 A U 94 O4 ? ? A A 274 A U 298 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog102 hydrog ? ? A C 71 N3 ? ? ? 1_555 A G 93 N1 ? ? A C 275 A G 297 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog103 hydrog ? ? A C 71 N4 ? ? ? 1_555 A G 93 O6 ? ? A C 275 A G 297 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog104 hydrog ? ? A C 71 O2 ? ? ? 1_555 A G 93 N2 ? ? A C 275 A G 297 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog105 hydrog ? ? A A 72 N1 ? ? ? 1_555 A U 92 N3 ? ? A A 276 A U 296 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog106 hydrog ? ? A A 72 N6 ? ? ? 1_555 A U 92 O4 ? ? A A 276 A U 296 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog107 hydrog ? ? A U 73 N3 ? ? ? 1_555 A G 91 O6 ? ? A U 277 A G 295 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog108 hydrog ? ? A U 73 O2 ? ? ? 1_555 A G 91 N1 ? ? A U 277 A G 295 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog109 hydrog ? ? A C 74 N3 ? ? ? 1_555 A G 90 N1 ? ? A C 278 A G 294 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog110 hydrog ? ? A C 74 N4 ? ? ? 1_555 A G 90 O6 ? ? A C 278 A G 294 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog111 hydrog ? ? A C 74 O2 ? ? ? 1_555 A G 90 N2 ? ? A C 278 A G 294 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog112 hydrog ? ? A A 75 N1 ? ? ? 1_555 A U 89 N3 ? ? A A 279 A U 293 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog113 hydrog ? ? A A 75 N6 ? ? ? 1_555 A U 89 O4 ? ? A A 279 A U 293 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog114 hydrog ? ? A G 77 N1 ? ? ? 1_555 A C 88 N3 ? ? A G 281 A C 292 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog115 hydrog ? ? A G 77 N2 ? ? ? 1_555 A C 88 O2 ? ? A G 281 A C 292 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog116 hydrog ? ? A G 77 O6 ? ? ? 1_555 A C 88 N4 ? ? A G 281 A C 292 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog117 hydrog ? ? A U 78 N3 ? ? ? 1_555 A G 87 O6 ? ? A U 282 A G 291 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog118 hydrog ? ? A U 78 O2 ? ? ? 1_555 A G 87 N1 ? ? A U 282 A G 291 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog119 hydrog ? ? A C 79 N3 ? ? ? 1_555 A G 86 N1 ? ? A C 283 A G 290 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog120 hydrog ? ? A C 79 N4 ? ? ? 1_555 A G 86 O6 ? ? A C 283 A G 290 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog121 hydrog ? ? A C 79 O2 ? ? ? 1_555 A G 86 N2 ? ? A C 283 A G 290 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog122 hydrog ? ? A U 80 N3 ? ? ? 1_555 A U 85 O4 ? ? A U 284 A U 289 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog123 hydrog ? ? A A 96 N1 ? ? ? 1_555 A A 117 N6 ? ? A A 300 A A 321 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog124 hydrog ? ? A C 97 N3 ? ? ? 1_555 A G 115 N1 ? ? A C 301 A G 319 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog125 hydrog ? ? A C 97 N4 ? ? ? 1_555 A G 115 O6 ? ? A C 301 A G 319 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog126 hydrog ? ? A C 97 O2 ? ? ? 1_555 A G 115 N2 ? ? A C 301 A G 319 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog127 hydrog ? ? A C 97 N3 ? ? ? 1_555 A U 116 N3 ? ? A C 301 A U 320 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog128 hydrog ? ? A C 97 N4 ? ? ? 1_555 A U 116 O4 ? ? A C 301 A U 320 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog129 hydrog ? ? A C 98 N3 ? ? ? 1_555 A G 114 N1 ? ? A C 302 A G 318 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog130 hydrog ? ? A C 98 N4 ? ? ? 1_555 A G 114 O6 ? ? A C 302 A G 318 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog131 hydrog ? ? A C 98 O2 ? ? ? 1_555 A G 114 N2 ? ? A C 302 A G 318 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog132 hydrog ? ? A G 99 N1 ? ? ? 1_555 A C 113 N3 ? ? A G 303 A C 317 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog133 hydrog ? ? A G 99 N2 ? ? ? 1_555 A C 113 O2 ? ? A G 303 A C 317 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog134 hydrog ? ? A G 99 O6 ? ? ? 1_555 A C 113 N4 ? ? A G 303 A C 317 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog135 hydrog ? ? A C 100 N3 ? ? ? 1_555 A G 112 N1 ? ? A C 304 A G 316 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog136 hydrog ? ? A C 100 N4 ? ? ? 1_555 A G 112 O6 ? ? A C 304 A G 316 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog137 hydrog ? ? A C 100 O2 ? ? ? 1_555 A G 112 N2 ? ? A C 304 A G 316 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog138 hydrog ? ? A G 101 N1 ? ? ? 1_555 A C 111 N3 ? ? A G 305 A C 315 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog139 hydrog ? ? A G 101 N2 ? ? ? 1_555 A C 111 O2 ? ? A G 305 A C 315 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog140 hydrog ? ? A G 101 O6 ? ? ? 1_555 A C 111 N4 ? ? A G 305 A C 315 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog141 hydrog ? ? A C 102 N3 ? ? ? 1_555 A G 110 N1 ? ? A C 306 A G 314 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog142 hydrog ? ? A C 102 N4 ? ? ? 1_555 A G 110 O6 ? ? A C 306 A G 314 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog143 hydrog ? ? A C 102 O2 ? ? ? 1_555 A G 110 N2 ? ? A C 306 A G 314 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _em_3d_fitting.id 1 _em_3d_fitting.entry_id 8UYK _em_3d_fitting.method ? _em_3d_fitting.target_criteria ? _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_space REAL _em_3d_fitting.ref_protocol OTHER # _em_3d_reconstruction.entry_id 8UYK _em_3d_reconstruction.id 1 _em_3d_reconstruction.method ? _em_3d_reconstruction.algorithm 'FOURIER SPACE' _em_3d_reconstruction.citation_id ? _em_3d_reconstruction.details ? _em_3d_reconstruction.resolution 6.9 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.magnification_calibration ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.num_particles 81341 _em_3d_reconstruction.euler_angles_details ? _em_3d_reconstruction.num_class_averages 1 _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.symmetry_type POINT # _em_buffer.id 1 _em_buffer.specimen_id 1 _em_buffer.name ? _em_buffer.details ? _em_buffer.pH 8.0 # _em_entity_assembly.id 1 _em_entity_assembly.parent_id 0 _em_entity_assembly.source SYNTHETIC _em_entity_assembly.type COMPLEX _em_entity_assembly.name ;MERS 5' proximal stem-loop 5, conformation 1 ; _em_entity_assembly.details ? _em_entity_assembly.synonym ? _em_entity_assembly.oligomeric_details ? _em_entity_assembly.entity_id_list 1 # _em_image_scans.entry_id 8UYK _em_image_scans.id 1 _em_image_scans.number_digital_images ? _em_image_scans.details ? _em_image_scans.scanner_model ? _em_image_scans.sampling_size ? _em_image_scans.od_range ? _em_image_scans.quant_bit_size ? _em_image_scans.citation_id ? _em_image_scans.dimension_height 4096 _em_image_scans.dimension_width 4096 _em_image_scans.frames_per_image ? _em_image_scans.image_recording_id 1 _em_image_scans.used_frames_per_image ? # _em_imaging.entry_id 8UYK _em_imaging.id 1 _em_imaging.astigmatism ? _em_imaging.electron_beam_tilt_params ? _em_imaging.residual_tilt ? _em_imaging.microscope_model 'TFS KRIOS' _em_imaging.specimen_holder_type ? _em_imaging.specimen_holder_model 'FEI TITAN KRIOS AUTOGRID HOLDER' _em_imaging.details ? _em_imaging.date ? _em_imaging.accelerating_voltage 300 _em_imaging.illumination_mode 'FLOOD BEAM' _em_imaging.mode 'BRIGHT FIELD' _em_imaging.nominal_cs 2.7 _em_imaging.nominal_defocus_min 1000 _em_imaging.nominal_defocus_max 2000 _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_defocus_max ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.nominal_magnification 96000 _em_imaging.calibrated_magnification ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.citation_id ? _em_imaging.temperature ? _em_imaging.detector_distance ? _em_imaging.recording_temperature_minimum ? _em_imaging.recording_temperature_maximum ? _em_imaging.alignment_procedure 'COMA FREE' _em_imaging.c2_aperture_diameter 70 _em_imaging.specimen_id 1 _em_imaging.cryogen NITROGEN # _em_sample_support.id 1 _em_sample_support.film_material ? _em_sample_support.method ? _em_sample_support.grid_material COPPER _em_sample_support.grid_mesh_size 300 _em_sample_support.grid_type 'Quantifoil R1.2/1.3' _em_sample_support.details ? _em_sample_support.specimen_id 1 _em_sample_support.citation_id ? # _em_vitrification.entry_id 8UYK _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.cryogen_name ETHANE _em_vitrification.humidity 100 _em_vitrification.temp ? _em_vitrification.chamber_temperature 278 _em_vitrification.instrument 'FEI VITROBOT MARK IV' _em_vitrification.method ? _em_vitrification.time_resolved_state ? _em_vitrification.citation_id ? _em_vitrification.details ? # _em_experiment.entry_id 8UYK _em_experiment.id 1 _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.aggregation_state PARTICLE _em_experiment.entity_assembly_id 1 # _em_single_particle_entity.entry_id 8UYK _em_single_particle_entity.id 1 _em_single_particle_entity.image_processing_id 1 _em_single_particle_entity.point_symmetry C1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _em_buffer_component.buffer_id _em_buffer_component.concentration _em_buffer_component.concentration_units _em_buffer_component.formula _em_buffer_component.id _em_buffer_component.name 1 50 mM Na-C8H18N2O4S 1 'Sodium HEPES' 1 10 mM MgCl2 2 'Magnesium Chloride' # _em_ctf_correction.details ? _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.id 1 _em_ctf_correction.type 'PHASE FLIPPING AND AMPLITUDE CORRECTION' # _em_entity_assembly_molwt.entity_assembly_id 1 _em_entity_assembly_molwt.experimental_flag NO _em_entity_assembly_molwt.id 1 _em_entity_assembly_molwt.units MEGADALTONS _em_entity_assembly_molwt.value 0.04367 # _em_entity_assembly_synthetic.cell ? _em_entity_assembly_synthetic.entity_assembly_id 1 _em_entity_assembly_synthetic.id 2 _em_entity_assembly_synthetic.ncbi_tax_id 1335626 _em_entity_assembly_synthetic.organism 'Middle East respiratory syndrome-related coronavirus' _em_entity_assembly_synthetic.strain ? _em_entity_assembly_synthetic.cellular_location ? _em_entity_assembly_synthetic.organ ? _em_entity_assembly_synthetic.organelle ? _em_entity_assembly_synthetic.tissue ? # _em_image_processing.details ? _em_image_processing.id 1 _em_image_processing.image_recording_id 1 # _em_image_recording.average_exposure_time 4.74 _em_image_recording.avg_electron_dose_per_subtomogram ? _em_image_recording.avg_electron_dose_per_image 50.0 _em_image_recording.details ? _em_image_recording.detector_mode ? _em_image_recording.film_or_detector_model 'FEI FALCON IV (4k x 4k)' _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged 1 _em_image_recording.num_real_images 13244 # _em_particle_selection.details ? _em_particle_selection.id 1 _em_particle_selection.image_processing_id 1 _em_particle_selection.method ? _em_particle_selection.num_particles_selected 1207909 _em_particle_selection.reference_model ? # loop_ _em_software.category _em_software.details _em_software.id _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id _em_software.name _em_software.version 'PARTICLE SELECTION' Template 1 1 ? ? cryoSPARC 3.2.0 'IMAGE ACQUISITION' ? 2 ? ? 1 EPU ? MASKING ? 3 ? ? ? ? ? 'CTF CORRECTION' 'Patch CTF Estimation' 4 1 ? ? cryoSPARC 3.2.0 'LAYERLINE INDEXING' ? 5 ? ? ? ? ? 'DIFFRACTION INDEXING' ? 6 ? ? ? ? ? 'MODEL FITTING' auto-DRRAFTER 7 ? 1 ? Rosetta 2020.42 OTHER ? 8 ? ? ? ? ? 'MODEL REFINEMENT' phenix.real_space_refine 9 ? 1 ? ERRASER 2 'INITIAL EULER ASSIGNMENT' 'Ab initio reconstruction multi-class' 10 1 ? ? cryoSPARC 3.2.0 'FINAL EULER ASSIGNMENT' 'Non-uniform Refinement' 11 1 ? ? cryoSPARC 3.2.0 CLASSIFICATION '3D variability' 12 1 ? ? cryoSPARC 3.2.0 CLASSIFICATION 'Heterogeneous refinement' 13 1 ? ? cryoSPARC 3.2.0 RECONSTRUCTION 'Non-uniform Refinement' 14 1 ? ? cryoSPARC 3.2.0 # _em_specimen.concentration 1.31 _em_specimen.details ? _em_specimen.embedding_applied NO _em_specimen.experiment_id 1 _em_specimen.id 1 _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8UYK 'double helix' 8UYK 'a-form double helix' 8UYK 'hairpin loop' 8UYK 'bulge loop' 8UYK 'mismatched base pair' 8UYK 'internal loop' 8UYK 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 135 1_555 -0.163 -0.079 0.164 4.363 -4.954 -4.279 1 A_G205:C339_A A 205 ? A 339 ? 19 1 1 A G 2 1_555 A C 134 1_555 -0.263 -0.202 -0.125 1.849 -12.713 -0.360 2 A_G206:C338_A A 206 ? A 338 ? 19 1 1 A A 3 1_555 A U 133 1_555 -0.119 -0.167 -0.272 -1.662 -12.435 -3.823 3 A_A207:U337_A A 207 ? A 337 ? 20 1 1 A G 4 1_555 A C 132 1_555 -0.185 -0.194 -0.115 -2.624 -13.203 -2.135 4 A_G208:C336_A A 208 ? A 336 ? 19 1 1 A C 5 1_555 A G 131 1_555 0.227 -0.229 -0.122 3.629 -15.938 -2.031 5 A_C209:G335_A A 209 ? A 335 ? 19 1 1 A G 6 1_555 A C 130 1_555 -0.026 -0.203 0.167 -14.143 -21.868 -5.153 6 A_G210:C334_A A 210 ? A 334 ? 19 1 1 A U 7 1_555 A G 129 1_555 1.804 -0.398 0.807 -17.975 -12.601 -16.699 7 A_U211:G333_A A 211 ? A 333 ? 28 1 1 A U 10 1_555 A A 128 1_555 -0.093 -0.114 0.241 21.772 -24.026 -14.131 8 A_U214:A332_A A 214 ? A 332 ? 20 1 1 A G 11 1_555 A C 127 1_555 -0.152 -0.155 -0.319 -8.692 -21.914 -2.432 9 A_G215:C331_A A 215 ? A 331 ? 19 1 1 A C 13 1_555 A G 126 1_555 0.007 -0.163 0.517 2.705 -4.456 -1.845 10 A_C217:G330_A A 217 ? A 330 ? 19 1 1 A U 14 1_555 A A 125 1_555 -0.039 -0.091 -0.166 8.138 -7.383 -5.380 11 A_U218:A329_A A 218 ? A 329 ? 20 1 1 A C 15 1_555 A G 124 1_555 0.112 -0.167 -0.239 8.101 -4.969 -3.525 12 A_C219:G328_A A 219 ? A 328 ? 19 1 1 A U 16 1_555 A C 123 1_555 -0.779 -0.482 -1.257 5.565 -24.810 -22.101 13 A_U220:C327_A A 220 ? A 327 ? ? ? 1 A G 18 1_555 A U 122 1_555 -2.174 -0.480 0.117 5.127 -16.211 3.322 14 A_G222:U326_A A 222 ? A 326 ? 28 1 1 A U 19 1_555 A A 121 1_555 -0.085 -0.079 0.084 1.721 -10.433 -5.152 15 A_U223:A325_A A 223 ? A 325 ? 20 1 1 A A 20 1_555 A U 120 1_555 -0.006 -0.093 0.014 0.921 -8.925 -6.090 16 A_A224:U324_A A 224 ? A 324 ? 20 1 1 A C 21 1_555 A G 119 1_555 0.096 -0.158 0.017 6.119 -9.985 -3.506 17 A_C225:G323_A A 225 ? A 323 ? 19 1 1 A G 22 1_555 A C 118 1_555 -0.113 -0.206 -0.178 -0.058 -12.945 -1.580 18 A_G226:C322_A A 226 ? A 322 ? 19 1 1 A U 23 1_555 A A 117 1_555 0.194 -0.122 -0.375 1.190 -12.050 -0.791 19 A_U227:A321_A A 227 ? A 321 ? 20 1 1 A C 64 1_555 A G 27 1_555 0.107 -0.005 -0.219 7.743 2.970 -4.968 20 A_C268:G231_A A 268 ? A 231 ? 19 1 1 A G 66 1_555 A C 26 1_555 -0.498 -0.207 0.532 2.243 7.263 5.396 21 A_G270:C230_A A 270 ? A 230 ? 19 1 1 A G 67 1_555 A U 25 1_555 -1.933 -0.397 -0.017 9.612 -8.478 -0.956 22 A_G271:U229_A A 271 ? A 229 ? 28 1 1 A G 68 1_555 A C 24 1_555 -0.188 -0.105 -0.407 -7.074 -16.929 0.117 23 A_G272:C228_A A 272 ? A 228 ? 19 1 1 A C 69 1_555 A G 95 1_555 -0.116 -0.117 0.162 7.144 -7.545 -4.257 24 A_C273:G299_A A 273 ? A 299 ? 19 1 1 A A 70 1_555 A U 94 1_555 -0.057 -0.118 -0.178 3.944 -12.589 -4.495 25 A_A274:U298_A A 274 ? A 298 ? 20 1 1 A C 71 1_555 A G 93 1_555 0.108 -0.167 -0.086 5.719 -12.119 -1.843 26 A_C275:G297_A A 275 ? A 297 ? 19 1 1 A A 72 1_555 A U 92 1_555 0.041 -0.086 -0.192 -5.643 -13.721 -4.895 27 A_A276:U296_A A 276 ? A 296 ? 20 1 1 A U 73 1_555 A G 91 1_555 1.852 -0.419 -0.013 -5.213 -12.557 -5.976 28 A_U277:G295_A A 277 ? A 295 ? 28 1 1 A C 74 1_555 A G 90 1_555 0.056 -0.177 0.139 -1.197 -9.690 -4.217 29 A_C278:G294_A A 278 ? A 294 ? 19 1 1 A A 75 1_555 A U 89 1_555 0.073 -0.006 -0.030 4.134 -4.611 -11.227 30 A_A279:U293_A A 279 ? A 293 ? 20 1 1 A G 77 1_555 A C 88 1_555 -0.108 -0.159 -0.374 -3.683 -14.154 -0.635 31 A_G281:C292_A A 281 ? A 292 ? 19 1 1 A U 78 1_555 A G 87 1_555 1.991 -0.453 -0.177 -3.332 -11.350 -0.424 32 A_U282:G291_A A 282 ? A 291 ? 28 1 1 A C 79 1_555 A G 86 1_555 0.240 -0.222 -0.430 -2.045 -0.988 -1.658 33 A_C283:G290_A A 283 ? A 290 ? 19 1 1 A U 80 1_555 A U 85 1_555 2.562 -1.180 -0.318 -0.700 12.721 -33.613 34 A_U284:U289_A A 284 ? A 289 ? ? ? 1 A G 28 1_555 A C 59 1_555 -0.229 -0.217 -0.589 -7.264 -8.280 -0.132 35 A_G232:C263_A A 232 ? A 263 ? 19 1 1 A U 29 1_555 A G 58 1_555 1.871 -0.438 -0.326 -4.493 -6.608 -1.832 36 A_U233:G262_A A 233 ? A 262 ? 28 1 1 A C 30 1_555 A G 57 1_555 0.155 -0.207 -0.143 0.149 -4.656 -1.515 37 A_C234:G261_A A 234 ? A 261 ? 19 1 1 A A 31 1_555 A U 56 1_555 0.223 -0.185 -0.739 -3.539 2.367 -7.108 38 A_A235:U260_A A 235 ? A 260 ? 20 1 1 A C 32 1_555 A G 55 1_555 0.405 -0.341 -0.808 1.710 2.598 -6.339 39 A_C236:G259_A A 236 ? A 259 ? 19 1 1 A A 33 1_555 A C 54 1_555 -3.018 -0.663 -0.495 -11.325 -29.702 -90.191 40 A_A237:C258_A A 237 ? A 258 ? 25 4 1 A U 35 1_555 A G 53 1_555 1.891 -0.467 0.196 -3.278 -21.342 -9.561 41 A_U239:G257_A A 239 ? A 257 ? 28 1 1 A A 36 1_555 A U 52 1_555 0.026 -0.287 0.500 -6.658 -16.414 -7.572 42 A_A240:U256_A A 240 ? A 256 ? 20 1 1 A C 37 1_555 A G 51 1_555 -0.058 -0.113 0.630 0.988 -9.283 -11.180 43 A_C241:G255_A A 241 ? A 255 ? 19 1 1 A C 39 1_555 A G 50 1_555 0.060 -0.328 0.978 3.377 -2.331 -0.233 44 A_C243:G254_A A 243 ? A 254 ? 19 1 1 A G 40 1_555 A C 49 1_555 -0.134 -0.156 -0.138 11.907 -5.475 -1.576 45 A_G244:C253_A A 244 ? A 253 ? 19 1 1 A G 41 1_555 A C 48 1_555 -0.113 -0.332 -0.855 5.236 1.292 -4.192 46 A_G245:C252_A A 245 ? A 252 ? 19 1 1 A U 42 1_555 A U 47 1_555 2.261 -1.100 -0.566 2.259 14.821 -41.302 47 A_U246:U251_A A 246 ? A 251 ? ? ? 1 A C 97 1_555 A G 115 1_555 -0.321 -0.314 -1.063 3.921 8.104 -12.711 48 A_C301:G319_A A 301 ? A 319 ? 19 1 1 A C 98 1_555 A G 114 1_555 0.035 -0.178 -0.542 4.292 -0.124 -4.050 49 A_C302:G318_A A 302 ? A 318 ? 19 1 1 A G 99 1_555 A C 113 1_555 -0.106 -0.160 -0.246 -4.402 -7.401 -2.448 50 A_G303:C317_A A 303 ? A 317 ? 19 1 1 A C 100 1_555 A G 112 1_555 0.088 -0.180 -0.228 2.856 -9.163 -3.360 51 A_C304:G316_A A 304 ? A 316 ? 19 1 1 A G 101 1_555 A C 111 1_555 -0.049 -0.165 0.009 -4.215 -12.156 -3.964 52 A_G305:C315_A A 305 ? A 315 ? 19 1 1 A C 102 1_555 A G 110 1_555 0.203 -0.143 0.061 3.266 -10.484 -7.187 53 A_C306:G314_A A 306 ? A 314 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 135 1_555 A G 2 1_555 A C 134 1_555 0.009 -1.839 3.479 0.320 10.451 31.703 -4.903 0.036 2.751 18.511 -0.566 33.341 1 AA_G205G206:C338C339_AA A 205 ? A 339 ? A 206 ? A 338 ? 1 A G 2 1_555 A C 134 1_555 A A 3 1_555 A U 133 1_555 -0.423 -1.641 3.442 -0.495 13.211 32.802 -4.588 0.628 2.614 22.299 0.836 35.298 2 AA_G206A207:U337C338_AA A 206 ? A 338 ? A 207 ? A 337 ? 1 A A 3 1_555 A U 133 1_555 A G 4 1_555 A C 132 1_555 0.007 -1.620 3.352 -1.472 13.084 31.014 -4.790 -0.236 2.483 23.201 2.609 33.630 3 AA_A207G208:C336U337_AA A 207 ? A 337 ? A 208 ? A 336 ? 1 A G 4 1_555 A C 132 1_555 A C 5 1_555 A G 131 1_555 0.113 -1.508 3.213 0.539 5.253 33.048 -3.441 -0.113 2.947 9.162 -0.940 33.456 4 AA_G208C209:G335C336_AA A 208 ? A 336 ? A 209 ? A 335 ? 1 A C 5 1_555 A G 131 1_555 A G 6 1_555 A C 130 1_555 0.123 -1.774 3.724 0.158 15.286 33.294 -4.999 -0.174 2.682 25.100 -0.259 36.545 5 AA_C209G210:C334G335_AA A 209 ? A 335 ? A 210 ? A 334 ? 1 A G 6 1_555 A C 130 1_555 A U 7 1_555 A G 129 1_555 -0.489 -1.639 3.538 -1.249 3.201 42.352 -2.607 0.540 3.423 4.421 1.726 42.485 6 AA_G210U211:G333C334_AA A 210 ? A 334 ? A 211 ? A 333 ? 1 A U 7 1_555 A G 129 1_555 A U 10 1_555 A A 128 1_555 -0.983 -1.905 3.829 33.343 4.609 36.667 -2.643 3.802 2.071 6.008 -43.468 49.379 7 AA_U211U214:A332G333_AA A 211 ? A 333 ? A 214 ? A 332 ? 1 A U 10 1_555 A A 128 1_555 A G 11 1_555 A C 127 1_555 0.621 -1.846 4.230 2.549 14.826 38.097 -4.605 -0.553 3.347 21.708 -3.733 40.856 8 AA_U214G215:C331A332_AA A 214 ? A 332 ? A 215 ? A 331 ? 1 A G 11 1_555 A C 127 1_555 A C 13 1_555 A G 126 1_555 -1.538 -1.898 4.495 15.264 19.864 45.337 -3.825 3.031 2.864 23.757 -18.255 51.477 9 AA_G215C217:G330C331_AA A 215 ? A 331 ? A 217 ? A 330 ? 1 A C 13 1_555 A G 126 1_555 A U 14 1_555 A A 125 1_555 -0.205 -1.772 3.249 3.607 10.483 29.401 -5.052 0.990 2.447 19.789 -6.809 31.378 10 AA_C217U218:A329G330_AA A 217 ? A 330 ? A 218 ? A 329 ? 1 A U 14 1_555 A A 125 1_555 A C 15 1_555 A G 124 1_555 0.192 -1.821 3.413 0.261 12.682 31.874 -4.977 -0.287 2.528 22.033 -0.454 34.244 11 AA_U218C219:G328A329_AA A 218 ? A 329 ? A 219 ? A 328 ? 1 A C 15 1_555 A G 124 1_555 A U 16 1_555 A C 123 1_555 -1.625 -2.038 3.591 0.130 19.491 26.977 -6.539 2.866 1.752 36.365 -0.243 33.176 12 AA_C219U220:C327G328_AA A 219 ? A 328 ? A 220 ? A 327 ? 1 A U 16 1_555 A C 123 1_555 A G 18 1_555 A U 122 1_555 -0.728 -2.337 4.635 7.423 17.198 47.344 -4.294 1.525 3.499 20.505 -8.850 50.716 13 AA_U220G222:U326C327_AA A 220 ? A 327 ? A 222 ? A 326 ? 1 A G 18 1_555 A U 122 1_555 A U 19 1_555 A A 121 1_555 -0.559 -1.486 3.600 -2.504 10.397 37.490 -3.551 0.520 3.124 15.787 3.802 38.933 14 AA_G222U223:A325U326_AA A 222 ? A 326 ? A 223 ? A 325 ? 1 A U 19 1_555 A A 121 1_555 A A 20 1_555 A U 120 1_555 -0.230 -1.701 3.317 0.144 15.156 31.515 -4.912 0.403 2.284 26.099 -0.247 34.887 15 AA_U223A224:U324A325_AA A 223 ? A 325 ? A 224 ? A 324 ? 1 A A 20 1_555 A U 120 1_555 A C 21 1_555 A G 119 1_555 0.099 -1.595 3.360 -0.028 9.053 30.648 -4.476 -0.186 2.787 16.676 0.052 31.926 16 AA_A224C225:G323U324_AA A 224 ? A 324 ? A 225 ? A 323 ? 1 A C 21 1_555 A G 119 1_555 A G 22 1_555 A C 118 1_555 0.203 -1.714 3.448 0.838 16.604 30.793 -5.202 -0.220 2.262 28.788 -1.453 34.899 17 AA_C225G226:C322G323_AA A 225 ? A 323 ? A 226 ? A 322 ? 1 A G 22 1_555 A C 118 1_555 A U 23 1_555 A A 117 1_555 0.262 -1.736 3.394 1.112 7.057 32.802 -4.147 -0.275 2.974 12.314 -1.940 33.550 18 AA_G226U227:A321C322_AA A 226 ? A 322 ? A 227 ? A 321 ? 1 A C 64 1_555 A G 27 1_555 A G 66 1_555 A C 26 1_555 -1.407 -2.224 5.923 15.400 14.152 42.349 -4.716 3.862 4.285 18.314 -19.929 47.019 19 AA_C268G270:C230G231_AA A 268 ? A 231 ? A 270 ? A 230 ? 1 A G 66 1_555 A C 26 1_555 A G 67 1_555 A U 25 1_555 -0.204 -2.095 3.431 2.390 2.393 20.600 -6.815 1.595 3.126 6.635 -6.626 20.872 20 AA_G270G271:U229C230_AA A 270 ? A 230 ? A 271 ? A 229 ? 1 A G 67 1_555 A U 25 1_555 A G 68 1_555 A C 24 1_555 0.124 -1.695 3.979 0.084 9.603 39.149 -3.721 -0.169 3.485 14.075 -0.123 40.265 21 AA_G271G272:C228U229_AA A 271 ? A 229 ? A 272 ? A 228 ? 1 A G 68 1_555 A C 24 1_555 A C 69 1_555 A G 95 1_555 1.444 -1.200 3.147 -6.035 -0.840 45.611 -1.468 -2.335 2.964 -1.077 7.743 45.995 22 AA_G272C273:G299C228_AA A 272 ? A 228 ? A 273 ? A 299 ? 1 A C 69 1_555 A G 95 1_555 A A 70 1_555 A U 94 1_555 -0.221 -1.727 3.446 1.094 13.656 31.006 -5.056 0.548 2.478 24.124 -1.933 33.830 23 AA_C273A274:U298G299_AA A 273 ? A 299 ? A 274 ? A 298 ? 1 A A 70 1_555 A U 94 1_555 A C 71 1_555 A G 93 1_555 0.144 -1.694 3.419 -0.698 6.695 31.608 -4.223 -0.382 3.002 12.120 1.264 32.299 24 AA_A274C275:G297U298_AA A 274 ? A 298 ? A 275 ? A 297 ? 1 A C 71 1_555 A G 93 1_555 A A 72 1_555 A U 92 1_555 -0.148 -1.813 3.641 0.972 14.228 31.492 -5.266 0.401 2.599 24.692 -1.687 34.496 25 AA_C275A276:U296G297_AA A 275 ? A 297 ? A 276 ? A 296 ? 1 A A 72 1_555 A U 92 1_555 A U 73 1_555 A G 91 1_555 -0.077 -1.536 3.456 0.573 7.364 38.090 -3.227 0.187 3.115 11.155 -0.868 38.773 26 AA_A276U277:G295U296_AA A 276 ? A 296 ? A 277 ? A 295 ? 1 A U 73 1_555 A G 91 1_555 A C 74 1_555 A G 90 1_555 0.016 -1.922 3.105 2.354 12.825 25.064 -6.378 0.414 1.907 27.318 -5.015 28.204 27 AA_U277C278:G294G295_AA A 277 ? A 295 ? A 278 ? A 294 ? 1 A C 74 1_555 A G 90 1_555 A A 75 1_555 A U 89 1_555 -0.481 -1.504 3.223 1.347 16.335 30.762 -4.702 0.986 2.154 28.404 -2.341 34.763 28 AA_C278A279:U293G294_AA A 278 ? A 294 ? A 279 ? A 293 ? 1 A A 75 1_555 A U 89 1_555 A G 77 1_555 A C 88 1_555 -0.891 -1.392 3.495 -1.533 9.218 43.158 -2.747 1.038 3.176 12.359 2.055 44.111 29 AA_A279G281:C292U293_AA A 279 ? A 293 ? A 281 ? A 292 ? 1 A G 77 1_555 A C 88 1_555 A U 78 1_555 A G 87 1_555 0.106 -1.566 3.399 0.224 5.543 40.149 -2.886 -0.127 3.164 8.028 -0.325 40.515 30 AA_G281U282:G291C292_AA A 281 ? A 292 ? A 282 ? A 291 ? 1 A U 78 1_555 A G 87 1_555 A C 79 1_555 A G 86 1_555 -0.075 -2.123 3.301 4.195 9.200 24.263 -6.888 1.174 2.310 20.771 -9.471 26.257 31 AA_U282C283:G290G291_AA A 282 ? A 291 ? A 283 ? A 290 ? 1 A C 79 1_555 A G 86 1_555 A U 80 1_555 A U 85 1_555 -2.025 -1.708 3.678 3.845 18.146 40.182 -3.976 3.057 2.523 24.874 -5.270 44.095 32 AA_C283U284:U289G290_AA A 283 ? A 290 ? A 284 ? A 289 ? 1 A G 28 1_555 A C 59 1_555 A U 29 1_555 A G 58 1_555 -0.180 -1.723 3.404 0.106 5.661 38.553 -3.272 0.282 3.130 8.518 -0.160 38.951 33 AA_G232U233:G262C263_AA A 232 ? A 263 ? A 233 ? A 262 ? 1 A U 29 1_555 A G 58 1_555 A C 30 1_555 A G 57 1_555 -0.075 -2.069 3.189 2.314 10.996 24.084 -6.947 0.677 2.048 24.705 -5.199 26.541 34 AA_U233C234:G261G262_AA A 233 ? A 262 ? A 234 ? A 261 ? 1 A C 30 1_555 A G 57 1_555 A A 31 1_555 A U 56 1_555 -0.214 -1.781 3.727 2.443 12.391 29.722 -5.488 0.836 2.758 22.898 -4.515 32.238 35 AA_C234A235:U260G261_AA A 234 ? A 261 ? A 235 ? A 260 ? 1 A A 31 1_555 A U 56 1_555 A C 32 1_555 A G 55 1_555 0.199 -1.993 3.518 0.981 8.550 29.106 -5.519 -0.185 2.837 16.561 -1.900 30.325 36 AA_A235C236:G259U260_AA A 235 ? A 260 ? A 236 ? A 259 ? 1 A C 32 1_555 A G 55 1_555 A A 33 1_555 A C 54 1_555 -3.971 -2.844 4.293 -5.632 -1.789 16.241 -7.718 7.714 5.616 -6.078 19.131 17.276 37 AA_C236A237:C258G259_AA A 236 ? A 259 ? A 237 ? A 258 ? 1 A A 33 1_555 A C 54 1_555 A U 35 1_555 A G 53 1_555 2.171 -2.296 3.506 11.061 0.626 77.508 -1.840 -1.378 3.724 0.498 -8.793 78.172 38 AA_A237U239:G257C258_AA A 237 ? A 258 ? A 239 ? A 257 ? 1 A U 35 1_555 A G 53 1_555 A A 36 1_555 A U 52 1_555 -0.065 -1.831 3.049 0.969 14.687 29.576 -5.245 0.248 1.943 26.782 -1.767 32.963 39 AA_U239A240:U256G257_AA A 239 ? A 257 ? A 240 ? A 256 ? 1 A A 36 1_555 A U 52 1_555 A C 37 1_555 A G 51 1_555 -0.129 -1.579 3.239 -0.275 2.862 31.943 -3.358 0.186 3.091 5.188 0.499 32.069 40 AA_A240C241:G255U256_AA A 240 ? A 256 ? A 241 ? A 255 ? 1 A C 37 1_555 A G 51 1_555 A C 39 1_555 A G 50 1_555 -0.791 -2.237 5.374 20.021 15.762 45.370 -4.179 2.958 3.817 18.794 -23.872 51.705 41 AA_C241C243:G254G255_AA A 241 ? A 255 ? A 243 ? A 254 ? 1 A C 39 1_555 A G 50 1_555 A G 40 1_555 A C 49 1_555 -0.149 -1.476 3.062 5.728 18.577 28.965 -4.770 0.958 1.768 32.881 -10.139 34.767 42 AA_C243G244:C253G254_AA A 243 ? A 254 ? A 244 ? A 253 ? 1 A G 40 1_555 A C 49 1_555 A G 41 1_555 A C 48 1_555 -0.295 -1.772 3.627 1.147 24.561 31.014 -5.354 0.565 1.791 39.141 -1.828 39.390 43 AA_G244G245:C252C253_AA A 244 ? A 253 ? A 245 ? A 252 ? 1 A G 41 1_555 A C 48 1_555 A U 42 1_555 A U 47 1_555 -2.653 -1.868 4.097 3.135 32.383 42.602 -4.306 3.181 2.093 38.593 -3.736 53.140 44 AA_G245U246:U251C252_AA A 245 ? A 252 ? A 246 ? A 251 ? 1 A C 97 1_555 A G 115 1_555 A C 98 1_555 A G 114 1_555 0.569 -1.934 3.736 -2.022 8.232 30.688 -5.128 -1.430 3.084 15.194 3.731 31.810 45 AA_C301C302:G318G319_AA A 301 ? A 319 ? A 302 ? A 318 ? 1 A C 98 1_555 A G 114 1_555 A G 99 1_555 A C 113 1_555 0.051 -1.945 3.853 -0.881 10.382 29.535 -5.730 -0.276 3.011 19.612 1.665 31.281 46 AA_C302G303:C317G318_AA A 302 ? A 318 ? A 303 ? A 317 ? 1 A G 99 1_555 A C 113 1_555 A C 100 1_555 A G 112 1_555 -0.142 -1.736 3.293 0.154 4.729 31.071 -4.064 0.291 3.002 8.764 -0.285 31.420 47 AA_G303C304:G316C317_AA A 303 ? A 317 ? A 304 ? A 316 ? 1 A C 100 1_555 A G 112 1_555 A G 101 1_555 A C 111 1_555 0.032 -1.775 3.545 -0.596 13.568 31.026 -5.196 -0.149 2.566 23.975 1.054 33.802 48 AA_C304G305:C315G316_AA A 304 ? A 316 ? A 305 ? A 315 ? 1 A G 101 1_555 A C 111 1_555 A C 102 1_555 A G 110 1_555 0.000 -1.726 3.251 0.330 0.213 32.684 -3.103 0.057 3.240 0.379 -0.587 32.687 49 AA_G305C306:G314C315_AA A 305 ? A 315 ? A 306 ? A 314 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R35GM122579 1 'Howard Hughes Medical Institute (HHMI)' 'United States' ? 2 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' U24GM129541 3 'National Science Foundation (NSF, United States)' 'United States' GRFPDGE1656518 4 'Ministry of Science and Technology (MoST, China)' China 2022YFC2303700 5 'Ministry of Science and Technology (MoST, China)' China 2022YFA1302700 6 'Other private' 'United States' 'BioX Bowes fellowship' 7 'Other private' 'United States' 'BioX Interdisciplinary Initiative Program' 8 'Other private' 'United States' 'ChEM-H COVID-19 Drug and Vaccine Prototyping seed grant' 9 'Department of Energy (DOE, United States)' 'United States' 'Coronavirus CARES Act' 10 'National Institutes of Health/National Institute Of Allergy and Infectious Diseases (NIH/NIAID)' 'United States' '#U19AI171421' 11 # _atom_sites.entry_id 8UYK _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_