data_8UYS # _entry.id 8UYS # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.388 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8UYS pdb_00008uys 10.2210/pdb8uys/pdb WWPDB D_1000279186 ? ? EMDB EMD-42818 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-12-06 2 'Structure model' 1 1 2023-12-27 3 'Structure model' 1 2 2024-03-13 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 3 'Structure model' citation 3 3 'Structure model' citation_author # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.pdbx_database_id_PubMed' 2 2 'Structure model' '_citation.title' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8UYS _pdbx_database_status.recvd_initial_deposition_date 2023-11-14 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _pdbx_database_related.db_name _pdbx_database_related.details _pdbx_database_related.db_id _pdbx_database_related.content_type EMDB . EMD-42816 'other EM volume' EMDB . EMD-42809 'other EM volume' EMDB . EMD-42810 'other EM volume' EMDB . EMD-42811 'other EM volume' EMDB . EMD-42801 'other EM volume' EMDB . EMD-42805 'other EM volume' EMDB . EMD-42802 'other EM volume' EMDB . EMD-42808 'other EM volume' EMDB . EMD-42803 'other EM volume' EMDB . EMD-42813 'other EM volume' EMDB . EMD-42814 'other EM volume' PDB . 8UYP unspecified PDB . 8UYK unspecified PDB . 8UYL unspecified PDB . 8UYM unspecified PDB . 8UYE unspecified PDB . 8UYG unspecified PDB . 8UYJ unspecified EMDB ;SARS-CoV-2 5' proximal stem-loop 5 ; EMD-42818 'associated EM volume' # loop_ _pdbx_contact_author.id _pdbx_contact_author.email _pdbx_contact_author.name_first _pdbx_contact_author.name_last _pdbx_contact_author.name_mi _pdbx_contact_author.role _pdbx_contact_author.identifier_ORCID 2 rhiju@stanford.edu Rhiju Das ? 'principal investigator/group leader' 0000-0001-7497-0972 3 wahc@stanford.edu Wah Chiu ? 'principal investigator/group leader' 0000-0002-8910-3078 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kretsch, R.C.' 1 0000-0002-6935-518X 'Xu, L.' 2 0000-0002-1200-8937 'Zheludev, I.N.' 3 0000-0002-9572-0574 'Zhou, X.' 4 0000-0002-0722-7334 'Huang, R.' 5 0009-0009-6136-8013 'Nye, G.' 6 0009-0001-6698-9988 'Li, S.' 7 0000-0002-7041-5960 'Zhang, K.' 8 0000-0003-0414-4776 'Chiu, W.' 9 0000-0002-8910-3078 'Das, R.' 10 0000-0001-7497-0972 # loop_ _citation.abstract _citation.abstract_id_CAS _citation.book_id_ISBN _citation.book_publisher _citation.book_publisher_city _citation.book_title _citation.coordinate_linkage _citation.country _citation.database_id_Medline _citation.details _citation.id _citation.journal_abbrev _citation.journal_id_ASTM _citation.journal_id_CSD _citation.journal_id_ISSN _citation.journal_full _citation.journal_issue _citation.journal_volume _citation.language _citation.page_first _citation.page_last _citation.title _citation.year _citation.database_id_CSD _citation.pdbx_database_id_DOI _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_patent _citation.unpublished_flag ? ? ? ? ? ? ? US ? ? primary Proc.Natl.Acad.Sci.USA PNASA6 0040 1091-6490 ? ? 121 ? e2320493121 e2320493121 ;Tertiary folds of the SL5 RNA from the 5' proximal region of SARS-CoV-2 and related coronaviruses. ; 2024 ? 10.1073/pnas.2320493121 38427602 ? ? ? ? ? ? ? ? ? US ? ? 1 Biorxiv ? ? 2692-8205 ? ? ? ? ? ? ;Tertiary folds of the SL5 RNA from the 5' proximal region of SARS-CoV-2 and related coronaviruses. ; 2023 ? 10.1101/2023.11.22.567964 38076883 ? ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Kretsch, R.C.' 1 0000-0002-6935-518X primary 'Xu, L.' 2 0000-0002-1200-8937 primary 'Zheludev, I.N.' 3 ? primary 'Zhou, X.' 4 0000-0002-0722-7334 primary 'Huang, R.' 5 ? primary 'Nye, G.' 6 ? primary 'Li, S.' 7 ? primary 'Zhang, K.' 8 ? primary 'Chiu, W.' 9 0000-0002-8910-3078 primary 'Das, R.' 10 0000-0001-7497-0972 1 'Kretsch, R.C.' 11 ? 1 'Xu, L.' 12 ? 1 'Zheludev, I.N.' 13 ? 1 'Zhou, X.' 14 ? 1 'Huang, R.' 15 ? 1 'Nye, G.' 16 ? 1 'Li, S.' 17 ? 1 'Zhang, K.' 18 ? 1 'Chiu, W.' 19 ? 1 'Das, R.' 20 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'SARS-CoV-2 RNA SL5 domain.' _entity.formula_weight 39807.484 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGACACGAGUAACUCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCGAUCAUCAGCACAUCUAGGU UUCGUCCGGGUGUGACCGAAAGGUAAGAUGGAGAGCCUUGUCCC ; _entity_poly.pdbx_seq_one_letter_code_can ;GGACACGAGUAACUCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCGAUCAUCAGCACAUCUAGGU UUCGUCCGGGUGUGACCGAAAGGUAAGAUGGAGAGCCUUGUCCC ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 C n 1 5 A n 1 6 C n 1 7 G n 1 8 A n 1 9 G n 1 10 U n 1 11 A n 1 12 A n 1 13 C n 1 14 U n 1 15 C n 1 16 G n 1 17 U n 1 18 C n 1 19 U n 1 20 A n 1 21 U n 1 22 C n 1 23 U n 1 24 U n 1 25 C n 1 26 U n 1 27 G n 1 28 C n 1 29 A n 1 30 G n 1 31 G n 1 32 C n 1 33 U n 1 34 G n 1 35 C n 1 36 U n 1 37 U n 1 38 A n 1 39 C n 1 40 G n 1 41 G n 1 42 U n 1 43 U n 1 44 U n 1 45 C n 1 46 G n 1 47 U n 1 48 C n 1 49 C n 1 50 G n 1 51 U n 1 52 G n 1 53 U n 1 54 U n 1 55 G n 1 56 C n 1 57 A n 1 58 G n 1 59 C n 1 60 C n 1 61 G n 1 62 A n 1 63 U n 1 64 C n 1 65 A n 1 66 U n 1 67 C n 1 68 A n 1 69 G n 1 70 C n 1 71 A n 1 72 C n 1 73 A n 1 74 U n 1 75 C n 1 76 U n 1 77 A n 1 78 G n 1 79 G n 1 80 U n 1 81 U n 1 82 U n 1 83 C n 1 84 G n 1 85 U n 1 86 C n 1 87 C n 1 88 G n 1 89 G n 1 90 G n 1 91 U n 1 92 G n 1 93 U n 1 94 G n 1 95 A n 1 96 C n 1 97 C n 1 98 G n 1 99 A n 1 100 A n 1 101 A n 1 102 G n 1 103 G n 1 104 U n 1 105 A n 1 106 A n 1 107 G n 1 108 A n 1 109 U n 1 110 G n 1 111 G n 1 112 A n 1 113 G n 1 114 A n 1 115 G n 1 116 C n 1 117 C n 1 118 U n 1 119 U n 1 120 G n 1 121 U n 1 122 C n 1 123 C n 1 124 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 124 _pdbx_entity_src_syn.organism_scientific 'Severe acute respiratory syndrome coronavirus 2' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 2697049 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 159 159 G G A . n A 1 2 G 2 160 160 G G A . n A 1 3 A 3 161 161 A A A . n A 1 4 C 4 162 162 C C A . n A 1 5 A 5 163 163 A A A . n A 1 6 C 6 164 164 C C A . n A 1 7 G 7 165 165 G G A . n A 1 8 A 8 166 166 A A A . n A 1 9 G 9 167 167 G G A . n A 1 10 U 10 168 168 U U A . n A 1 11 A 11 169 169 A A A . n A 1 12 A 12 170 170 A A A . n A 1 13 C 13 171 171 C C A . n A 1 14 U 14 172 172 U U A . n A 1 15 C 15 173 173 C C A . n A 1 16 G 16 174 174 G G A . n A 1 17 U 17 175 175 U U A . n A 1 18 C 18 176 176 C C A . n A 1 19 U 19 177 177 U U A . n A 1 20 A 20 178 178 A A A . n A 1 21 U 21 179 179 U U A . n A 1 22 C 22 180 180 C C A . n A 1 23 U 23 181 181 U U A . n A 1 24 U 24 182 182 U U A . n A 1 25 C 25 183 183 C C A . n A 1 26 U 26 184 184 U U A . n A 1 27 G 27 185 185 G G A . n A 1 28 C 28 186 186 C C A . n A 1 29 A 29 187 187 A A A . n A 1 30 G 30 188 188 G G A . n A 1 31 G 31 189 189 G G A . n A 1 32 C 32 190 190 C C A . n A 1 33 U 33 191 191 U U A . n A 1 34 G 34 192 192 G G A . n A 1 35 C 35 193 193 C C A . n A 1 36 U 36 194 194 U U A . n A 1 37 U 37 195 195 U U A . n A 1 38 A 38 196 196 A A A . n A 1 39 C 39 197 197 C C A . n A 1 40 G 40 198 198 G G A . n A 1 41 G 41 199 199 G G A . n A 1 42 U 42 200 200 U U A . n A 1 43 U 43 201 201 U U A . n A 1 44 U 44 202 202 U U A . n A 1 45 C 45 203 203 C C A . n A 1 46 G 46 204 204 G G A . n A 1 47 U 47 205 205 U U A . n A 1 48 C 48 206 206 C C A . n A 1 49 C 49 207 207 C C A . n A 1 50 G 50 208 208 G G A . n A 1 51 U 51 209 209 U U A . n A 1 52 G 52 210 210 G G A . n A 1 53 U 53 211 211 U U A . n A 1 54 U 54 212 212 U U A . n A 1 55 G 55 213 213 G G A . n A 1 56 C 56 214 214 C C A . n A 1 57 A 57 215 215 A A A . n A 1 58 G 58 216 216 G G A . n A 1 59 C 59 217 217 C C A . n A 1 60 C 60 218 218 C C A . n A 1 61 G 61 219 219 G G A . n A 1 62 A 62 220 220 A A A . n A 1 63 U 63 221 221 U U A . n A 1 64 C 64 222 222 C C A . n A 1 65 A 65 223 223 A A A . n A 1 66 U 66 224 224 U U A . n A 1 67 C 67 225 225 C C A . n A 1 68 A 68 226 226 A A A . n A 1 69 G 69 227 227 G G A . n A 1 70 C 70 228 228 C C A . n A 1 71 A 71 229 229 A A A . n A 1 72 C 72 230 230 C C A . n A 1 73 A 73 231 231 A A A . n A 1 74 U 74 232 232 U U A . n A 1 75 C 75 233 233 C C A . n A 1 76 U 76 234 234 U U A . n A 1 77 A 77 235 235 A A A . n A 1 78 G 78 236 236 G G A . n A 1 79 G 79 237 237 G G A . n A 1 80 U 80 238 238 U U A . n A 1 81 U 81 239 239 U U A . n A 1 82 U 82 240 240 U U A . n A 1 83 C 83 241 241 C C A . n A 1 84 G 84 242 242 G G A . n A 1 85 U 85 243 243 U U A . n A 1 86 C 86 244 244 C C A . n A 1 87 C 87 245 245 C C A . n A 1 88 G 88 246 246 G G A . n A 1 89 G 89 247 247 G G A . n A 1 90 G 90 248 248 G G A . n A 1 91 U 91 249 249 U U A . n A 1 92 G 92 250 250 G G A . n A 1 93 U 93 251 251 U U A . n A 1 94 G 94 252 252 G G A . n A 1 95 A 95 253 253 A A A . n A 1 96 C 96 254 254 C C A . n A 1 97 C 97 255 255 C C A . n A 1 98 G 98 256 256 G G A . n A 1 99 A 99 257 257 A A A . n A 1 100 A 100 258 258 A A A . n A 1 101 A 101 259 259 A A A . n A 1 102 G 102 260 260 G G A . n A 1 103 G 103 261 261 G G A . n A 1 104 U 104 262 262 U U A . n A 1 105 A 105 263 263 A A A . n A 1 106 A 106 264 264 A A A . n A 1 107 G 107 265 265 G G A . n A 1 108 A 108 266 266 A A A . n A 1 109 U 109 267 267 U U A . n A 1 110 G 110 268 268 G G A . n A 1 111 G 111 269 269 G G A . n A 1 112 A 112 270 270 A A A . n A 1 113 G 113 271 271 G G A . n A 1 114 A 114 272 272 A A A . n A 1 115 G 115 273 273 G G A . n A 1 116 C 116 274 274 C C A . n A 1 117 C 117 275 275 C C A . n A 1 118 U 118 276 276 U U A . n A 1 119 U 119 277 277 U U A . n A 1 120 G 120 278 278 G G A . n A 1 121 U 121 279 279 U U A . n A 1 122 C 122 280 280 C C A . n A 1 123 C 123 281 281 C C A . n A 1 124 C 124 282 282 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8UYS _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _struct.entry_id 8UYS _struct.title ;SARS-CoV-2 5' proximal stem-loop 5 ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8UYS _struct_keywords.text ;SL5, coronavirus, 5' UTR, RNA ; _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name GB _struct_ref.db_code NC_045512.2 _struct_ref.pdbx_db_accession NC_045512.2 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ;GGACACGAGUAACUCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCGAUCAUCAGCACAUCUAGGU UUCGUCCGGGUGUGACCGAAAGGUAAGAUGGAGAGCCUUGUCCC ; _struct_ref.pdbx_align_begin 159 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8UYS _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 124 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession NC_045512.2 _struct_ref_seq.db_align_beg 159 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 282 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 159 _struct_ref_seq.pdbx_auth_seq_align_end 282 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'electron microscopy' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 123 N3 ? ? A G 159 A C 281 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 123 O2 ? ? A G 159 A C 281 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 123 N4 ? ? A G 159 A C 281 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 122 N3 ? ? A G 160 A C 280 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 122 O2 ? ? A G 160 A C 280 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 122 N4 ? ? A G 160 A C 280 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 121 N3 ? ? A A 161 A U 279 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 121 O4 ? ? A A 161 A U 279 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 120 N1 ? ? A C 162 A G 278 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 120 O6 ? ? A C 162 A G 278 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 120 N2 ? ? A C 162 A G 278 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 119 N3 ? ? A A 163 A U 277 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 119 O4 ? ? A A 163 A U 277 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 7 N1 ? ? ? 1_555 A U 119 O2 ? ? A G 165 A U 277 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog15 hydrog ? ? A G 7 O6 ? ? ? 1_555 A U 119 N3 ? ? A G 165 A U 277 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog16 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 118 N3 ? ? A A 166 A U 276 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 118 O4 ? ? A A 166 A U 276 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 117 N3 ? ? A G 167 A C 275 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 117 O2 ? ? A G 167 A C 275 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 117 N4 ? ? A G 167 A C 275 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A U 10 O2 ? ? ? 1_555 A A 12 N6 ? ? A U 168 A A 170 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog22 hydrog ? ? A U 10 O2 ? ? ? 1_555 A C 116 N4 ? ? A U 168 A C 274 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog23 hydrog ? ? A A 11 N6 ? ? ? 1_555 A A 112 N7 ? ? A A 169 A A 270 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog24 hydrog ? ? A A 12 N6 ? ? ? 1_555 A C 116 N3 ? ? A A 170 A C 274 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog25 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 115 N1 ? ? A C 171 A G 273 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 115 O6 ? ? A C 171 A G 273 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 115 N2 ? ? A C 171 A G 273 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 114 N1 ? ? A U 172 A A 272 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 114 N6 ? ? A U 172 A A 272 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 113 N1 ? ? A C 173 A G 271 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 113 O6 ? ? A C 173 A G 271 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 113 N2 ? ? A C 173 A G 271 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 16 N1 ? ? ? 1_555 A A 112 N1 ? ? A G 174 A A 270 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog34 hydrog ? ? A G 16 O6 ? ? ? 1_555 A A 112 N6 ? ? A G 174 A A 270 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog35 hydrog ? ? A U 17 N3 ? ? ? 1_555 A A 112 N1 ? ? A U 175 A A 270 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A U 17 O4 ? ? ? 1_555 A A 112 N6 ? ? A U 175 A A 270 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 18 N3 ? ? ? 1_555 A G 111 N1 ? ? A C 176 A G 269 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 18 N4 ? ? ? 1_555 A G 111 O6 ? ? A C 176 A G 269 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 18 O2 ? ? ? 1_555 A G 111 N2 ? ? A C 176 A G 269 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A U 19 N3 ? ? ? 1_555 A G 110 O6 ? ? A U 177 A G 268 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog41 hydrog ? ? A U 19 O2 ? ? ? 1_555 A G 110 N1 ? ? A U 177 A G 268 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog42 hydrog ? ? A A 20 N1 ? ? ? 1_555 A U 109 N3 ? ? A A 178 A U 267 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A A 20 N6 ? ? ? 1_555 A U 109 O4 ? ? A A 178 A U 267 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A U 21 N3 ? ? ? 1_555 A A 108 N1 ? ? A U 179 A A 266 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A U 21 O4 ? ? ? 1_555 A A 108 N6 ? ? A U 179 A A 266 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 22 N3 ? ? ? 1_555 A G 107 N1 ? ? A C 180 A G 265 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 22 N4 ? ? ? 1_555 A G 107 O6 ? ? A C 180 A G 265 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 22 O2 ? ? ? 1_555 A G 107 N2 ? ? A C 180 A G 265 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A U 23 N3 ? ? ? 1_555 A A 106 N1 ? ? A U 181 A A 264 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A U 23 O4 ? ? ? 1_555 A A 106 N6 ? ? A U 181 A A 264 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A U 24 N3 ? ? ? 1_555 A A 105 N1 ? ? A U 182 A A 263 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A U 24 O4 ? ? ? 1_555 A A 105 N6 ? ? A U 182 A A 263 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 25 N3 ? ? ? 1_555 A G 69 N1 ? ? A C 183 A G 227 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 25 N4 ? ? ? 1_555 A G 69 O6 ? ? A C 183 A G 227 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 25 O2 ? ? ? 1_555 A G 69 N2 ? ? A C 183 A G 227 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A U 26 N3 ? ? ? 1_555 A A 68 N1 ? ? A U 184 A A 226 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A U 26 O4 ? ? ? 1_555 A A 68 N6 ? ? A U 184 A A 226 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 67 N3 ? ? A G 185 A C 225 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 67 O2 ? ? A G 185 A C 225 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 67 N4 ? ? A G 185 A C 225 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A C 28 N3 ? ? ? 1_555 A U 66 N3 ? ? A C 186 A U 224 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog62 hydrog ? ? A C 28 N4 ? ? ? 1_555 A U 66 O4 ? ? A C 186 A U 224 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog63 hydrog ? ? A A 29 N1 ? ? ? 1_555 A G 61 N1 ? ? A A 187 A G 219 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog64 hydrog ? ? A A 29 N6 ? ? ? 1_555 A G 61 O6 ? ? A A 187 A G 219 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog65 hydrog ? ? A G 30 N1 ? ? ? 1_555 A C 60 N3 ? ? A G 188 A C 218 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 30 N2 ? ? ? 1_555 A C 60 O2 ? ? A G 188 A C 218 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A G 30 O6 ? ? ? 1_555 A C 60 N4 ? ? A G 188 A C 218 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 59 N3 ? ? A G 189 A C 217 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 59 O2 ? ? A G 189 A C 217 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 59 N4 ? ? A G 189 A C 217 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A C 32 N3 ? ? ? 1_555 A G 58 N1 ? ? A C 190 A G 216 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A C 32 N4 ? ? ? 1_555 A G 58 O6 ? ? A C 190 A G 216 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A C 32 O2 ? ? ? 1_555 A G 58 N2 ? ? A C 190 A G 216 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A U 33 N3 ? ? ? 1_555 A A 57 N1 ? ? A U 191 A A 215 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A U 33 O4 ? ? ? 1_555 A A 57 N6 ? ? A U 191 A A 215 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A G 34 N1 ? ? ? 1_555 A C 56 N3 ? ? A G 192 A C 214 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A G 34 N2 ? ? ? 1_555 A C 56 O2 ? ? A G 192 A C 214 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A G 34 O6 ? ? ? 1_555 A C 56 N4 ? ? A G 192 A C 214 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A C 35 N3 ? ? ? 1_555 A G 55 N1 ? ? A C 193 A G 213 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A C 35 N4 ? ? ? 1_555 A G 55 O6 ? ? A C 193 A G 213 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A C 35 O2 ? ? ? 1_555 A G 55 N2 ? ? A C 193 A G 213 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A U 36 N3 ? ? ? 1_555 A U 54 O4 ? ? A U 194 A U 212 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog83 hydrog ? ? A U 37 N3 ? ? ? 1_555 A U 53 O4 ? ? A U 195 A U 211 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog84 hydrog ? ? A U 37 O2 ? ? ? 1_555 A U 53 N3 ? ? A U 195 A U 211 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog85 hydrog ? ? A A 38 N1 ? ? ? 1_555 A U 51 N3 ? ? A A 196 A U 209 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A A 38 N6 ? ? ? 1_555 A U 51 O4 ? ? A A 196 A U 209 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A C 39 N3 ? ? ? 1_555 A G 50 N1 ? ? A C 197 A G 208 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A C 39 N4 ? ? ? 1_555 A G 50 O6 ? ? A C 197 A G 208 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A C 39 O2 ? ? ? 1_555 A G 50 N2 ? ? A C 197 A G 208 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A G 40 N1 ? ? ? 1_555 A C 49 N3 ? ? A G 198 A C 207 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A G 40 N2 ? ? ? 1_555 A C 49 O2 ? ? A G 198 A C 207 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A G 40 O6 ? ? ? 1_555 A C 49 N4 ? ? A G 198 A C 207 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A G 41 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 199 A C 206 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? A G 41 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 199 A C 206 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A G 41 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 199 A C 206 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A U 42 N3 ? ? ? 1_555 A U 47 O4 ? ? A U 200 A U 205 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog97 hydrog ? ? A C 70 N3 ? ? ? 1_555 A G 94 N1 ? ? A C 228 A G 252 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? A C 70 N4 ? ? ? 1_555 A G 94 O6 ? ? A C 228 A G 252 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? A C 70 O2 ? ? ? 1_555 A G 94 N2 ? ? A C 228 A G 252 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? A A 71 N1 ? ? ? 1_555 A U 93 N3 ? ? A A 229 A U 251 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog101 hydrog ? ? A A 71 N6 ? ? ? 1_555 A U 93 O4 ? ? A A 229 A U 251 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog102 hydrog ? ? A C 72 N3 ? ? ? 1_555 A G 92 N1 ? ? A C 230 A G 250 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog103 hydrog ? ? A C 72 N4 ? ? ? 1_555 A G 92 O6 ? ? A C 230 A G 250 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog104 hydrog ? ? A C 72 O2 ? ? ? 1_555 A G 92 N2 ? ? A C 230 A G 250 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog105 hydrog ? ? A A 73 N1 ? ? ? 1_555 A U 91 N3 ? ? A A 231 A U 249 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog106 hydrog ? ? A A 73 N6 ? ? ? 1_555 A U 91 O4 ? ? A A 231 A U 249 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog107 hydrog ? ? A U 74 N3 ? ? ? 1_555 A G 90 O6 ? ? A U 232 A G 248 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog108 hydrog ? ? A U 74 O2 ? ? ? 1_555 A G 90 N1 ? ? A U 232 A G 248 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog109 hydrog ? ? A C 75 N3 ? ? ? 1_555 A G 89 N1 ? ? A C 233 A G 247 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog110 hydrog ? ? A C 75 N4 ? ? ? 1_555 A G 89 O6 ? ? A C 233 A G 247 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog111 hydrog ? ? A C 75 O2 ? ? ? 1_555 A G 89 N2 ? ? A C 233 A G 247 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog112 hydrog ? ? A U 76 N3 ? ? ? 1_555 A G 88 O6 ? ? A U 234 A G 246 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog113 hydrog ? ? A U 76 O2 ? ? ? 1_555 A G 88 N1 ? ? A U 234 A G 246 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog114 hydrog ? ? A G 78 N1 ? ? ? 1_555 A C 87 N3 ? ? A G 236 A C 245 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog115 hydrog ? ? A G 78 N2 ? ? ? 1_555 A C 87 O2 ? ? A G 236 A C 245 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog116 hydrog ? ? A G 78 O6 ? ? ? 1_555 A C 87 N4 ? ? A G 236 A C 245 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog117 hydrog ? ? A G 79 N1 ? ? ? 1_555 A C 86 N3 ? ? A G 237 A C 244 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog118 hydrog ? ? A G 79 N2 ? ? ? 1_555 A C 86 O2 ? ? A G 237 A C 244 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog119 hydrog ? ? A G 79 O6 ? ? ? 1_555 A C 86 N4 ? ? A G 237 A C 244 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog120 hydrog ? ? A U 80 N3 ? ? ? 1_555 A C 86 N3 ? ? A U 238 A C 244 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog121 hydrog ? ? A U 80 O4 ? ? ? 1_555 A C 86 N4 ? ? A U 238 A C 244 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog122 hydrog ? ? A A 95 N1 ? ? ? 1_555 A U 104 N3 ? ? A A 253 A U 262 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog123 hydrog ? ? A A 95 N6 ? ? ? 1_555 A U 104 O4 ? ? A A 253 A U 262 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog124 hydrog ? ? A C 96 N3 ? ? ? 1_555 A G 103 N1 ? ? A C 254 A G 261 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog125 hydrog ? ? A C 96 N4 ? ? ? 1_555 A G 103 O6 ? ? A C 254 A G 261 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog126 hydrog ? ? A C 96 O2 ? ? ? 1_555 A G 103 N2 ? ? A C 254 A G 261 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog127 hydrog ? ? A C 97 N3 ? ? ? 1_555 A G 102 N1 ? ? A C 255 A G 260 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog128 hydrog ? ? A C 97 N4 ? ? ? 1_555 A G 102 O6 ? ? A C 255 A G 260 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog129 hydrog ? ? A C 97 O2 ? ? ? 1_555 A G 102 N2 ? ? A C 255 A G 260 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog130 hydrog ? ? A G 98 N2 ? ? ? 1_555 A A 101 N7 ? ? A G 256 A A 259 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _em_3d_fitting.id 1 _em_3d_fitting.entry_id 8UYS _em_3d_fitting.method ? _em_3d_fitting.target_criteria ? _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_space REAL _em_3d_fitting.ref_protocol OTHER # _em_3d_reconstruction.entry_id 8UYS _em_3d_reconstruction.id 1 _em_3d_reconstruction.method ? _em_3d_reconstruction.algorithm 'FOURIER SPACE' _em_3d_reconstruction.citation_id ? _em_3d_reconstruction.details ? _em_3d_reconstruction.resolution 4.7 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.magnification_calibration ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.num_particles 445981 _em_3d_reconstruction.euler_angles_details ? _em_3d_reconstruction.num_class_averages 1 _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.symmetry_type POINT # _em_buffer.id 1 _em_buffer.specimen_id 1 _em_buffer.name ? _em_buffer.details ? _em_buffer.pH 8.0 # _em_entity_assembly.id 1 _em_entity_assembly.parent_id 0 _em_entity_assembly.source SYNTHETIC _em_entity_assembly.type COMPLEX _em_entity_assembly.name ;SARS-CoV-2 5' proximal stem-loop 5 ; _em_entity_assembly.details ? _em_entity_assembly.synonym ? _em_entity_assembly.oligomeric_details ? _em_entity_assembly.entity_id_list 1 # _em_image_scans.entry_id 8UYS _em_image_scans.id 1 _em_image_scans.number_digital_images ? _em_image_scans.details ? _em_image_scans.scanner_model ? _em_image_scans.sampling_size ? _em_image_scans.od_range ? _em_image_scans.quant_bit_size ? _em_image_scans.citation_id ? _em_image_scans.dimension_height 4096 _em_image_scans.dimension_width 4096 _em_image_scans.frames_per_image ? _em_image_scans.image_recording_id 1 _em_image_scans.used_frames_per_image ? # _em_imaging.entry_id 8UYS _em_imaging.id 1 _em_imaging.astigmatism ? _em_imaging.electron_beam_tilt_params ? _em_imaging.residual_tilt ? _em_imaging.microscope_model 'TFS KRIOS' _em_imaging.specimen_holder_type ? _em_imaging.specimen_holder_model 'FEI TITAN KRIOS AUTOGRID HOLDER' _em_imaging.details ? _em_imaging.date ? _em_imaging.accelerating_voltage 300 _em_imaging.illumination_mode 'FLOOD BEAM' _em_imaging.mode 'BRIGHT FIELD' _em_imaging.nominal_cs 2.7 _em_imaging.nominal_defocus_min 1000 _em_imaging.nominal_defocus_max 2500 _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_defocus_max ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.nominal_magnification 96000 _em_imaging.calibrated_magnification ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.citation_id ? _em_imaging.temperature ? _em_imaging.detector_distance ? _em_imaging.recording_temperature_minimum ? _em_imaging.recording_temperature_maximum ? _em_imaging.alignment_procedure 'COMA FREE' _em_imaging.c2_aperture_diameter 70 _em_imaging.specimen_id 1 _em_imaging.cryogen NITROGEN # _em_sample_support.id 1 _em_sample_support.film_material ? _em_sample_support.method ? _em_sample_support.grid_material COPPER _em_sample_support.grid_mesh_size 300 _em_sample_support.grid_type 'Quantifoil R1.2/1.3' _em_sample_support.details '1 of the 4 grids was Quantifoil R 2/1 grids (Cu, 200 mesh)' _em_sample_support.specimen_id 1 _em_sample_support.citation_id ? # _em_vitrification.entry_id 8UYS _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.cryogen_name ETHANE _em_vitrification.humidity 100 _em_vitrification.temp ? _em_vitrification.chamber_temperature 278 _em_vitrification.instrument 'FEI VITROBOT MARK IV' _em_vitrification.method ? _em_vitrification.time_resolved_state ? _em_vitrification.citation_id ? _em_vitrification.details ? # _em_experiment.entry_id 8UYS _em_experiment.id 1 _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.aggregation_state PARTICLE _em_experiment.entity_assembly_id 1 # _em_single_particle_entity.entry_id 8UYS _em_single_particle_entity.id 1 _em_single_particle_entity.image_processing_id 1 _em_single_particle_entity.point_symmetry C1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _em_buffer_component.buffer_id _em_buffer_component.concentration _em_buffer_component.concentration_units _em_buffer_component.formula _em_buffer_component.id _em_buffer_component.name 1 50 mM Na-C8H18N2O4S 1 'Sodium HEPES' 1 10 mM MgCl2 2 'Magnesium Chloride' # _em_ctf_correction.details ? _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.id 1 _em_ctf_correction.type 'PHASE FLIPPING AND AMPLITUDE CORRECTION' # _em_entity_assembly_molwt.entity_assembly_id 1 _em_entity_assembly_molwt.experimental_flag NO _em_entity_assembly_molwt.id 1 _em_entity_assembly_molwt.units MEGADALTONS _em_entity_assembly_molwt.value 0.04003 # _em_entity_assembly_synthetic.cell ? _em_entity_assembly_synthetic.entity_assembly_id 1 _em_entity_assembly_synthetic.id 2 _em_entity_assembly_synthetic.ncbi_tax_id 2697049 _em_entity_assembly_synthetic.organism 'Severe acute respiratory syndrome coronavirus 2' _em_entity_assembly_synthetic.strain ? _em_entity_assembly_synthetic.cellular_location ? _em_entity_assembly_synthetic.organ ? _em_entity_assembly_synthetic.organelle ? _em_entity_assembly_synthetic.tissue ? # _em_image_processing.details ? _em_image_processing.id 1 _em_image_processing.image_recording_id 1 # _em_image_recording.average_exposure_time 4.88 _em_image_recording.avg_electron_dose_per_subtomogram ? _em_image_recording.avg_electron_dose_per_image 50.0 _em_image_recording.details 'For collections had exposure times of 6.00s, 3.84s, 4.13s, 5.56s. Four collection had 11,815, 4,217, 4,592 5,540 micrographs.' _em_image_recording.detector_mode ? _em_image_recording.film_or_detector_model 'FEI FALCON IV (4k x 4k)' _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged 1 _em_image_recording.num_real_images 26164 # _em_particle_selection.details ? _em_particle_selection.id 1 _em_particle_selection.image_processing_id 1 _em_particle_selection.method ? _em_particle_selection.num_particles_selected 1562978 _em_particle_selection.reference_model ? # loop_ _em_software.category _em_software.details _em_software.id _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id _em_software.name _em_software.version 'PARTICLE SELECTION' Template 1 1 ? ? cryoSPARC 3.2.0 'IMAGE ACQUISITION' ? 2 ? ? 1 EPU ? MASKING ? 3 ? ? ? ? ? 'CTF CORRECTION' 'Patch CTF Estimation' 4 1 ? ? cryoSPARC 3.2.0 'LAYERLINE INDEXING' ? 5 ? ? ? ? ? 'DIFFRACTION INDEXING' ? 6 ? ? ? ? ? 'MODEL FITTING' auto-DRRAFTER 7 ? 1 ? Rosetta 2020.42 OTHER ? 8 ? ? ? ? ? 'MODEL REFINEMENT' phenix.real_space_refine 9 ? 1 ? ERRASER 2 'INITIAL EULER ASSIGNMENT' 'Ab initio reconstruction multi-class' 10 1 ? ? cryoSPARC 3.2.0 'FINAL EULER ASSIGNMENT' 'Non-uniform Refinement' 11 1 ? ? cryoSPARC 3.2.0 CLASSIFICATION 'Heterogeneous refinement' 12 1 ? ? cryoSPARC 3.2.0 RECONSTRUCTION 'Non-uniform Refinement' 13 1 ? ? cryoSPARC 3.2.0 # _em_specimen.concentration 1.20 _em_specimen.details '1 of the 4 grids was at 0.80 mg/mL' _em_specimen.embedding_applied NO _em_specimen.experiment_id 1 _em_specimen.id 1 _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8UYS 'double helix' 8UYS 'a-form double helix' 8UYS 'hairpin loop' 8UYS tetraloop 8UYS 'bulge loop' 8UYS 'mismatched base pair' 8UYS 'internal loop' 8UYS 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 123 1_555 -0.193 -0.169 -0.511 -1.454 0.429 -3.918 1 A_G159:C281_A A 159 ? A 281 ? 19 1 1 A G 2 1_555 A C 122 1_555 -0.209 -0.181 -0.376 -1.996 -5.371 -1.936 2 A_G160:C280_A A 160 ? A 280 ? 19 1 1 A A 3 1_555 A U 121 1_555 -0.019 -0.121 -0.282 -3.818 -10.753 -3.725 3 A_A161:U279_A A 161 ? A 279 ? 20 1 1 A C 4 1_555 A G 120 1_555 0.144 -0.176 -0.053 1.660 -12.437 -1.845 4 A_C162:G278_A A 162 ? A 278 ? 19 1 1 A A 5 1_555 A U 119 1_555 0.067 0.188 -0.514 -12.444 -14.623 -11.444 5 A_A163:U277_A A 163 ? A 277 ? 20 1 1 A A 8 1_555 A U 118 1_555 -0.210 -0.168 -0.168 7.354 -14.224 0.254 6 A_A166:U276_A A 166 ? A 276 ? 20 1 1 A G 9 1_555 A C 117 1_555 -0.119 -0.146 -0.391 -9.656 -14.672 1.196 7 A_G167:C275_A A 167 ? A 275 ? 19 1 1 A A 12 1_555 A C 116 1_555 -1.903 0.133 0.724 20.831 -3.846 -7.305 8 A_A170:C274_A A 170 ? A 274 ? ? ? 1 A C 13 1_555 A G 115 1_555 0.103 -0.111 -0.019 11.930 -16.859 -1.471 9 A_C171:G273_A A 171 ? A 273 ? 19 1 1 A U 14 1_555 A A 114 1_555 -0.053 -0.142 -0.144 2.727 -15.500 -2.241 10 A_U172:A272_A A 172 ? A 272 ? 20 1 1 A C 15 1_555 A G 113 1_555 -0.130 -0.019 0.060 2.902 -3.874 -5.385 11 A_C173:G271_A A 173 ? A 271 ? 19 1 1 A U 17 1_555 A A 112 1_555 -0.043 -0.300 0.960 -2.587 -6.906 -0.473 12 A_U175:A270_A A 175 ? A 270 ? 20 1 1 A C 18 1_555 A G 111 1_555 0.039 -0.127 0.105 3.046 -14.678 -3.793 13 A_C176:G269_A A 176 ? A 269 ? 19 1 1 A U 19 1_555 A G 110 1_555 1.681 -0.347 0.203 -1.713 -12.207 -6.652 14 A_U177:G268_A A 177 ? A 268 ? 28 1 1 A A 20 1_555 A U 109 1_555 -0.019 -0.122 0.170 0.153 -9.637 -5.129 15 A_A178:U267_A A 178 ? A 267 ? 20 1 1 A U 21 1_555 A A 108 1_555 0.086 -0.062 0.086 2.625 -9.332 -5.891 16 A_U179:A266_A A 179 ? A 266 ? 20 1 1 A C 22 1_555 A G 107 1_555 0.156 -0.144 0.000 6.875 -15.060 -2.491 17 A_C180:G265_A A 180 ? A 265 ? 19 1 1 A U 23 1_555 A A 106 1_555 0.072 -0.174 0.015 -0.672 -24.105 -4.365 18 A_U181:A264_A A 181 ? A 264 ? 20 1 1 A U 24 1_555 A A 105 1_555 -0.166 0.037 0.540 -10.640 -18.989 -8.574 19 A_U182:A263_A A 182 ? A 263 ? 20 1 1 A A 95 1_555 A U 104 1_555 -0.206 -0.016 -0.280 3.225 -9.866 -12.144 20 A_A253:U262_A A 253 ? A 262 ? 20 1 1 A C 96 1_555 A G 103 1_555 0.128 -0.194 -0.303 4.341 -10.965 -2.252 21 A_C254:G261_A A 254 ? A 261 ? 19 1 1 A C 97 1_555 A G 102 1_555 0.289 -0.246 -0.345 0.384 -3.411 -3.514 22 A_C255:G260_A A 255 ? A 260 ? 19 1 1 A G 98 1_555 A A 101 1_555 7.388 -5.223 -0.020 26.977 18.769 -32.257 23 A_G256:A259_A A 256 ? A 259 ? ? ? 1 A U 47 1_555 A U 42 1_555 -3.063 -1.137 -0.003 10.059 7.560 -32.065 24 A_U205:U200_A A 205 ? A 200 ? ? ? 1 A C 48 1_555 A G 41 1_555 -0.099 -0.104 -0.507 7.611 -3.651 -5.202 25 A_C206:G199_A A 206 ? A 199 ? 19 1 1 A C 49 1_555 A G 40 1_555 0.025 -0.174 -0.396 3.291 -9.380 -3.041 26 A_C207:G198_A A 207 ? A 198 ? 19 1 1 A G 50 1_555 A C 39 1_555 -0.130 -0.190 0.195 -1.959 -9.400 -4.092 27 A_G208:C197_A A 208 ? A 197 ? 19 1 1 A U 51 1_555 A A 38 1_555 -0.058 -0.135 0.307 7.486 -2.921 -5.404 28 A_U209:A196_A A 209 ? A 196 ? 20 1 1 A U 53 1_555 A U 37 1_555 -2.146 -2.063 1.166 4.073 -8.095 5.376 29 A_U211:U195_A A 211 ? A 195 ? 16 1 1 A U 54 1_555 A U 36 1_555 -2.077 -1.415 -0.317 1.198 -12.866 -14.186 30 A_U212:U194_A A 212 ? A 194 ? ? ? 1 A G 55 1_555 A C 35 1_555 -0.194 -0.102 -0.077 3.417 -7.079 -0.411 31 A_G213:C193_A A 213 ? A 193 ? 19 1 1 A C 56 1_555 A G 34 1_555 0.049 -0.125 -0.184 5.591 -7.129 -1.314 32 A_C214:G192_A A 214 ? A 192 ? 19 1 1 A A 57 1_555 A U 33 1_555 0.044 -0.092 -0.175 -1.932 -8.263 -3.059 33 A_A215:U191_A A 215 ? A 191 ? 20 1 1 A G 58 1_555 A C 32 1_555 -0.113 -0.137 -0.062 -3.405 -13.393 -0.987 34 A_G216:C190_A A 216 ? A 190 ? 19 1 1 A C 59 1_555 A G 31 1_555 0.227 -0.210 0.048 -0.956 -17.808 -2.052 35 A_C217:G189_A A 217 ? A 189 ? 19 1 1 A C 60 1_555 A G 30 1_555 -0.104 -0.038 0.395 -8.468 -13.813 -9.225 36 A_C218:G188_A A 218 ? A 188 ? 19 1 1 A G 61 1_555 A A 29 1_555 0.183 1.542 -0.418 3.975 10.445 -27.488 37 A_G219:A187_A A 219 ? A 187 ? 8 1 1 A U 66 1_555 A C 28 1_555 -0.327 -1.401 0.206 -18.191 -6.294 3.435 38 A_U224:C186_A A 224 ? A 186 ? 18 1 1 A C 67 1_555 A G 27 1_555 0.033 -0.163 0.005 -0.801 -3.726 -1.720 39 A_C225:G185_A A 225 ? A 185 ? 19 1 1 A A 68 1_555 A U 26 1_555 0.026 -0.051 -0.042 2.168 -8.527 -7.212 40 A_A226:U184_A A 226 ? A 184 ? 20 1 1 A G 69 1_555 A C 25 1_555 -0.256 -0.196 0.139 6.537 -12.106 -0.772 41 A_G227:C183_A A 227 ? A 183 ? 19 1 1 A C 70 1_555 A G 94 1_555 -0.052 -0.130 0.175 3.799 -13.930 -4.390 42 A_C228:G252_A A 228 ? A 252 ? 19 1 1 A A 71 1_555 A U 93 1_555 -0.018 -0.060 0.000 0.927 -11.326 -5.955 43 A_A229:U251_A A 229 ? A 251 ? 20 1 1 A C 72 1_555 A G 92 1_555 0.030 -0.136 0.118 4.574 -11.113 -4.212 44 A_C230:G250_A A 230 ? A 250 ? 19 1 1 A A 73 1_555 A U 91 1_555 0.048 -0.026 -0.129 0.479 -12.622 -6.330 45 A_A231:U249_A A 231 ? A 249 ? 20 1 1 A U 74 1_555 A G 90 1_555 1.836 -0.326 -0.062 5.436 -8.731 -1.416 46 A_U232:G248_A A 232 ? A 248 ? 28 1 1 A C 75 1_555 A G 89 1_555 0.374 -0.253 -0.545 2.848 -12.895 2.991 47 A_C233:G247_A A 233 ? A 247 ? 19 1 1 A U 76 1_555 A G 88 1_555 2.360 -0.576 -0.323 -3.684 -3.373 -4.437 48 A_U234:G246_A A 234 ? A 246 ? 28 1 1 A G 78 1_555 A C 87 1_555 -0.050 -0.107 -0.091 15.856 -8.532 -0.669 49 A_G236:C245_A A 236 ? A 245 ? 19 1 1 A G 79 1_555 A C 86 1_555 0.089 -0.625 -1.738 -15.765 0.325 -6.407 50 A_G237:C244_A A 237 ? A 244 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 123 1_555 A G 2 1_555 A C 122 1_555 -0.068 -1.936 3.525 -1.149 8.986 30.331 -5.208 -0.087 2.849 16.711 2.137 31.624 1 AA_G159G160:C280C281_AA A 159 ? A 281 ? A 160 ? A 280 ? 1 A G 2 1_555 A C 122 1_555 A A 3 1_555 A U 121 1_555 -0.126 -1.792 3.483 -0.655 10.034 31.563 -4.814 0.113 2.799 17.887 1.168 33.087 2 AA_G160A161:U279C280_AA A 160 ? A 280 ? A 161 ? A 279 ? 1 A A 3 1_555 A U 121 1_555 A C 4 1_555 A G 120 1_555 0.195 -1.775 3.320 -0.434 2.331 31.687 -3.668 -0.436 3.182 4.262 0.794 31.774 3 AA_A161C162:G278U279_AA A 161 ? A 279 ? A 162 ? A 278 ? 1 A C 4 1_555 A G 120 1_555 A A 5 1_555 A U 119 1_555 -0.352 -1.865 3.775 4.322 14.111 33.674 -4.976 1.176 2.738 23.033 -7.054 36.680 4 AA_C162A163:U277G278_AA A 162 ? A 278 ? A 163 ? A 277 ? 1 A A 5 1_555 A U 119 1_555 A A 8 1_555 A U 118 1_555 -0.340 -2.486 4.810 26.596 19.116 39.966 -4.619 2.821 2.743 23.750 -33.044 51.245 5 AA_A163A166:U276U277_AA A 163 ? A 277 ? A 166 ? A 276 ? 1 A A 8 1_555 A U 118 1_555 A G 9 1_555 A C 117 1_555 0.098 -1.926 3.788 -0.018 16.804 32.655 -5.434 -0.159 2.530 27.717 0.030 36.620 6 AA_A166G167:C275U276_AA A 166 ? A 276 ? A 167 ? A 275 ? 1 A G 9 1_555 A C 117 1_555 A A 12 1_555 A C 116 1_555 -3.718 -1.375 4.776 22.322 24.360 48.211 -2.953 5.245 2.140 26.533 -24.313 57.883 7 AA_G167A170:C274C275_AA A 167 ? A 275 ? A 170 ? A 274 ? 1 A A 12 1_555 A C 116 1_555 A C 13 1_555 A G 115 1_555 0.019 -1.793 3.752 1.010 9.950 40.250 -3.688 0.090 3.238 14.195 -1.441 41.424 8 AA_A170C171:G273C274_AA A 170 ? A 274 ? A 171 ? A 273 ? 1 A C 13 1_555 A G 115 1_555 A U 14 1_555 A A 114 1_555 -0.169 -1.826 3.589 0.540 10.345 31.989 -4.878 0.383 2.872 18.185 -0.950 33.582 9 AA_C171U172:A272G273_AA A 171 ? A 273 ? A 172 ? A 272 ? 1 A U 14 1_555 A A 114 1_555 A C 15 1_555 A G 113 1_555 -0.118 -1.814 3.440 -1.274 5.620 32.018 -4.228 -0.014 3.088 10.086 2.286 32.519 10 AA_U172C173:G271A272_AA A 172 ? A 272 ? A 173 ? A 271 ? 1 A C 15 1_555 A G 113 1_555 A U 17 1_555 A A 112 1_555 -1.292 -2.412 5.641 18.505 10.800 45.293 -4.113 3.677 4.203 13.189 -22.599 49.863 11 AA_C173U175:A270G271_AA A 173 ? A 271 ? A 175 ? A 270 ? 1 A U 17 1_555 A A 112 1_555 A C 18 1_555 A G 111 1_555 -0.010 -1.636 3.142 6.086 9.354 31.053 -4.304 0.941 2.511 16.805 -10.935 32.951 12 AA_U175C176:G269A270_AA A 175 ? A 270 ? A 176 ? A 269 ? 1 A C 18 1_555 A G 111 1_555 A U 19 1_555 A G 110 1_555 0.017 -1.502 3.602 1.243 11.011 37.640 -3.611 0.130 3.059 16.629 -1.877 39.180 13 AA_C176U177:G268G269_AA A 176 ? A 269 ? A 177 ? A 268 ? 1 A U 19 1_555 A G 110 1_555 A A 20 1_555 A U 109 1_555 0.037 -1.929 3.084 2.630 16.682 25.429 -6.258 0.337 1.549 33.586 -5.295 30.449 14 AA_U177A178:U267G268_AA A 177 ? A 268 ? A 178 ? A 267 ? 1 A A 20 1_555 A U 109 1_555 A U 21 1_555 A A 108 1_555 0.035 -1.672 3.456 0.515 10.405 29.720 -4.980 0.029 2.730 19.545 -0.967 31.454 15 AA_A178U179:A266U267_AA A 178 ? A 267 ? A 179 ? A 266 ? 1 A U 21 1_555 A A 108 1_555 A C 22 1_555 A G 107 1_555 0.359 -1.645 3.243 1.633 8.438 30.865 -4.399 -0.378 2.725 15.481 -2.996 32.011 16 AA_U179C180:G265A266_AA A 179 ? A 266 ? A 180 ? A 265 ? 1 A C 22 1_555 A G 107 1_555 A U 23 1_555 A A 106 1_555 0.024 -1.675 3.551 1.487 9.679 32.209 -4.499 0.205 2.937 16.963 -2.606 33.627 17 AA_C180U181:A264G265_AA A 180 ? A 265 ? A 181 ? A 264 ? 1 A U 23 1_555 A A 106 1_555 A U 24 1_555 A A 105 1_555 -0.070 -1.668 3.614 -1.723 9.145 34.218 -4.142 -0.149 3.081 15.198 2.864 35.424 18 AA_U181U182:A263A264_AA A 181 ? A 264 ? A 182 ? A 263 ? 1 A U 24 1_555 A A 105 1_555 A A 95 1_555 A U 104 1_555 0.503 -2.307 3.057 11.140 17.493 27.387 -6.052 0.503 1.464 31.802 -20.251 34.234 19 AA_U182A253:U262A263_AA A 182 ? A 263 ? A 253 ? A 262 ? 1 A A 95 1_555 A U 104 1_555 A C 96 1_555 A G 103 1_555 0.395 -1.895 3.398 -0.938 3.194 34.567 -3.669 -0.808 3.204 5.360 1.574 34.722 20 AA_A253C254:G261U262_AA A 253 ? A 262 ? A 254 ? A 261 ? 1 A C 96 1_555 A G 103 1_555 A C 97 1_555 A G 102 1_555 -0.066 -1.824 3.536 0.532 9.984 32.688 -4.691 0.196 2.870 17.243 -0.918 34.143 21 AA_C254C255:G260G261_AA A 254 ? A 261 ? A 255 ? A 260 ? 1 A C 97 1_555 A G 102 1_555 A G 98 1_555 A A 101 1_555 -2.714 -1.504 2.978 -6.412 -1.055 55.117 -1.557 2.557 3.276 -1.136 6.902 55.469 22 AA_C255G256:A259G260_AA A 255 ? A 260 ? A 256 ? A 259 ? 1 A U 47 1_555 A U 42 1_555 A C 48 1_555 A G 41 1_555 1.581 -1.872 3.875 -1.133 14.169 43.026 -3.822 -2.167 3.101 18.719 1.496 45.207 23 AA_U205C206:G199U200_AA A 205 ? A 200 ? A 206 ? A 199 ? 1 A C 48 1_555 A G 41 1_555 A C 49 1_555 A G 40 1_555 -0.063 -1.867 3.588 -0.272 11.743 31.725 -5.116 0.064 2.744 20.617 0.478 33.777 24 AA_C206C207:G198G199_AA A 206 ? A 199 ? A 207 ? A 198 ? 1 A C 49 1_555 A G 40 1_555 A G 50 1_555 A C 39 1_555 -0.249 -1.718 3.527 -3.108 14.096 31.172 -5.078 -0.054 2.549 24.643 5.434 34.276 25 AA_C207G208:C197G198_AA A 207 ? A 198 ? A 208 ? A 197 ? 1 A G 50 1_555 A C 39 1_555 A U 51 1_555 A A 38 1_555 -0.051 -1.666 3.265 -1.541 5.247 30.464 -4.094 -0.190 2.942 9.886 2.904 30.939 26 AA_G208U209:A196C197_AA A 208 ? A 197 ? A 209 ? A 196 ? 1 A U 51 1_555 A A 38 1_555 A U 53 1_555 A U 37 1_555 -0.680 -2.899 5.366 14.888 20.058 38.972 -6.170 2.697 3.153 26.968 -20.018 46.027 27 AA_U209U211:U195A196_AA A 209 ? A 196 ? A 211 ? A 195 ? 1 A U 53 1_555 A U 37 1_555 A U 54 1_555 A U 36 1_555 -1.025 -1.568 3.570 3.813 15.042 35.146 -4.246 2.033 2.589 23.544 -5.969 38.321 28 AA_U211U212:U194U195_AA A 211 ? A 195 ? A 212 ? A 194 ? 1 A U 54 1_555 A U 36 1_555 A G 55 1_555 A C 35 1_555 0.239 -1.965 3.531 -7.121 14.677 34.478 -4.809 -1.237 2.433 23.221 11.267 38.037 29 AA_U212G213:C193U194_AA A 212 ? A 194 ? A 213 ? A 193 ? 1 A G 55 1_555 A C 35 1_555 A C 56 1_555 A G 34 1_555 -0.114 -1.863 3.442 -0.099 7.680 30.984 -4.766 0.190 2.909 14.106 0.182 31.899 30 AA_G213C214:G192C193_AA A 213 ? A 193 ? A 214 ? A 192 ? 1 A C 56 1_555 A G 34 1_555 A A 57 1_555 A U 33 1_555 -0.167 -1.857 3.623 0.352 13.056 29.896 -5.577 0.358 2.604 23.922 -0.645 32.565 31 AA_C214A215:U191G192_AA A 214 ? A 192 ? A 215 ? A 191 ? 1 A A 57 1_555 A U 33 1_555 A G 58 1_555 A C 32 1_555 0.087 -1.807 3.429 -0.495 10.030 29.498 -5.209 -0.253 2.684 19.017 0.938 31.125 32 AA_A215G216:C190U191_AA A 215 ? A 191 ? A 216 ? A 190 ? 1 A G 58 1_555 A C 32 1_555 A C 59 1_555 A G 31 1_555 -0.019 -1.643 3.342 0.168 4.421 32.909 -3.609 0.060 3.101 7.759 -0.295 33.197 33 AA_G216C217:G189C190_AA A 216 ? A 190 ? A 217 ? A 189 ? 1 A C 59 1_555 A G 31 1_555 A C 60 1_555 A G 30 1_555 -0.278 -1.780 3.563 -0.271 9.941 33.041 -4.569 0.427 2.923 17.005 0.464 34.465 34 AA_C217C218:G188G189_AA A 217 ? A 189 ? A 218 ? A 188 ? 1 A C 60 1_555 A G 30 1_555 A G 61 1_555 A A 29 1_555 -0.910 -1.510 3.141 7.462 16.832 32.157 -4.266 2.270 1.898 27.733 -12.294 36.934 35 AA_C218G219:A187G188_AA A 218 ? A 188 ? A 219 ? A 187 ? 1 A G 61 1_555 A A 29 1_555 A U 66 1_555 A C 28 1_555 -3.170 -3.133 3.858 -14.647 -0.247 63.149 -2.916 2.169 4.432 -0.233 13.791 64.655 36 AA_G219U224:C186A187_AA A 219 ? A 187 ? A 224 ? A 186 ? 1 A U 66 1_555 A C 28 1_555 A C 67 1_555 A G 27 1_555 -0.226 -1.610 3.006 4.311 1.281 29.696 -3.346 1.237 2.874 2.481 -8.351 30.028 37 AA_U224C225:G185C186_AA A 224 ? A 186 ? A 225 ? A 185 ? 1 A C 67 1_555 A G 27 1_555 A A 68 1_555 A U 26 1_555 -0.360 -1.665 3.362 1.148 8.216 28.400 -4.929 0.938 2.766 16.310 -2.278 29.562 38 AA_C225A226:U184G185_AA A 225 ? A 185 ? A 226 ? A 184 ? 1 A A 68 1_555 A U 26 1_555 A G 69 1_555 A C 25 1_555 0.337 -1.709 3.238 -2.039 8.675 29.291 -4.809 -1.008 2.608 16.675 3.919 30.588 39 AA_A226G227:C183U184_AA A 226 ? A 184 ? A 227 ? A 183 ? 1 A G 69 1_555 A C 25 1_555 A C 70 1_555 A G 94 1_555 1.159 -1.420 3.344 1.497 6.881 43.900 -2.511 -1.395 3.134 9.134 -1.987 44.433 40 AA_G227C228:G252C183_AA A 227 ? A 183 ? A 228 ? A 252 ? 1 A C 70 1_555 A G 94 1_555 A A 71 1_555 A U 93 1_555 -0.272 -1.747 3.412 -0.049 11.708 30.860 -4.973 0.472 2.596 21.074 0.088 32.955 41 AA_C228A229:U251G252_AA A 228 ? A 252 ? A 229 ? A 251 ? 1 A A 71 1_555 A U 93 1_555 A C 72 1_555 A G 92 1_555 0.007 -1.689 3.360 -0.679 6.674 31.003 -4.288 -0.134 2.941 12.305 1.252 31.703 42 AA_A229C230:G250U251_AA A 229 ? A 251 ? A 230 ? A 250 ? 1 A C 72 1_555 A G 92 1_555 A A 73 1_555 A U 91 1_555 -0.102 -1.711 3.386 1.453 14.338 31.711 -4.899 0.378 2.405 24.707 -2.504 34.755 43 AA_C230A231:U249G250_AA A 230 ? A 250 ? A 231 ? A 249 ? 1 A A 73 1_555 A U 91 1_555 A U 74 1_555 A G 90 1_555 0.388 -1.559 3.320 0.052 5.643 36.924 -3.165 -0.600 3.057 8.846 -0.081 37.338 44 AA_A231U232:G248U249_AA A 231 ? A 249 ? A 232 ? A 248 ? 1 A U 74 1_555 A G 90 1_555 A C 75 1_555 A G 89 1_555 0.355 -2.095 3.328 5.835 10.339 25.173 -6.621 0.536 2.326 22.214 -12.536 27.791 45 AA_U232C233:G247G248_AA A 232 ? A 248 ? A 233 ? A 247 ? 1 A C 75 1_555 A G 89 1_555 A U 76 1_555 A G 88 1_555 -0.202 -1.395 3.657 2.670 15.203 39.169 -3.597 0.572 2.923 21.682 -3.808 41.990 46 AA_C233U234:G246G247_AA A 233 ? A 247 ? A 234 ? A 246 ? 1 A U 76 1_555 A G 88 1_555 A G 78 1_555 A C 87 1_555 -2.441 -1.286 3.227 3.631 10.069 36.663 -3.118 4.149 2.554 15.603 -5.626 38.142 47 AA_U234G236:C245G246_AA A 234 ? A 246 ? A 236 ? A 245 ? 1 A G 78 1_555 A C 87 1_555 A G 79 1_555 A C 86 1_555 -0.670 -2.382 4.647 3.055 12.756 35.556 -5.798 1.543 3.548 20.065 -4.806 37.825 48 AA_G236G237:C244C245_AA A 236 ? A 245 ? A 237 ? A 244 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R35GM122579 1 'Howard Hughes Medical Institute (HHMI)' 'United States' ? 2 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' U24GM129541 3 'National Science Foundation (NSF, United States)' 'United States' GRFPDGE1656518 4 'Ministry of Science and Technology (MoST, China)' China 2022YFC2303700 5 'Ministry of Science and Technology (MoST, China)' China 2022YFA1302700 6 'Other private' 'United States' 'BioX Bowes fellowship' 7 'Other private' 'United States' 'BioX Interdisciplinary Initiative Program' 8 'Other private' 'United States' 'ChEM-H COVID-19 Drug and Vaccine Prototyping seed grant' 9 'Department of Energy (DOE, United States)' 'United States' 'Coronavirus CARES Act' 10 'National Institutes of Health/National Institute Of Allergy and Infectious Diseases (NIH/NIAID)' 'United States' '#U19AI171421' 11 # _atom_sites.entry_id 8UYS _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_