data_8VCI # _entry.id 8VCI # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.393 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8VCI pdb_00008vci 10.2210/pdb8vci/pdb WWPDB D_1000279924 ? ? EMDB EMD-43137 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2024-01-17 2 'Structure model' 1 1 2024-05-22 3 'Structure model' 1 2 2024-05-29 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author 3 3 'Structure model' citation # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_ASTM' 4 2 'Structure model' '_citation.journal_id_CSD' 5 2 'Structure model' '_citation.journal_id_ISSN' 6 2 'Structure model' '_citation.pdbx_database_id_DOI' 7 2 'Structure model' '_citation.pdbx_database_id_PubMed' 8 2 'Structure model' '_citation.title' 9 2 'Structure model' '_citation.year' 10 2 'Structure model' '_citation_author.identifier_ORCID' 11 3 'Structure model' '_citation.journal_volume' 12 3 'Structure model' '_citation.page_first' 13 3 'Structure model' '_citation.page_last' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8VCI _pdbx_database_status.recvd_initial_deposition_date 2023-12-14 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name EMDB _pdbx_database_related.details 'SARS-CoV-2 Frameshift Stimulatory Element with Upstream Multibranch Loop' _pdbx_database_related.db_id EMD-43137 _pdbx_database_related.content_type 'associated EM volume' # _pdbx_contact_author.id 2 _pdbx_contact_author.email wmoss@iastate.edu _pdbx_contact_author.name_first Walter _pdbx_contact_author.name_last Moss _pdbx_contact_author.name_mi N _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0001-6419-5570 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Peterson, J.M.' 1 0000-0002-5069-5889 'Becker, S.T.' 2 ? ;O'Leary, C.A. ; 3 0000-0002-4246-6277 'Juneja, P.' 4 ? 'Yang, Y.' 5 0000-0001-9061-3828 'Moss, W.N.' 6 0000-0001-6419-5570 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Biochemistry _citation.journal_id_ASTM BICHAW _citation.journal_id_CSD 0033 _citation.journal_id_ISSN 0006-2960 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 63 _citation.language ? _citation.page_first 1287 _citation.page_last 1296 _citation.title 'Structure of the SARS-CoV-2 Frameshift Stimulatory Element with an Upstream Multibranch Loop.' _citation.year 2024 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1021/acs.biochem.3c00716 _citation.pdbx_database_id_PubMed 38727003 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Peterson, J.M.' 1 ? primary 'Becker, S.T.' 2 ? primary ;O'Leary, C.A. ; 3 ? primary 'Juneja, P.' 4 ? primary 'Yang, Y.' 5 ? primary 'Moss, W.N.' 6 0000-0001-6419-5570 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'Frameshift Stimulatory Element with Upstream Multi-branch Loop' _entity.formula_weight 37901.410 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation 'C2G, G51C' _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGGAACCCAUGCUUCAGUCAGCUGAUGCACAAUCGUUUUUAAACGGGUUUCCGGUGUAAGUGCAGCCCGUCUUACACCGU GCGGCACAGGCACUAGUACUGAUGUCGUAUACAGGGCU ; _entity_poly.pdbx_seq_one_letter_code_can ;GGGAACCCAUGCUUCAGUCAGCUGAUGCACAAUCGUUUUUAAACGGGUUUCCGGUGUAAGUGCAGCCCGUCUUACACCGU GCGGCACAGGCACUAGUACUGAUGUCGUAUACAGGGCU ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 A n 1 5 A n 1 6 C n 1 7 C n 1 8 C n 1 9 A n 1 10 U n 1 11 G n 1 12 C n 1 13 U n 1 14 U n 1 15 C n 1 16 A n 1 17 G n 1 18 U n 1 19 C n 1 20 A n 1 21 G n 1 22 C n 1 23 U n 1 24 G n 1 25 A n 1 26 U n 1 27 G n 1 28 C n 1 29 A n 1 30 C n 1 31 A n 1 32 A n 1 33 U n 1 34 C n 1 35 G n 1 36 U n 1 37 U n 1 38 U n 1 39 U n 1 40 U n 1 41 A n 1 42 A n 1 43 A n 1 44 C n 1 45 G n 1 46 G n 1 47 G n 1 48 U n 1 49 U n 1 50 U n 1 51 C n 1 52 C n 1 53 G n 1 54 G n 1 55 U n 1 56 G n 1 57 U n 1 58 A n 1 59 A n 1 60 G n 1 61 U n 1 62 G n 1 63 C n 1 64 A n 1 65 G n 1 66 C n 1 67 C n 1 68 C n 1 69 G n 1 70 U n 1 71 C n 1 72 U n 1 73 U n 1 74 A n 1 75 C n 1 76 A n 1 77 C n 1 78 C n 1 79 G n 1 80 U n 1 81 G n 1 82 C n 1 83 G n 1 84 G n 1 85 C n 1 86 A n 1 87 C n 1 88 A n 1 89 G n 1 90 G n 1 91 C n 1 92 A n 1 93 C n 1 94 U n 1 95 A n 1 96 G n 1 97 U n 1 98 A n 1 99 C n 1 100 U n 1 101 G n 1 102 A n 1 103 U n 1 104 G n 1 105 U n 1 106 C n 1 107 G n 1 108 U n 1 109 A n 1 110 U n 1 111 A n 1 112 C n 1 113 A n 1 114 G n 1 115 G n 1 116 G n 1 117 C n 1 118 U n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 118 _pdbx_entity_src_syn.organism_scientific 'Severe acute respiratory syndrome coronavirus 2' _pdbx_entity_src_syn.organism_common_name '2019-nCoV, SARS-CoV-2' _pdbx_entity_src_syn.ncbi_taxonomy_id 2697049 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 A 4 4 4 A A A . n A 1 5 A 5 5 5 A A A . n A 1 6 C 6 6 6 C C A . n A 1 7 C 7 7 7 C C A . n A 1 8 C 8 8 8 C C A . n A 1 9 A 9 9 9 A A A . n A 1 10 U 10 10 10 U U A . n A 1 11 G 11 11 11 G G A . n A 1 12 C 12 12 12 C C A . n A 1 13 U 13 13 13 U U A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 A 16 16 16 A A A . n A 1 17 G 17 17 17 G G A . n A 1 18 U 18 18 18 U U A . n A 1 19 C 19 19 19 C C A . n A 1 20 A 20 20 20 A A A . n A 1 21 G 21 21 21 G G A . n A 1 22 C 22 22 22 C C A . n A 1 23 U 23 23 23 U U A . n A 1 24 G 24 24 24 G G A . n A 1 25 A 25 25 25 A A A . n A 1 26 U 26 26 26 U U A . n A 1 27 G 27 27 27 G G A . n A 1 28 C 28 28 28 C C A . n A 1 29 A 29 29 29 A A A . n A 1 30 C 30 30 30 C C A . n A 1 31 A 31 31 31 A A A . n A 1 32 A 32 32 32 A A A . n A 1 33 U 33 33 33 U U A . n A 1 34 C 34 34 34 C C A . n A 1 35 G 35 35 35 G G A . n A 1 36 U 36 36 36 U U A . n A 1 37 U 37 37 37 U U A . n A 1 38 U 38 38 38 U U A . n A 1 39 U 39 39 39 U U A . n A 1 40 U 40 40 40 U U A . n A 1 41 A 41 41 41 A A A . n A 1 42 A 42 42 42 A A A . n A 1 43 A 43 43 43 A A A . n A 1 44 C 44 44 44 C C A . n A 1 45 G 45 45 45 G G A . n A 1 46 G 46 46 46 G G A . n A 1 47 G 47 47 47 G G A . n A 1 48 U 48 48 48 U U A . n A 1 49 U 49 49 49 U U A . n A 1 50 U 50 50 50 U U A . n A 1 51 C 51 51 51 C C A . n A 1 52 C 52 52 52 C C A . n A 1 53 G 53 53 53 G G A . n A 1 54 G 54 54 54 G G A . n A 1 55 U 55 55 55 U U A . n A 1 56 G 56 56 56 G G A . n A 1 57 U 57 57 57 U U A . n A 1 58 A 58 58 58 A A A . n A 1 59 A 59 59 59 A A A . n A 1 60 G 60 60 60 G G A . n A 1 61 U 61 61 61 U U A . n A 1 62 G 62 62 62 G G A . n A 1 63 C 63 63 63 C C A . n A 1 64 A 64 64 64 A A A . n A 1 65 G 65 65 65 G G A . n A 1 66 C 66 66 66 C C A . n A 1 67 C 67 67 67 C C A . n A 1 68 C 68 68 68 C C A . n A 1 69 G 69 69 69 G G A . n A 1 70 U 70 70 70 U U A . n A 1 71 C 71 71 71 C C A . n A 1 72 U 72 72 72 U U A . n A 1 73 U 73 73 73 U U A . n A 1 74 A 74 74 74 A A A . n A 1 75 C 75 75 75 C C A . n A 1 76 A 76 76 76 A A A . n A 1 77 C 77 77 77 C C A . n A 1 78 C 78 78 78 C C A . n A 1 79 G 79 79 79 G G A . n A 1 80 U 80 80 80 U U A . n A 1 81 G 81 81 81 G G A . n A 1 82 C 82 82 82 C C A . n A 1 83 G 83 83 83 G G A . n A 1 84 G 84 84 84 G G A . n A 1 85 C 85 85 85 C C A . n A 1 86 A 86 86 86 A A A . n A 1 87 C 87 87 87 C C A . n A 1 88 A 88 88 88 A A A . n A 1 89 G 89 89 89 G G A . n A 1 90 G 90 90 90 G G A . n A 1 91 C 91 91 91 C C A . n A 1 92 A 92 92 92 A A A . n A 1 93 C 93 93 93 C C A . n A 1 94 U 94 94 94 U U A . n A 1 95 A 95 95 95 A A A . n A 1 96 G 96 96 96 G G A . n A 1 97 U 97 97 97 U U A . n A 1 98 A 98 98 98 A A A . n A 1 99 C 99 99 99 C C A . n A 1 100 U 100 100 100 U U A . n A 1 101 G 101 101 101 G G A . n A 1 102 A 102 102 102 A A A . n A 1 103 U 103 103 103 U U A . n A 1 104 G 104 104 104 G G A . n A 1 105 U 105 105 105 U U A . n A 1 106 C 106 106 106 C C A . n A 1 107 G 107 107 107 G G A . n A 1 108 U 108 108 108 U U A . n A 1 109 A 109 109 109 A A A . n A 1 110 U 110 110 110 U U A . n A 1 111 A 111 111 111 A A A . n A 1 112 C 112 112 112 C C A . n A 1 113 A 113 113 113 A A A . n A 1 114 G 114 114 114 G G A . n A 1 115 G 115 115 115 G G A . n A 1 116 G 116 116 116 G G A . n A 1 117 C 117 117 117 C C A . n A 1 118 U 118 118 118 U U A . n # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 2 2 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 3 3 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 4 4 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 5 5 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 6 6 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 7 7 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 8 8 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" 9 9 Y 1 A G 1 ? "O5'" ? A G 1 "O5'" # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8VCI _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _struct.entry_id 8VCI _struct.title 'SARS-CoV-2 Frameshift Stimulatory Element with Upstream Multibranch Loop' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8VCI _struct_keywords.text ;RNA, Coronavirus, SARS-CoV-2, Programmed -1 Ribosomal Frameshifting, -1 PRF, Frameshift Stimulatory Element, FSE, Attenuator Hairpin ; _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name GB _struct_ref.db_code NC_045512.2 _struct_ref.pdbx_db_accession NC_045512.2 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ;GCGAACCCAUGCUUCAGUCAGCUGAUGCACAAUCGUUUUUAAACGGGUUUGCGGUGUAAGUGCAGCCCGUCUUACACCGU GCGGCACAGGCACUAGUACUGAUGUCGUAUACAGGGCU ; _struct_ref.pdbx_align_begin 13425 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8VCI _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 118 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession NC_045512.2 _struct_ref_seq.db_align_beg 13425 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 13542 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 118 # loop_ _struct_ref_seq_dif.align_id _struct_ref_seq_dif.pdbx_pdb_id_code _struct_ref_seq_dif.mon_id _struct_ref_seq_dif.pdbx_pdb_strand_id _struct_ref_seq_dif.seq_num _struct_ref_seq_dif.pdbx_pdb_ins_code _struct_ref_seq_dif.pdbx_seq_db_name _struct_ref_seq_dif.pdbx_seq_db_accession_code _struct_ref_seq_dif.db_mon_id _struct_ref_seq_dif.pdbx_seq_db_seq_num _struct_ref_seq_dif.details _struct_ref_seq_dif.pdbx_auth_seq_num _struct_ref_seq_dif.pdbx_ordinal 1 8VCI G A 2 ? GB NC_045512.2 C 13426 'engineered mutation' 2 1 1 8VCI C A 51 ? GB NC_045512.2 G 13475 'engineered mutation' 51 2 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'electron microscopy' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 52 N3 ? ? A G 1 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 52 O2 ? ? A G 1 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 52 N4 ? ? A G 1 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 51 N3 ? ? A G 2 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 51 O2 ? ? A G 2 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 51 N4 ? ? A G 2 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A U 50 O2 ? ? A G 3 A U 50 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog8 hydrog ? ? A G 3 O6 ? ? ? 1_555 A U 50 N3 ? ? A G 3 A U 50 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog9 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 49 N3 ? ? A A 4 A U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 49 O4 ? ? A A 4 A U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 48 N3 ? ? A A 5 A U 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 48 O4 ? ? A A 5 A U 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 47 N1 ? ? A C 6 A G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 47 O6 ? ? A C 6 A G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 47 N2 ? ? A C 6 A G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 46 N1 ? ? A C 7 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 46 O6 ? ? A C 7 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 46 N2 ? ? A C 7 A G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 45 N1 ? ? A C 8 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 45 O6 ? ? A C 8 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 45 N2 ? ? A C 8 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A U 10 N3 ? ? ? 1_555 A A 29 N1 ? ? A U 10 A A 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A U 10 O4 ? ? ? 1_555 A A 29 N6 ? ? A U 10 A A 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 28 N3 ? ? A G 11 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 28 O2 ? ? A G 11 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 28 N4 ? ? A G 11 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 12 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 12 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 12 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 13 N3 ? ? ? 1_555 A U 26 O4 ? ? A U 13 A U 26 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog31 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 25 N1 ? ? A U 14 A A 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 25 N6 ? ? A U 14 A A 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 24 N1 ? ? A C 15 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 24 O6 ? ? A C 15 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 24 N2 ? ? A C 15 A G 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A A 16 N1 ? ? ? 1_555 A U 23 N3 ? ? A A 16 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A A 16 N6 ? ? ? 1_555 A U 23 O4 ? ? A A 16 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 17 N1 ? ? ? 1_555 A C 22 N3 ? ? A G 17 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 17 N2 ? ? ? 1_555 A C 22 O2 ? ? A G 17 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 17 O6 ? ? ? 1_555 A C 22 N4 ? ? A G 17 A C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 35 N1 ? ? ? 1_555 A C 44 N3 ? ? A G 35 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 35 N2 ? ? ? 1_555 A C 44 O2 ? ? A G 35 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 35 O6 ? ? ? 1_555 A C 44 N4 ? ? A G 35 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A U 36 N3 ? ? ? 1_555 A A 43 N1 ? ? A U 36 A A 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A U 36 O4 ? ? ? 1_555 A A 43 N6 ? ? A U 36 A A 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A U 37 N3 ? ? ? 1_555 A A 42 N1 ? ? A U 37 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A U 37 O4 ? ? ? 1_555 A A 42 N6 ? ? A U 37 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A U 38 O2 ? ? ? 1_555 A A 42 N6 ? ? A U 38 A A 42 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog49 hydrog ? ? A G 53 N1 ? ? ? 1_555 A C 78 N3 ? ? A G 53 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 53 N2 ? ? ? 1_555 A C 78 O2 ? ? A G 53 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 53 O6 ? ? ? 1_555 A C 78 N4 ? ? A G 53 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 54 N1 ? ? ? 1_555 A C 77 N3 ? ? A G 54 A C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 54 N2 ? ? ? 1_555 A C 77 O2 ? ? A G 54 A C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 54 O6 ? ? ? 1_555 A C 77 N4 ? ? A G 54 A C 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A U 55 N3 ? ? ? 1_555 A A 76 N1 ? ? A U 55 A A 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A U 55 O4 ? ? ? 1_555 A A 76 N6 ? ? A U 55 A A 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A G 56 N1 ? ? ? 1_555 A C 75 N3 ? ? A G 56 A C 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A G 56 N2 ? ? ? 1_555 A C 75 O2 ? ? A G 56 A C 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 56 O6 ? ? ? 1_555 A C 75 N4 ? ? A G 56 A C 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A U 57 N3 ? ? ? 1_555 A A 74 N1 ? ? A U 57 A A 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A U 57 O4 ? ? ? 1_555 A A 74 N6 ? ? A U 57 A A 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A A 58 N1 ? ? ? 1_555 A U 73 N3 ? ? A A 58 A U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A A 58 N6 ? ? ? 1_555 A U 73 O4 ? ? A A 58 A U 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A A 59 N1 ? ? ? 1_555 A U 72 N3 ? ? A A 59 A U 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A A 59 N6 ? ? ? 1_555 A U 72 O4 ? ? A A 59 A U 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 60 N1 ? ? ? 1_555 A C 71 N3 ? ? A G 60 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A G 60 N2 ? ? ? 1_555 A C 71 O2 ? ? A G 60 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A G 60 O6 ? ? ? 1_555 A C 71 N4 ? ? A G 60 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A G 62 N1 ? ? ? 1_555 A U 70 O2 ? ? A G 62 A U 70 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog70 hydrog ? ? A G 62 O6 ? ? ? 1_555 A U 70 N3 ? ? A G 62 A U 70 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog71 hydrog ? ? A C 63 N3 ? ? ? 1_555 A G 69 N1 ? ? A C 63 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A C 63 N4 ? ? ? 1_555 A G 69 O6 ? ? A C 63 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A C 63 O2 ? ? ? 1_555 A G 69 N2 ? ? A C 63 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A A 64 N1 ? ? ? 1_555 A U 118 N3 ? ? A A 64 A U 118 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A A 64 N6 ? ? ? 1_555 A U 118 O4 ? ? A A 64 A U 118 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A G 65 N1 ? ? ? 1_555 A C 117 N3 ? ? A G 65 A C 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A G 65 N2 ? ? ? 1_555 A C 117 O2 ? ? A G 65 A C 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A G 65 O6 ? ? ? 1_555 A C 117 N4 ? ? A G 65 A C 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A C 66 N3 ? ? ? 1_555 A G 116 N1 ? ? A C 66 A G 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A C 66 N4 ? ? ? 1_555 A G 116 O6 ? ? A C 66 A G 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A C 66 O2 ? ? ? 1_555 A G 116 N2 ? ? A C 66 A G 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A C 67 N3 ? ? ? 1_555 A G 115 N1 ? ? A C 67 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A C 67 N4 ? ? ? 1_555 A G 115 O6 ? ? A C 67 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A C 67 O2 ? ? ? 1_555 A G 115 N2 ? ? A C 67 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A C 68 N3 ? ? ? 1_555 A G 114 N1 ? ? A C 68 A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A C 68 N4 ? ? ? 1_555 A G 114 O6 ? ? A C 68 A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A C 68 O2 ? ? ? 1_555 A G 114 N2 ? ? A C 68 A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A G 79 N1 ? ? ? 1_555 A U 110 O2 ? ? A G 79 A U 110 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog89 hydrog ? ? A G 79 O6 ? ? ? 1_555 A U 110 N3 ? ? A G 79 A U 110 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog90 hydrog ? ? A U 80 N3 ? ? ? 1_555 A A 109 N1 ? ? A U 80 A A 109 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A U 80 O4 ? ? ? 1_555 A A 109 N6 ? ? A U 80 A A 109 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A G 81 N1 ? ? ? 1_555 A U 108 O2 ? ? A G 81 A U 108 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog93 hydrog ? ? A G 81 O6 ? ? ? 1_555 A U 108 N3 ? ? A G 81 A U 108 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog94 hydrog ? ? A C 82 N3 ? ? ? 1_555 A G 107 N1 ? ? A C 82 A G 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A C 82 N4 ? ? ? 1_555 A G 107 O6 ? ? A C 82 A G 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A C 82 O2 ? ? ? 1_555 A G 107 N2 ? ? A C 82 A G 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? A G 83 N1 ? ? ? 1_555 A C 106 N3 ? ? A G 83 A C 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? A G 83 N2 ? ? ? 1_555 A C 106 O2 ? ? A G 83 A C 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? A G 83 O6 ? ? ? 1_555 A C 106 N4 ? ? A G 83 A C 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? A G 84 N1 ? ? ? 1_555 A U 105 O2 ? ? A G 84 A U 105 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog101 hydrog ? ? A G 84 O6 ? ? ? 1_555 A U 105 N3 ? ? A G 84 A U 105 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog102 hydrog ? ? A C 85 N3 ? ? ? 1_555 A G 104 N1 ? ? A C 85 A G 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog103 hydrog ? ? A C 85 N4 ? ? ? 1_555 A G 104 O6 ? ? A C 85 A G 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog104 hydrog ? ? A C 85 O2 ? ? ? 1_555 A G 104 N2 ? ? A C 85 A G 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog105 hydrog ? ? A A 86 N1 ? ? ? 1_555 A U 103 N3 ? ? A A 86 A U 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog106 hydrog ? ? A A 86 N6 ? ? ? 1_555 A U 103 O4 ? ? A A 86 A U 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog107 hydrog ? ? A C 87 N3 ? ? ? 1_555 A G 101 N1 ? ? A C 87 A G 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog108 hydrog ? ? A C 87 N4 ? ? ? 1_555 A G 101 O6 ? ? A C 87 A G 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog109 hydrog ? ? A C 87 O2 ? ? ? 1_555 A G 101 N2 ? ? A C 87 A G 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog110 hydrog ? ? A A 88 N1 ? ? ? 1_555 A U 100 N3 ? ? A A 88 A U 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog111 hydrog ? ? A A 88 N6 ? ? ? 1_555 A U 100 O4 ? ? A A 88 A U 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog112 hydrog ? ? A G 89 N1 ? ? ? 1_555 A C 99 N3 ? ? A G 89 A C 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog113 hydrog ? ? A G 89 N2 ? ? ? 1_555 A C 99 O2 ? ? A G 89 A C 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog114 hydrog ? ? A G 89 O6 ? ? ? 1_555 A C 99 N4 ? ? A G 89 A C 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog115 hydrog ? ? A G 90 N1 ? ? ? 1_555 A A 98 N1 ? ? A G 90 A A 98 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog116 hydrog ? ? A G 90 O6 ? ? ? 1_555 A A 98 N6 ? ? A G 90 A A 98 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog117 hydrog ? ? A C 91 N4 ? ? ? 1_555 A A 98 N1 ? ? A C 91 A A 98 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog118 hydrog ? ? A A 92 N1 ? ? ? 1_555 A G 96 N1 ? ? A A 92 A G 96 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog119 hydrog ? ? A A 92 N6 ? ? ? 1_555 A G 96 O6 ? ? A A 92 A G 96 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog120 hydrog ? ? A A 92 N1 ? ? ? 1_555 A U 97 N3 ? ? A A 92 A U 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog121 hydrog ? ? A A 92 N6 ? ? ? 1_555 A U 97 O4 ? ? A A 92 A U 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog122 hydrog ? ? A C 93 N3 ? ? ? 1_555 A G 96 N1 ? ? A C 93 A G 96 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog123 hydrog ? ? A C 93 N4 ? ? ? 1_555 A G 96 O6 ? ? A C 93 A G 96 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog124 hydrog ? ? A C 93 O2 ? ? ? 1_555 A G 96 N2 ? ? A C 93 A G 96 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 2 OP2 A A 64 ? ? OP2 A G 65 ? ? 1.64 2 2 OP2 A G 54 ? ? "O2'" A A 111 ? ? 2.08 3 4 OP2 A A 64 ? ? OP2 A G 65 ? ? 1.67 4 4 OP2 A A 64 ? ? P A G 65 ? ? 1.67 5 4 "O2'" A A 29 ? ? "O2'" A G 35 ? ? 2.12 6 6 H41 A C 68 ? ? "O2'" A G 69 ? ? 1.50 7 6 "O2'" A G 69 ? ? O6 A G 114 ? ? 2.02 8 8 "HO2'" A A 102 ? ? OP2 A G 104 ? ? 1.59 9 8 "O2'" A A 102 ? ? OP2 A G 104 ? ? 2.09 10 9 "HO2'" A U 39 ? ? "O4'" A U 40 ? ? 1.55 11 9 OP2 A A 64 ? ? OP2 A G 65 ? ? 1.57 12 9 "HO2'" A A 5 ? ? "O2'" A G 116 ? ? 1.60 13 9 OP2 A A 64 ? ? P A G 65 ? ? 1.73 14 9 "O2'" A A 5 ? ? "O2'" A G 116 ? ? 2.18 # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 "C2'" A G 35 ? ? "C1'" A G 35 ? ? 1.468 1.526 -0.058 0.008 N 2 8 "O4'" A U 37 ? ? "C1'" A U 37 ? ? 1.488 1.415 0.073 0.012 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 5 "C3'" A A 113 ? ? "O3'" A A 113 ? ? P A G 114 ? ? 135.43 119.70 15.73 1.20 Y 2 6 "O4'" A A 102 ? ? "C1'" A A 102 ? ? N9 A A 102 ? ? 115.74 108.50 7.24 0.70 N # loop_ _pdbx_validate_polymer_linkage.id _pdbx_validate_polymer_linkage.PDB_model_num _pdbx_validate_polymer_linkage.auth_atom_id_1 _pdbx_validate_polymer_linkage.auth_asym_id_1 _pdbx_validate_polymer_linkage.auth_comp_id_1 _pdbx_validate_polymer_linkage.auth_seq_id_1 _pdbx_validate_polymer_linkage.PDB_ins_code_1 _pdbx_validate_polymer_linkage.label_alt_id_1 _pdbx_validate_polymer_linkage.auth_atom_id_2 _pdbx_validate_polymer_linkage.auth_asym_id_2 _pdbx_validate_polymer_linkage.auth_comp_id_2 _pdbx_validate_polymer_linkage.auth_seq_id_2 _pdbx_validate_polymer_linkage.PDB_ins_code_2 _pdbx_validate_polymer_linkage.label_alt_id_2 _pdbx_validate_polymer_linkage.dist 1 1 "O3'" A C 63 ? ? P A A 64 ? ? 3.41 2 2 "O3'" A C 63 ? ? P A A 64 ? ? 3.62 3 3 "O3'" A C 63 ? ? P A A 64 ? ? 3.43 4 4 "O3'" A C 63 ? ? P A A 64 ? ? 3.95 5 5 "O3'" A C 63 ? ? P A A 64 ? ? 3.84 6 6 "O3'" A C 68 ? ? P A G 69 ? ? 4.79 7 7 "O3'" A C 68 ? ? P A G 69 ? ? 3.00 8 8 "O3'" A C 63 ? ? P A A 64 ? ? 3.42 9 9 "O3'" A C 63 ? ? P A A 64 ? ? 3.98 # _em_3d_fitting.id 1 _em_3d_fitting.entry_id 8VCI _em_3d_fitting.method ? _em_3d_fitting.target_criteria ? _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_space ? _em_3d_fitting.ref_protocol 'AB INITIO MODEL' # _em_3d_reconstruction.entry_id 8VCI _em_3d_reconstruction.id 1 _em_3d_reconstruction.method ? _em_3d_reconstruction.algorithm ? _em_3d_reconstruction.citation_id ? _em_3d_reconstruction.details ? _em_3d_reconstruction.resolution 6.1 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.magnification_calibration ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.num_particles 627438 _em_3d_reconstruction.euler_angles_details ? _em_3d_reconstruction.num_class_averages 1 _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.symmetry_type POINT # _em_buffer.id 1 _em_buffer.specimen_id 1 _em_buffer.name ? _em_buffer.details ? _em_buffer.pH 8.0 # _em_entity_assembly.id 1 _em_entity_assembly.parent_id 0 _em_entity_assembly.source RECOMBINANT _em_entity_assembly.type VIRUS _em_entity_assembly.name 'Severe acute respiratory syndrome coronavirus' _em_entity_assembly.details 'PCR amplified and transcribed using T7 polymerase.' _em_entity_assembly.synonym ? _em_entity_assembly.oligomeric_details ? _em_entity_assembly.entity_id_list 1 # _em_imaging.entry_id 8VCI _em_imaging.id 1 _em_imaging.astigmatism ? _em_imaging.electron_beam_tilt_params ? _em_imaging.residual_tilt ? _em_imaging.microscope_model 'TFS GLACIOS' _em_imaging.specimen_holder_type ? _em_imaging.specimen_holder_model ? _em_imaging.details ? _em_imaging.date ? _em_imaging.accelerating_voltage 200 _em_imaging.illumination_mode 'FLOOD BEAM' _em_imaging.mode 'BRIGHT FIELD' _em_imaging.nominal_cs 2.7 _em_imaging.nominal_defocus_min 1500 _em_imaging.nominal_defocus_max 3500 _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_defocus_max ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.nominal_magnification 36000 _em_imaging.calibrated_magnification ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.citation_id ? _em_imaging.temperature ? _em_imaging.detector_distance ? _em_imaging.recording_temperature_minimum ? _em_imaging.recording_temperature_maximum ? _em_imaging.alignment_procedure ? _em_imaging.c2_aperture_diameter ? _em_imaging.specimen_id 1 _em_imaging.cryogen ? # _em_sample_support.id 1 _em_sample_support.film_material ? _em_sample_support.method ? _em_sample_support.grid_material COPPER _em_sample_support.grid_mesh_size 300 _em_sample_support.grid_type 'Quantifoil R1.2/1.3' _em_sample_support.details ? _em_sample_support.specimen_id 1 _em_sample_support.citation_id ? # _em_virus_entity.id 1 _em_virus_entity.virus_host_category ? _em_virus_entity.virus_type VIRION _em_virus_entity.virus_isolate STRAIN _em_virus_entity.entity_assembly_id 1 _em_virus_entity.enveloped YES _em_virus_entity.empty YES _em_virus_entity.details ? # _em_vitrification.entry_id 8VCI _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.cryogen_name ETHANE _em_vitrification.humidity 100 _em_vitrification.temp ? _em_vitrification.chamber_temperature 4 _em_vitrification.instrument 'FEI VITROBOT MARK IV' _em_vitrification.method ? _em_vitrification.time_resolved_state ? _em_vitrification.citation_id ? _em_vitrification.details ? # _em_experiment.entry_id 8VCI _em_experiment.id 1 _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.aggregation_state PARTICLE _em_experiment.entity_assembly_id 1 # _em_single_particle_entity.entry_id 8VCI _em_single_particle_entity.id 1 _em_single_particle_entity.image_processing_id 1 _em_single_particle_entity.point_symmetry C1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # _em_ctf_correction.details ? _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.id 1 _em_ctf_correction.type NONE # _em_entity_assembly_molwt.entity_assembly_id 1 _em_entity_assembly_molwt.experimental_flag NO _em_entity_assembly_molwt.id 1 _em_entity_assembly_molwt.units ? _em_entity_assembly_molwt.value ? # _em_entity_assembly_naturalsource.cell ? _em_entity_assembly_naturalsource.cellular_location ? _em_entity_assembly_naturalsource.entity_assembly_id 1 _em_entity_assembly_naturalsource.id 2 _em_entity_assembly_naturalsource.ncbi_tax_id 2901879 _em_entity_assembly_naturalsource.organism 'Severe acute respiratory syndrome coronavirus' _em_entity_assembly_naturalsource.organelle ? _em_entity_assembly_naturalsource.organ ? _em_entity_assembly_naturalsource.strain Wuhan-Hu-1 _em_entity_assembly_naturalsource.tissue ? _em_entity_assembly_naturalsource.details ? # _em_entity_assembly_recombinant.cell ? _em_entity_assembly_recombinant.entity_assembly_id 1 _em_entity_assembly_recombinant.id 2 _em_entity_assembly_recombinant.ncbi_tax_id 32644 _em_entity_assembly_recombinant.organism unidentified _em_entity_assembly_recombinant.plasmid ? _em_entity_assembly_recombinant.strain ? # _em_image_processing.details ? _em_image_processing.id 1 _em_image_processing.image_recording_id 1 # _em_image_recording.average_exposure_time ? _em_image_recording.avg_electron_dose_per_subtomogram ? _em_image_recording.avg_electron_dose_per_image 60 _em_image_recording.details ? _em_image_recording.detector_mode ? _em_image_recording.film_or_detector_model 'GATAN K3 (6k x 4k)' _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged 3 _em_image_recording.num_real_images ? # loop_ _em_software.category _em_software.details _em_software.id _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id _em_software.name _em_software.version 'PARTICLE SELECTION' ? 1 1 ? ? cryoSPARC 4.3.1 'IMAGE ACQUISITION' ? 2 ? ? 1 cryoSPARC 4.3.1 MASKING ? 3 ? ? ? ? ? 'CTF CORRECTION' ? 4 1 ? ? cryoSPARC 4.3.1 'LAYERLINE INDEXING' ? 5 ? ? ? ? ? 'DIFFRACTION INDEXING' ? 6 ? ? ? ? ? 'MODEL FITTING' ? 7 ? 1 ? ? ? OTHER ? 8 ? ? ? ? ? 'INITIAL EULER ASSIGNMENT' ? 9 1 ? ? ? ? 'FINAL EULER ASSIGNMENT' ? 10 1 ? ? ? ? CLASSIFICATION ? 11 1 ? ? cryoSPARC 4.3.1 RECONSTRUCTION ? 12 1 ? ? cryoSPARC 4.3.1 'MODEL REFINEMENT' ? 13 ? 1 ? ? ? # _em_specimen.concentration ? _em_specimen.details ? _em_specimen.embedding_applied NO _em_specimen.experiment_id 1 _em_specimen.id 1 _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # _em_virus_natural_host.entity_assembly_id 1 _em_virus_natural_host.id 1 _em_virus_natural_host.ncbi_tax_id 9606 _em_virus_natural_host.organism 'Homo sapiens' _em_virus_natural_host.strain Wuhan-Hu-1 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8VCI 'double helix' 8VCI 'a-form double helix' 8VCI 'hairpin loop' 8VCI 'bulge loop' 8VCI 'mismatched base pair' 8VCI 'triple helix' 8VCI 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 52 1_555 -0.137 -0.138 -0.118 -4.705 -4.907 -1.057 1 A_G1:C52_A A 1 ? A 52 ? 19 1 1 A G 2 1_555 A C 51 1_555 -0.109 -0.143 -0.155 -8.165 -6.272 -1.603 2 A_G2:C51_A A 2 ? A 51 ? 19 1 1 A G 3 1_555 A U 50 1_555 -2.059 -0.456 -0.011 -2.668 -6.387 -3.591 3 A_G3:U50_A A 3 ? A 50 ? 28 1 1 A A 4 1_555 A U 49 1_555 0.021 -0.063 -0.067 0.912 -3.839 -3.980 4 A_A4:U49_A A 4 ? A 49 ? 20 1 1 A A 5 1_555 A U 48 1_555 -0.006 -0.093 -0.146 -0.005 -6.445 -2.185 5 A_A5:U48_A A 5 ? A 48 ? 20 1 1 A C 6 1_555 A G 47 1_555 0.165 -0.133 -0.054 0.671 -2.823 -0.831 6 A_C6:G47_A A 6 ? A 47 ? 19 1 1 A C 7 1_555 A G 46 1_555 0.160 -0.129 -0.053 -0.221 -1.683 -1.367 7 A_C7:G46_A A 7 ? A 46 ? 19 1 1 A C 8 1_555 A G 45 1_555 0.165 -0.130 -0.070 -0.040 -1.339 -1.168 8 A_C8:G45_A A 8 ? A 45 ? 19 1 1 A G 35 1_555 A C 44 1_555 -0.026 -0.256 0.515 -3.233 -17.225 -5.468 9 A_G35:C44_A A 35 ? A 44 ? 19 1 1 A U 36 1_555 A A 43 1_555 0.028 -0.213 -0.049 -10.578 -38.862 -8.510 10 A_U36:A43_A A 36 ? A 43 ? 20 1 1 A U 37 1_555 A A 42 1_555 -0.088 -0.084 -0.092 -42.062 4.439 -5.104 11 A_U37:A42_A A 37 ? A 42 ? 20 1 1 A U 10 1_555 A A 29 1_555 0.048 -0.117 -0.144 -0.843 -6.692 -0.927 12 A_U10:A29_A A 10 ? A 29 ? 20 1 1 A G 11 1_555 A C 28 1_555 -0.108 -0.126 -0.148 -7.434 -4.837 -1.674 13 A_G11:C28_A A 11 ? A 28 ? 19 1 1 A C 12 1_555 A G 27 1_555 0.164 -0.126 -0.035 0.211 -2.527 -1.149 14 A_C12:G27_A A 12 ? A 27 ? 19 1 1 A U 13 1_555 A U 26 1_555 3.480 -1.176 -1.066 -10.748 -20.448 -49.300 15 A_U13:U26_A A 13 ? A 26 ? ? ? 1 A U 14 1_555 A A 25 1_555 0.060 -0.116 -0.168 -1.022 -7.220 -0.998 16 A_U14:A25_A A 14 ? A 25 ? 20 1 1 A C 15 1_555 A G 24 1_555 0.157 -0.137 0.005 -3.244 0.456 -0.795 17 A_C15:G24_A A 15 ? A 24 ? 19 1 1 A A 16 1_555 A U 23 1_555 0.039 -0.072 -0.140 -3.523 -2.332 -4.028 18 A_A16:U23_A A 16 ? A 23 ? 20 1 1 A G 17 1_555 A C 22 1_555 -0.110 -0.121 -0.115 -4.781 -4.253 -1.634 19 A_G17:C22_A A 17 ? A 22 ? 19 1 1 A G 69 1_555 A C 63 1_555 -0.162 -0.120 -0.043 -1.514 -4.034 -1.004 20 A_G69:C63_A A 69 ? A 63 ? 19 1 1 A U 70 1_555 A G 62 1_555 2.109 -0.484 -0.007 1.890 -11.163 -1.571 21 A_U70:G62_A A 70 ? A 62 ? 28 1 1 A C 71 1_555 A G 60 1_555 0.113 -0.123 -0.122 5.135 -4.714 -1.588 22 A_C71:G60_A A 71 ? A 60 ? 19 1 1 A U 72 1_555 A A 59 1_555 -0.011 -0.085 -0.146 1.286 -4.570 -2.919 23 A_U72:A59_A A 72 ? A 59 ? 20 1 1 A U 73 1_555 A A 58 1_555 -0.026 -0.076 -0.096 2.919 -2.600 -3.105 24 A_U73:A58_A A 73 ? A 58 ? 20 1 1 A A 74 1_555 A U 57 1_555 -0.047 -0.083 -0.072 2.417 -4.877 -2.842 25 A_A74:U57_A A 74 ? A 57 ? 20 1 1 A C 75 1_555 A G 56 1_555 0.096 -0.120 -0.077 4.725 -4.096 -1.907 26 A_C75:G56_A A 75 ? A 56 ? 19 1 1 A A 76 1_555 A U 55 1_555 -0.056 -0.082 -0.076 3.654 -5.641 -3.170 27 A_A76:U55_A A 76 ? A 55 ? 20 1 1 A C 77 1_555 A G 54 1_555 0.118 -0.125 -0.127 6.793 -5.511 -1.568 28 A_C77:G54_A A 77 ? A 54 ? 19 1 1 A C 78 1_555 A G 53 1_555 0.136 -0.138 -0.117 4.693 -4.909 -1.062 29 A_C78:G53_A A 78 ? A 53 ? 19 1 1 A G 79 1_555 A U 110 1_555 -2.107 -0.484 -0.009 -1.867 -11.453 -1.611 30 A_G79:U110_A A 79 ? A 110 ? 28 1 1 A U 80 1_555 A A 109 1_555 0.096 -0.114 -0.140 -2.088 -8.794 -1.347 31 A_U80:A109_A A 80 ? A 109 ? 20 1 1 A G 81 1_555 A U 108 1_555 -2.052 -0.471 0.013 -3.175 -5.672 -4.320 32 A_G81:U108_A A 81 ? A 108 ? 28 1 1 A C 82 1_555 A G 107 1_555 0.146 -0.115 -0.042 2.493 -3.248 -1.732 33 A_C82:G107_A A 82 ? A 107 ? 19 1 1 A G 83 1_555 A C 106 1_555 -0.104 -0.150 -0.120 -4.820 -5.013 -1.203 34 A_G83:C106_A A 83 ? A 106 ? 19 1 1 A G 84 1_555 A U 105 1_555 -2.054 -0.461 0.002 -1.889 -6.905 -3.687 35 A_G84:U105_A A 84 ? A 105 ? 28 1 1 A C 85 1_555 A G 104 1_555 0.146 -0.116 -0.034 2.491 -3.464 -1.579 36 A_C85:G104_A A 85 ? A 104 ? 19 1 1 A A 86 1_555 A U 103 1_555 0.012 -0.089 -0.135 -1.301 -5.108 -2.664 37 A_A86:U103_A A 86 ? A 103 ? 20 1 1 A C 87 1_555 A G 101 1_555 0.145 -0.139 -0.077 2.381 -3.497 -0.635 38 A_C87:G101_A A 87 ? A 101 ? 19 1 1 A A 88 1_555 A U 100 1_555 0.022 -0.088 -0.183 -4.990 -2.838 -2.993 39 A_A88:U100_A A 88 ? A 100 ? 20 1 1 A G 89 1_555 A C 99 1_555 -0.110 -0.122 -0.145 -6.071 -4.709 -1.656 40 A_G89:C99_A A 89 ? A 99 ? 19 1 1 A C 91 1_555 A A 98 1_555 -1.814 -0.064 0.981 -8.915 -0.260 0.746 41 A_C91:A98_A A 91 ? A 98 ? ? 1 1 A A 92 1_555 A U 97 1_555 -0.056 -0.071 1.069 22.148 6.376 -5.448 42 A_A92:U97_A A 92 ? A 97 ? 20 1 1 A C 93 1_555 A G 96 1_555 0.137 -0.749 1.190 45.520 22.211 13.347 43 A_C93:G96_A A 93 ? A 96 ? 19 1 1 A A 64 1_555 A U 118 1_555 -0.042 -0.121 -0.200 -1.073 -7.564 -0.938 44 A_A64:U118_A A 64 ? A 118 ? 20 1 1 A G 65 1_555 A C 117 1_555 -0.119 -0.130 -0.166 -7.030 -5.275 -1.177 45 A_G65:C117_A A 65 ? A 117 ? 19 1 1 A C 66 1_555 A G 116 1_555 0.161 -0.127 -0.020 -0.627 -2.513 -1.281 46 A_C66:G116_A A 66 ? A 116 ? 19 1 1 A C 67 1_555 A G 115 1_555 0.165 -0.129 -0.065 0.062 -1.429 -1.288 47 A_C67:G115_A A 67 ? A 115 ? 19 1 1 A C 68 1_555 A G 114 1_555 0.161 -0.127 -0.063 0.120 -1.604 -1.351 48 A_C68:G114_A A 68 ? A 114 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 52 1_555 A G 2 1_555 A C 51 1_555 -0.043 -1.783 3.322 0.225 7.160 32.319 -4.289 0.113 2.871 12.669 -0.398 33.083 1 AA_G1G2:C51C52_AA A 1 ? A 52 ? A 2 ? A 51 ? 1 A G 2 1_555 A C 51 1_555 A G 3 1_555 A U 50 1_555 0.047 -1.710 2.959 -3.353 8.716 26.670 -5.177 -0.739 2.275 18.200 7.002 28.230 2 AA_G2G3:U50C51_AA A 2 ? A 51 ? A 3 ? A 50 ? 1 A G 3 1_555 A U 50 1_555 A A 4 1_555 A U 49 1_555 -0.031 -1.320 3.223 -1.648 5.550 38.806 -2.602 -0.143 3.012 8.297 2.464 39.219 3 AA_G3A4:U49U50_AA A 3 ? A 50 ? A 4 ? A 49 ? 1 A A 4 1_555 A U 49 1_555 A A 5 1_555 A U 48 1_555 0.225 -1.719 3.290 0.153 8.135 32.168 -4.303 -0.370 2.785 14.396 -0.271 33.155 4 AA_A4A5:U48U49_AA A 4 ? A 49 ? A 5 ? A 48 ? 1 A A 5 1_555 A U 48 1_555 A C 6 1_555 A G 47 1_555 0.195 -1.746 3.252 -0.240 6.297 33.127 -3.979 -0.374 2.880 10.921 0.417 33.704 5 AA_A5C6:G47U48_AA A 5 ? A 48 ? A 6 ? A 47 ? 1 A C 6 1_555 A G 47 1_555 A C 7 1_555 A G 46 1_555 0.168 -1.803 3.273 1.108 6.693 31.626 -4.358 -0.117 2.846 12.106 -2.004 32.327 6 AA_C6C7:G46G47_AA A 6 ? A 47 ? A 7 ? A 46 ? 1 A C 7 1_555 A G 46 1_555 A C 8 1_555 A G 45 1_555 0.252 -1.770 3.253 1.235 6.837 31.808 -4.282 -0.247 2.829 12.293 -2.221 32.538 7 AA_C7C8:G45G46_AA A 7 ? A 46 ? A 8 ? A 45 ? 1 A C 8 1_555 A G 45 1_555 A G 35 1_555 A C 44 1_555 -2.098 -1.463 5.124 26.301 56.243 67.734 -2.757 2.296 2.714 42.761 -19.997 89.302 8 AA_C8G35:C44G45_AA A 8 ? A 45 ? A 35 ? A 44 ? 1 A G 35 1_555 A C 44 1_555 A U 36 1_555 A A 43 1_555 0.027 -1.202 3.423 7.800 9.612 37.472 -2.927 0.889 2.985 14.486 -11.755 39.394 9 AA_G35U36:A43C44_AA A 35 ? A 44 ? A 36 ? A 43 ? 1 A U 36 1_555 A A 43 1_555 A U 37 1_555 A A 42 1_555 0.737 -0.172 4.151 5.887 -1.098 44.763 -0.098 -0.283 4.213 -1.434 -7.690 45.142 10 AA_U36U37:A42A43_AA A 36 ? A 43 ? A 37 ? A 42 ? 1 A U 10 1_555 A A 29 1_555 A G 11 1_555 A C 28 1_555 -0.047 -1.764 3.394 0.597 9.884 32.189 -4.597 0.175 2.746 17.322 -1.046 33.639 11 AA_U10G11:C28A29_AA A 10 ? A 29 ? A 11 ? A 28 ? 1 A G 11 1_555 A C 28 1_555 A C 12 1_555 A G 27 1_555 0.240 -1.608 3.046 -0.289 4.271 33.063 -3.443 -0.463 2.820 7.465 0.506 33.331 12 AA_G11C12:G27C28_AA A 11 ? A 28 ? A 12 ? A 27 ? 1 A C 12 1_555 A G 27 1_555 A U 13 1_555 A U 26 1_555 -1.979 -1.502 3.760 7.280 7.099 54.574 -2.065 2.590 3.289 7.668 -7.863 55.441 13 AA_C12U13:U26G27_AA A 12 ? A 27 ? A 13 ? A 26 ? 1 A U 13 1_555 A U 26 1_555 A U 14 1_555 A A 25 1_555 2.697 -2.358 3.846 -1.835 -26.682 6.469 6.349 -6.450 3.019 -76.467 5.260 27.503 14 AA_U13U14:A25U26_AA A 13 ? A 26 ? A 14 ? A 25 ? 1 A U 14 1_555 A A 25 1_555 A C 15 1_555 A G 24 1_555 0.003 -1.809 3.296 -0.232 7.869 33.238 -4.261 -0.040 2.807 13.521 0.399 34.132 15 AA_U14C15:G24A25_AA A 14 ? A 25 ? A 15 ? A 24 ? 1 A C 15 1_555 A G 24 1_555 A A 16 1_555 A U 23 1_555 -0.032 -1.719 3.276 1.681 8.247 30.663 -4.553 0.346 2.727 15.238 -3.107 31.771 16 AA_C15A16:U23G24_AA A 15 ? A 24 ? A 16 ? A 23 ? 1 A A 16 1_555 A U 23 1_555 A G 17 1_555 A C 22 1_555 0.362 -1.713 3.341 -0.143 7.654 31.339 -4.395 -0.676 2.852 13.911 0.261 32.238 17 AA_A16G17:C22U23_AA A 16 ? A 23 ? A 17 ? A 22 ? 1 A G 69 1_555 A C 63 1_555 A U 70 1_555 A G 62 1_555 0.060 -1.436 3.109 1.525 4.537 40.976 -2.492 0.068 2.941 6.455 -2.170 41.242 18 AA_G69U70:G62C63_AA A 69 ? A 63 ? A 70 ? A 62 ? 1 A U 70 1_555 A G 62 1_555 A C 71 1_555 A G 60 1_555 1.128 -3.123 3.934 -20.769 24.989 42.768 -4.948 -2.474 1.386 29.711 24.693 53.246 19 AA_U70C71:G60G62_AA A 70 ? A 62 ? A 71 ? A 60 ? 1 A C 71 1_555 A G 60 1_555 A U 72 1_555 A A 59 1_555 -0.219 -1.758 3.393 0.355 8.261 31.443 -4.548 0.452 2.849 14.923 -0.641 32.485 20 AA_C71U72:A59G60_AA A 71 ? A 60 ? A 72 ? A 59 ? 1 A U 72 1_555 A A 59 1_555 A U 73 1_555 A A 58 1_555 -0.180 -1.650 3.242 -0.226 7.912 31.617 -4.227 0.285 2.761 14.244 0.407 32.569 21 AA_U72U73:A58A59_AA A 72 ? A 59 ? A 73 ? A 58 ? 1 A U 73 1_555 A A 58 1_555 A A 74 1_555 A U 57 1_555 -0.130 -1.607 3.254 -0.268 10.613 32.262 -4.322 0.183 2.611 18.485 0.467 33.920 22 AA_U73A74:U57A58_AA A 73 ? A 58 ? A 74 ? A 57 ? 1 A A 74 1_555 A U 57 1_555 A C 75 1_555 A G 56 1_555 -0.191 -1.616 3.281 -0.452 6.393 32.485 -3.869 0.262 2.921 11.291 0.798 33.095 23 AA_A74C75:G56U57_AA A 74 ? A 57 ? A 75 ? A 56 ? 1 A C 75 1_555 A G 56 1_555 A A 76 1_555 A U 55 1_555 -0.262 -1.613 3.258 -0.115 9.482 31.565 -4.346 0.445 2.675 16.957 0.207 32.924 24 AA_C75A76:U55G56_AA A 75 ? A 56 ? A 76 ? A 55 ? 1 A A 76 1_555 A U 55 1_555 A C 77 1_555 A G 54 1_555 -0.087 -1.649 3.219 -0.457 4.701 32.649 -3.663 0.080 2.961 8.308 0.807 32.980 25 AA_A76C77:G54U55_AA A 76 ? A 55 ? A 77 ? A 54 ? 1 A C 77 1_555 A G 54 1_555 A C 78 1_555 A G 53 1_555 -0.006 -1.800 3.279 0.009 6.151 32.415 -4.167 0.012 2.898 10.895 -0.016 32.978 26 AA_C77C78:G53G54_AA A 77 ? A 54 ? A 78 ? A 53 ? 1 A C 78 1_555 A G 53 1_555 A G 79 1_555 A U 110 1_555 1.545 -1.072 2.981 5.554 31.514 37.038 -3.356 -1.516 1.802 41.436 -7.303 48.577 27 AA_C78G79:U110G53_AA A 78 ? A 53 ? A 79 ? A 110 ? 1 A G 79 1_555 A U 110 1_555 A U 80 1_555 A A 109 1_555 -0.079 -1.418 3.176 -0.546 5.749 40.421 -2.629 0.056 2.956 8.269 0.785 40.814 28 AA_G79U80:A109U110_AA A 79 ? A 110 ? A 80 ? A 109 ? 1 A U 80 1_555 A A 109 1_555 A G 81 1_555 A U 108 1_555 -0.123 -1.800 3.160 -3.804 10.328 26.035 -5.779 -0.516 2.288 21.730 8.004 28.228 29 AA_U80G81:U108A109_AA A 80 ? A 109 ? A 81 ? A 108 ? 1 A G 81 1_555 A U 108 1_555 A C 82 1_555 A G 107 1_555 0.248 -1.325 3.139 -1.382 6.785 40.045 -2.608 -0.499 2.876 9.819 2.000 40.615 30 AA_G81C82:G107U108_AA A 81 ? A 108 ? A 82 ? A 107 ? 1 A C 82 1_555 A G 107 1_555 A G 83 1_555 A C 106 1_555 0.136 -1.757 3.449 0.503 10.415 30.854 -4.903 -0.157 2.729 18.911 -0.914 32.528 31 AA_C82G83:C106G107_AA A 82 ? A 107 ? A 83 ? A 106 ? 1 A G 83 1_555 A C 106 1_555 A G 84 1_555 A U 105 1_555 0.018 -1.766 3.000 -3.371 10.112 26.939 -5.378 -0.651 2.189 20.705 6.902 28.935 32 AA_G83G84:U105C106_AA A 83 ? A 106 ? A 84 ? A 105 ? 1 A G 84 1_555 A U 105 1_555 A C 85 1_555 A G 104 1_555 0.185 -1.327 3.161 -1.497 7.245 40.300 -2.635 -0.417 2.882 10.410 2.151 40.946 33 AA_G84C85:G104U105_AA A 84 ? A 105 ? A 85 ? A 104 ? 1 A C 85 1_555 A G 104 1_555 A A 86 1_555 A U 103 1_555 0.079 -1.722 3.342 0.713 9.529 31.597 -4.569 -0.024 2.723 17.019 -1.273 32.975 34 AA_C85A86:U103G104_AA A 85 ? A 104 ? A 86 ? A 103 ? 1 A A 86 1_555 A U 103 1_555 A C 87 1_555 A G 101 1_555 3.909 -1.345 4.407 -2.461 -24.540 55.216 0.382 -4.078 4.438 -25.129 2.520 60.076 35 AA_A86C87:G101U103_AA A 86 ? A 103 ? A 87 ? A 101 ? 1 A C 87 1_555 A G 101 1_555 A A 88 1_555 A U 100 1_555 -0.138 -1.864 3.440 1.213 8.666 31.460 -4.790 0.451 2.833 15.608 -2.184 32.624 36 AA_C87A88:U100G101_AA A 87 ? A 101 ? A 88 ? A 100 ? 1 A A 88 1_555 A U 100 1_555 A G 89 1_555 A C 99 1_555 0.246 -1.744 3.313 0.044 6.936 31.415 -4.336 -0.437 2.873 12.618 -0.080 32.152 37 AA_A88G89:C99U100_AA A 88 ? A 100 ? A 89 ? A 99 ? 1 A G 89 1_555 A C 99 1_555 A C 91 1_555 A A 98 1_555 -1.887 -2.283 5.189 14.083 27.339 43.502 -4.951 3.349 2.720 32.519 -16.751 52.841 38 AA_G89C91:A98C99_AA A 89 ? A 99 ? A 91 ? A 98 ? 1 A C 91 1_555 A A 98 1_555 A A 92 1_555 A U 97 1_555 -0.255 -0.627 2.587 -1.940 6.685 30.066 -2.186 0.187 2.407 12.673 3.677 30.843 39 AA_C91A92:U97A98_AA A 91 ? A 98 ? A 92 ? A 97 ? 1 A A 92 1_555 A U 97 1_555 A C 93 1_555 A G 96 1_555 0.100 -1.002 3.073 -5.848 16.195 26.508 -4.434 -1.120 2.069 31.451 11.358 31.525 40 AA_A92C93:G96U97_AA A 92 ? A 97 ? A 93 ? A 96 ? 1 A A 64 1_555 A U 118 1_555 A G 65 1_555 A C 117 1_555 -0.039 -1.849 3.379 -0.424 7.862 32.243 -4.517 -0.001 2.861 13.900 0.750 33.166 41 AA_A64G65:C117U118_AA A 64 ? A 118 ? A 65 ? A 117 ? 1 A G 65 1_555 A C 117 1_555 A C 66 1_555 A G 116 1_555 0.137 -1.665 3.078 -0.284 3.675 33.140 -3.461 -0.282 2.880 6.418 0.495 33.339 42 AA_G65C66:G116C117_AA A 65 ? A 117 ? A 66 ? A 116 ? 1 A C 66 1_555 A G 116 1_555 A C 67 1_555 A G 115 1_555 0.226 -1.766 3.226 1.203 6.585 31.490 -4.286 -0.208 2.815 11.965 -2.185 32.176 43 AA_C66C67:G115G116_AA A 66 ? A 116 ? A 67 ? A 115 ? 1 A C 67 1_555 A G 115 1_555 A C 68 1_555 A G 114 1_555 0.258 -1.772 3.266 1.163 6.770 31.763 -4.289 -0.268 2.845 12.192 -2.094 32.479 44 AA_C67C68:G114G115_AA A 67 ? A 115 ? A 68 ? A 114 ? # _pdbx_audit_support.funding_organization 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number R01GM133810 _pdbx_audit_support.ordinal 1 # _atom_sites.entry_id 8VCI _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_