data_8VFS # _entry.id 8VFS # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.401 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8VFS pdb_00008vfs 10.2210/pdb8vfs/pdb WWPDB D_1000280059 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2024-12-25 2 'Structure model' 1 1 2025-01-22 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_audit_revision_group.ordinal 1 _pdbx_audit_revision_group.revision_ordinal 2 _pdbx_audit_revision_group.data_content_type 'Structure model' _pdbx_audit_revision_group.group 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_ASTM' 4 2 'Structure model' '_citation.journal_id_CSD' 5 2 'Structure model' '_citation.journal_id_ISSN' 6 2 'Structure model' '_citation.journal_volume' 7 2 'Structure model' '_citation.page_first' 8 2 'Structure model' '_citation.page_last' 9 2 'Structure model' '_citation.pdbx_database_id_DOI' 10 2 'Structure model' '_citation.pdbx_database_id_PubMed' 11 2 'Structure model' '_citation.title' 12 2 'Structure model' '_citation.year' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8VFS _pdbx_database_status.recvd_initial_deposition_date 2023-12-21 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 4 _pdbx_contact_author.email adrian.ferre@nih.gov _pdbx_contact_author.name_first Adrian _pdbx_contact_author.name_last "Ferre-D'Amare" _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0003-4549-1619 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Shaffer, S.N.' 1 ? 'Passalacqua, L.F.M.' 2 ? 'Abdelsayed, M.M.' 3 ? ;Ferre-D'Amare, A.R. ; 4 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev J.Biol.Chem. _citation.journal_id_ASTM JBCHA3 _citation.journal_id_CSD 0071 _citation.journal_id_ISSN 1083-351X _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 300 _citation.language ? _citation.page_first 107547 _citation.page_last 107547 _citation.title 'RNA thermometers are widespread upstream of ABC transporter genes in bacteria.' _citation.year 2024 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1016/j.jbc.2024.107547 _citation.pdbx_database_id_PubMed 38992441 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Tong, A.Y.' 1 ? primary 'Tong, E.L.' 2 ? primary 'Hannani, M.A.' 3 ? primary 'Shaffer, S.N.' 4 ? primary 'Santiago, D.' 5 ? primary ;Ferre-D'Amare, A.R. ; 6 ? primary 'Passalacqua, L.F.M.' 7 ? primary 'Abdelsayed, M.M.' 8 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (27-MER)' 8682.175 2 ? ? ? ? 2 water nat water 18.015 4 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code AGCUUGCUUUAAGCCGCUGGAGGAGCU _entity_poly.pdbx_seq_one_letter_code_can AGCUUGCUUUAAGCCGCUGGAGGAGCU _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name water _pdbx_entity_nonpoly.comp_id HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 A n 1 2 G n 1 3 C n 1 4 U n 1 5 U n 1 6 G n 1 7 C n 1 8 U n 1 9 U n 1 10 U n 1 11 A n 1 12 A n 1 13 G n 1 14 C n 1 15 C n 1 16 G n 1 17 C n 1 18 U n 1 19 G n 1 20 G n 1 21 A n 1 22 G n 1 23 G n 1 24 A n 1 25 G n 1 26 C n 1 27 U n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 27 _pdbx_entity_src_syn.organism_scientific 'Providencia stuartii' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 588 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 A 1 1 1 A A A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 U 4 4 4 U U A . n A 1 5 U 5 5 5 U U A . n A 1 6 G 6 6 6 G G A . n A 1 7 C 7 7 7 C C A . n A 1 8 U 8 8 8 U U A . n A 1 9 U 9 9 9 U U A . n A 1 10 U 10 10 10 U U A . n A 1 11 A 11 11 11 A A A . n A 1 12 A 12 12 12 A A A . n A 1 13 G 13 13 13 G G A . n A 1 14 C 14 14 14 C C A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 C 17 17 17 C C A . n A 1 18 U 18 18 18 U U A . n A 1 19 G 19 19 19 G G A . n A 1 20 G 20 20 20 G G A . n A 1 21 A 21 21 21 A A A . n A 1 22 G 22 22 22 G G A . n A 1 23 G 23 23 23 G G A . n A 1 24 A 24 24 24 A A A . n A 1 25 G 25 25 25 G G A . n A 1 26 C 26 26 26 C C A . n A 1 27 U 27 27 27 U U A . n B 1 1 A 1 1 1 A A B . n B 1 2 G 2 2 2 G G B . n B 1 3 C 3 3 3 C C B . n B 1 4 U 4 4 4 U U B . n B 1 5 U 5 5 5 U U B . n B 1 6 G 6 6 6 G G B . n B 1 7 C 7 7 7 C C B . n B 1 8 U 8 8 8 U U B . n B 1 9 U 9 9 9 U U B . n B 1 10 U 10 10 10 U U B . n B 1 11 A 11 11 11 A A B . n B 1 12 A 12 12 12 A A B . n B 1 13 G 13 13 13 G G B . n B 1 14 C 14 14 14 C C B . n B 1 15 C 15 15 15 C C B . n B 1 16 G 16 16 16 G G B . n B 1 17 C 17 17 17 C C B . n B 1 18 U 18 18 18 U U B . n B 1 19 G 19 19 19 G G B . n B 1 20 G 20 20 20 G G B . n B 1 21 A 21 21 21 A A B . n B 1 22 G 22 22 22 G G B . n B 1 23 G 23 23 23 G G B . n B 1 24 A 24 24 24 A A B . n B 1 25 G 25 25 25 G G B . n B 1 26 C 26 26 26 C C B . n B 1 27 U 27 27 27 U U B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 HOH 1 101 2 HOH HOH A . C 2 HOH 2 102 4 HOH HOH A . C 2 HOH 3 103 3 HOH HOH A . D 2 HOH 1 101 1 HOH HOH B . # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 B G 6 ? N9 ? B G 6 N9 2 1 Y 1 B G 6 ? C8 ? B G 6 C8 3 1 Y 1 B G 6 ? N7 ? B G 6 N7 4 1 Y 1 B G 6 ? C5 ? B G 6 C5 5 1 Y 1 B G 6 ? C6 ? B G 6 C6 6 1 Y 1 B G 6 ? O6 ? B G 6 O6 7 1 Y 1 B G 6 ? N1 ? B G 6 N1 8 1 Y 1 B G 6 ? C2 ? B G 6 C2 9 1 Y 1 B G 6 ? N2 ? B G 6 N2 10 1 Y 1 B G 6 ? N3 ? B G 6 N3 11 1 Y 1 B G 6 ? C4 ? B G 6 C4 # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.21rc1_5156 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? DIALS ? ? ? 3.8 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? DIALS ? ? ? 3.8 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? 2.8.3 4 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 8VFS _cell.details ? _cell.formula_units_Z ? _cell.length_a 63.602 _cell.length_a_esd ? _cell.length_b 63.602 _cell.length_b_esd ? _cell.length_c 86.147 _cell.length_c_esd ? _cell.volume 348486.490 _cell.volume_esd ? _cell.Z_PDB 16 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8VFS _symmetry.cell_setting ? _symmetry.Int_Tables_number 96 _symmetry.space_group_name_Hall 'P 4nw 2abw' _symmetry.space_group_name_H-M 'P 43 21 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8VFS _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.51 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 50.97 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'Ammonium Sulphate, Sodium acetate tri-hydrate pH 4.6, PEG MME 2000' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 294 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS3 2M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2023-11-17 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97741 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'ALS BEAMLINE 5.0.1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97741 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 5.0.1 _diffrn_source.pdbx_synchrotron_site ALS # _reflns.B_iso_Wilson_estimate 64.05 _reflns.entry_id 8VFS _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.7 _reflns.d_resolution_low 51.17 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 5232 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 97.63 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 24.0 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 18.53 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 1 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.09606 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.7 _reflns_shell.d_res_low 2.97 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 2.22 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 1267 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.995 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 0.712 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 70.57 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8VFS _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.70 _refine.ls_d_res_low 51.17 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 5105 _refine.ls_number_reflns_R_free 508 _refine.ls_number_reflns_R_work 4597 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 97.57 _refine.ls_percent_reflns_R_free 9.95 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2130 _refine.ls_R_factor_R_free 0.2397 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2106 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.39 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1100 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 32.0276 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.4067 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.70 _refine_hist.d_res_low 51.17 _refine_hist.number_atoms_solvent 4 _refine_hist.number_atoms_total 1141 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1137 _refine_hist.pdbx_number_atoms_ligand 0 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0051 ? 1269 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.0631 ? 1975 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0494 ? 267 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0072 ? 53 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 13.2324 ? 639 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.70 2.97 . . 120 1108 96.92 . . . . 0.4053 . . . . . . . . . . . 0.4052 'X-RAY DIFFRACTION' 2.97 3.40 . . 119 1088 95.26 . . . . 0.2685 . . . . . . . . . . . 0.3225 'X-RAY DIFFRACTION' 3.40 4.28 . . 129 1155 98.09 . . . . 0.1938 . . . . . . . . . . . 0.2210 'X-RAY DIFFRACTION' 4.29 51.17 . . 140 1246 99.86 . . . . 0.1691 . . . . . . . . . . . 0.1940 # _struct.entry_id 8VFS _struct.title 'oppF ROSE-like RNA thermometer structure' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8VFS _struct_keywords.text 'RNA Thermometer, Regulatory RNA, ABC transporters, Thermoswitch, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 2 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8VFS _struct_ref.pdbx_db_accession 8VFS _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 8VFS A 1 ? 27 ? 8VFS 1 ? 27 ? 1 27 2 1 8VFS B 1 ? 27 ? 8VFS 1 ? 27 ? 1 27 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 2660 ? 1 MORE -12 ? 1 'SSA (A^2)' 9770 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A A 1 N1 ? ? ? 1_555 B U 27 N3 ? ? A A 1 B U 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A A 1 N6 ? ? ? 1_555 B U 27 O4 ? ? A A 1 B U 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 N1 ? ? ? 1_555 B C 26 N3 ? ? A G 2 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N2 ? ? ? 1_555 B C 26 O2 ? ? A G 2 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 O6 ? ? ? 1_555 B C 26 N4 ? ? A G 2 B C 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 3 N3 ? ? ? 1_555 B G 25 N1 ? ? A C 3 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N4 ? ? ? 1_555 B G 25 O6 ? ? A C 3 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 O2 ? ? ? 1_555 B G 25 N2 ? ? A C 3 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 4 N3 ? ? ? 1_555 B A 24 N1 ? ? A U 4 B A 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 4 O4 ? ? ? 1_555 B A 24 N6 ? ? A U 4 B A 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 5 N3 ? ? ? 1_555 B G 23 O6 ? ? A U 5 B G 23 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog12 hydrog ? ? A U 5 O2 ? ? ? 1_555 B G 23 N1 ? ? A U 5 B G 23 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog13 hydrog ? ? A C 7 N3 ? ? ? 1_555 B G 22 N1 ? ? A C 7 B G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 7 N4 ? ? ? 1_555 B G 22 O6 ? ? A C 7 B G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 7 O2 ? ? ? 1_555 B G 22 N2 ? ? A C 7 B G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 8 N3 ? ? ? 1_555 B A 21 N1 ? ? A U 8 B A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 8 O4 ? ? ? 1_555 B A 21 N6 ? ? A U 8 B A 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 9 N3 ? ? ? 1_555 B G 20 O6 ? ? A U 9 B G 20 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog19 hydrog ? ? A U 9 O2 ? ? ? 1_555 B G 20 N1 ? ? A U 9 B G 20 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog20 hydrog ? ? A U 10 N3 ? ? ? 1_555 B G 19 O6 ? ? A U 10 B G 19 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog21 hydrog ? ? A U 10 O2 ? ? ? 1_555 B G 19 N1 ? ? A U 10 B G 19 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog22 hydrog ? ? A A 11 N6 ? ? ? 1_555 B C 15 N3 ? ? A A 11 B C 15 1_555 ? ? ? ? ? ? TYPE_25_PAIR ? ? ? hydrog23 hydrog ? ? A A 11 N7 ? ? ? 1_555 B C 15 N4 ? ? A A 11 B C 15 1_555 ? ? ? ? ? ? TYPE_25_PAIR ? ? ? hydrog24 hydrog ? ? A A 11 N1 ? ? ? 1_555 B U 18 N3 ? ? A A 11 B U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A A 11 N6 ? ? ? 1_555 B U 18 O4 ? ? A A 11 B U 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 17 N3 ? ? A G 13 B C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 17 O2 ? ? A G 13 B C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 17 N4 ? ? A G 13 B C 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 14 N3 ? ? ? 1_555 B G 16 N1 ? ? A C 14 B G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 14 N4 ? ? ? 1_555 B G 16 O6 ? ? A C 14 B G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 14 O2 ? ? ? 1_555 B G 16 N2 ? ? A C 14 B G 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 16 N1 ? ? ? 1_555 B C 14 N3 ? ? A G 16 B C 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 16 N2 ? ? ? 1_555 B C 14 O2 ? ? A G 16 B C 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 16 O6 ? ? ? 1_555 B C 14 N4 ? ? A G 16 B C 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 17 N3 ? ? ? 1_555 B G 13 N1 ? ? A C 17 B G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 17 N4 ? ? ? 1_555 B G 13 O6 ? ? A C 17 B G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 17 O2 ? ? ? 1_555 B G 13 N2 ? ? A C 17 B G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A U 18 N3 ? ? ? 1_555 B A 12 N1 ? ? A U 18 B A 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 18 O4 ? ? ? 1_555 B A 12 N6 ? ? A U 18 B A 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 19 N1 ? ? ? 1_555 B U 10 O2 ? ? A G 19 B U 10 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog41 hydrog ? ? A G 19 O6 ? ? ? 1_555 B U 10 N3 ? ? A G 19 B U 10 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog42 hydrog ? ? A G 20 N1 ? ? ? 1_555 B U 9 O2 ? ? A G 20 B U 9 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog43 hydrog ? ? A G 20 O6 ? ? ? 1_555 B U 9 N3 ? ? A G 20 B U 9 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog44 hydrog ? ? A A 21 N1 ? ? ? 1_555 B U 8 N3 ? ? A A 21 B U 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A A 21 N6 ? ? ? 1_555 B U 8 O4 ? ? A A 21 B U 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 22 N1 ? ? ? 1_555 B C 7 N3 ? ? A G 22 B C 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 22 N2 ? ? ? 1_555 B C 7 O2 ? ? A G 22 B C 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 22 O6 ? ? ? 1_555 B C 7 N4 ? ? A G 22 B C 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 23 N1 ? ? ? 1_555 B U 5 O2 ? ? A G 23 B U 5 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog50 hydrog ? ? A G 23 O6 ? ? ? 1_555 B U 5 N3 ? ? A G 23 B U 5 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog51 hydrog ? ? A A 24 N1 ? ? ? 1_555 B U 4 N3 ? ? A A 24 B U 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A A 24 N6 ? ? ? 1_555 B U 4 O4 ? ? A A 24 B U 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 25 N1 ? ? ? 1_555 B C 3 N3 ? ? A G 25 B C 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 25 N2 ? ? ? 1_555 B C 3 O2 ? ? A G 25 B C 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 25 O6 ? ? ? 1_555 B C 3 N4 ? ? A G 25 B C 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A C 26 N3 ? ? ? 1_555 B G 2 N1 ? ? A C 26 B G 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 26 N4 ? ? ? 1_555 B G 2 O6 ? ? A C 26 B G 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 26 O2 ? ? ? 1_555 B G 2 N2 ? ? A C 26 B G 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A U 27 N3 ? ? ? 1_555 B A 1 N1 ? ? A U 27 B A 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A U 27 O4 ? ? ? 1_555 B A 1 N6 ? ? A U 27 B A 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_entry_details.entry_id 8VFS _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.has_ligand_of_interest ? _pdbx_entry_details.has_protein_modification N # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 "O4'" _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 G _pdbx_validate_rmsd_angle.auth_seq_id_1 16 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 "C1'" _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 G _pdbx_validate_rmsd_angle.auth_seq_id_2 16 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 N9 _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 G _pdbx_validate_rmsd_angle.auth_seq_id_3 16 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 114.76 _pdbx_validate_rmsd_angle.angle_target_value 108.50 _pdbx_validate_rmsd_angle.angle_deviation 6.26 _pdbx_validate_rmsd_angle.angle_standard_deviation 0.70 _pdbx_validate_rmsd_angle.linker_flag N # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 -y+1/2,x+1/2,z+3/4 3 y+1/2,-x+1/2,z+1/4 4 x+1/2,-y+1/2,-z+1/4 5 -x+1/2,y+1/2,-z+3/4 6 -x,-y,z+1/2 7 y,x,-z 8 -y,-x,-z+1/2 # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x -12.880445502 _pdbx_refine_tls.origin_y -37.510250506 _pdbx_refine_tls.origin_z 71.7150220824 _pdbx_refine_tls.T[1][1] 0.814019767803 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] 0.135927683511 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.0220153959764 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.731584735585 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] 0.00957173979352 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.385989723561 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 1.45330672254 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] 0.168586840826 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] 1.98679848273 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 0.52428847473 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] -0.932888878343 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 7.73681414907 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] 0.00470673683651 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] 0.180397589456 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] 0.178547206294 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] 0.203460467841 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] -0.00441500255001 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] 0.0103840137936 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] -0.996827452809 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] 0.700834856174 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] -0.0589388793275 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id A _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id A _pdbx_refine_tls_group.beg_auth_seq_id 1 _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id C _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id H _pdbx_refine_tls_group.end_auth_seq_id 4 _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 U OP3 O N N 114 U P P N N 115 U OP1 O N N 116 U OP2 O N N 117 U "O5'" O N N 118 U "C5'" C N N 119 U "C4'" C N R 120 U "O4'" O N N 121 U "C3'" C N S 122 U "O3'" O N N 123 U "C2'" C N R 124 U "O2'" O N N 125 U "C1'" C N R 126 U N1 N N N 127 U C2 C N N 128 U O2 O N N 129 U N3 N N N 130 U C4 C N N 131 U O4 O N N 132 U C5 C N N 133 U C6 C N N 134 U HOP3 H N N 135 U HOP2 H N N 136 U "H5'" H N N 137 U "H5''" H N N 138 U "H4'" H N N 139 U "H3'" H N N 140 U "HO3'" H N N 141 U "H2'" H N N 142 U "HO2'" H N N 143 U "H1'" H N N 144 U H3 H N N 145 U H5 H N N 146 U H6 H N N 147 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 U OP3 P sing N N 118 U OP3 HOP3 sing N N 119 U P OP1 doub N N 120 U P OP2 sing N N 121 U P "O5'" sing N N 122 U OP2 HOP2 sing N N 123 U "O5'" "C5'" sing N N 124 U "C5'" "C4'" sing N N 125 U "C5'" "H5'" sing N N 126 U "C5'" "H5''" sing N N 127 U "C4'" "O4'" sing N N 128 U "C4'" "C3'" sing N N 129 U "C4'" "H4'" sing N N 130 U "O4'" "C1'" sing N N 131 U "C3'" "O3'" sing N N 132 U "C3'" "C2'" sing N N 133 U "C3'" "H3'" sing N N 134 U "O3'" "HO3'" sing N N 135 U "C2'" "O2'" sing N N 136 U "C2'" "C1'" sing N N 137 U "C2'" "H2'" sing N N 138 U "O2'" "HO2'" sing N N 139 U "C1'" N1 sing N N 140 U "C1'" "H1'" sing N N 141 U N1 C2 sing N N 142 U N1 C6 sing N N 143 U C2 O2 doub N N 144 U C2 N3 sing N N 145 U N3 C4 sing N N 146 U N3 H3 sing N N 147 U C4 O4 doub N N 148 U C4 C5 sing N N 149 U C5 C6 doub N N 150 U C5 H5 sing N N 151 U C6 H6 sing N N 152 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8VFS 'double helix' 8VFS 'a-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A A 1 1_555 B U 27 1_555 0.046 -0.176 0.851 8.312 1.975 1.479 1 A_A1:U27_B A 1 ? B 27 ? 20 1 1 A G 2 1_555 B C 26 1_555 -0.245 -0.146 0.493 7.174 -6.584 2.000 2 A_G2:C26_B A 2 ? B 26 ? 19 1 1 A C 3 1_555 B G 25 1_555 0.226 -0.188 0.277 1.507 -9.171 1.428 3 A_C3:G25_B A 3 ? B 25 ? 19 1 1 A U 4 1_555 B A 24 1_555 -0.033 -0.171 0.307 -5.813 -8.664 1.590 4 A_U4:A24_B A 4 ? B 24 ? 20 1 1 A U 5 1_555 B G 23 1_555 1.976 -0.556 0.130 -3.717 -6.492 1.983 5 A_U5:G23_B A 5 ? B 23 ? 28 1 1 A C 7 1_555 B G 22 1_555 0.237 -0.123 0.039 2.692 -2.742 2.667 6 A_C7:G22_B A 7 ? B 22 ? 19 1 1 A U 8 1_555 B A 21 1_555 -0.181 -0.084 -0.016 1.385 -1.915 3.402 7 A_U8:A21_B A 8 ? B 21 ? 20 1 1 A U 9 1_555 B G 20 1_555 1.708 -0.255 -0.235 -1.131 -1.482 9.211 8 A_U9:G20_B A 9 ? B 20 ? 28 1 1 A U 10 1_555 B G 19 1_555 2.232 -0.764 0.262 -0.993 -8.130 8.894 9 A_U10:G19_B A 10 ? B 19 ? 28 1 1 A A 11 1_555 B U 18 1_555 0.004 -0.216 0.653 13.943 -10.622 -1.085 10 A_A11:U18_B A 11 ? B 18 ? 20 1 1 A G 13 1_555 B C 17 1_555 -0.146 -0.152 0.348 -0.601 -6.181 3.435 11 A_G13:C17_B A 13 ? B 17 ? 19 1 1 A C 14 1_555 B G 16 1_555 0.165 -0.288 0.329 -8.397 -8.348 0.657 12 A_C14:G16_B A 14 ? B 16 ? 19 1 1 A G 16 1_555 B C 14 1_555 -0.742 -0.074 0.181 -2.443 9.187 5.380 13 A_G16:C14_B A 16 ? B 14 ? 19 1 1 A C 17 1_555 B G 13 1_555 0.190 -0.097 0.342 -0.604 -3.436 2.074 14 A_C17:G13_B A 17 ? B 13 ? 19 1 1 A U 18 1_555 B A 12 1_555 -0.071 -0.129 0.147 1.545 -3.604 -0.403 15 A_U18:A12_B A 18 ? B 12 ? 20 1 1 A G 19 1_555 B U 10 1_555 -2.010 -0.639 -0.077 -2.220 -3.589 -3.418 16 A_G19:U10_B A 19 ? B 10 ? 28 1 1 A G 20 1_555 B U 9 1_555 -1.815 -0.544 -0.271 0.131 -2.028 -0.377 17 A_G20:U9_B A 20 ? B 9 ? 28 1 1 A A 21 1_555 B U 8 1_555 0.078 -0.084 -0.179 -2.784 -1.056 2.972 18 A_A21:U8_B A 21 ? B 8 ? 20 1 1 A G 22 1_555 B C 7 1_555 -0.138 -0.076 -0.084 -5.813 -0.802 4.000 19 A_G22:C7_B A 22 ? B 7 ? 19 1 1 A G 23 1_555 B U 5 1_555 -1.918 -0.421 0.213 -1.132 -3.845 -6.564 20 A_G23:U5_B A 23 ? B 5 ? 28 1 1 A A 24 1_555 B U 4 1_555 0.570 -0.013 0.350 4.502 -9.458 4.973 21 A_A24:U4_B A 24 ? B 4 ? 20 1 1 A G 25 1_555 B C 3 1_555 -0.255 -0.199 -0.116 -4.256 -6.355 1.020 22 A_G25:C3_B A 25 ? B 3 ? 19 1 1 A C 26 1_555 B G 2 1_555 0.153 -0.182 0.258 -4.202 -3.404 0.703 23 A_C26:G2_B A 26 ? B 2 ? 19 1 1 A U 27 1_555 B A 1 1_555 0.147 -0.085 0.383 -0.118 -1.862 3.186 24 A_U27:A1_B A 27 ? B 1 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A A 1 1_555 B U 27 1_555 A G 2 1_555 B C 26 1_555 0.174 -1.749 3.095 0.678 7.709 30.004 -4.589 -0.210 2.580 14.587 -1.284 30.963 1 AA_A1G2:C26U27_BB A 1 ? B 27 ? A 2 ? B 26 ? 1 A G 2 1_555 B C 26 1_555 A C 3 1_555 B G 25 1_555 -0.025 -1.872 3.289 0.225 3.195 34.222 -3.658 0.076 3.107 5.414 -0.382 34.367 2 AA_G2C3:G25C26_BB A 2 ? B 26 ? A 3 ? B 25 ? 1 A C 3 1_555 B G 25 1_555 A U 4 1_555 B A 24 1_555 -0.293 -2.000 3.166 -0.118 7.496 31.625 -4.758 0.506 2.636 13.517 0.213 32.479 3 AA_C3U4:A24G25_BB A 3 ? B 25 ? A 4 ? B 24 ? 1 A U 4 1_555 B A 24 1_555 A U 5 1_555 B G 23 1_555 -0.046 -1.187 3.213 4.589 7.610 36.540 -2.782 0.638 2.890 11.921 -7.188 37.569 4 AA_U4U5:G23A24_BB A 4 ? B 24 ? A 5 ? B 23 ? 1 A U 5 1_555 B G 23 1_555 A C 7 1_555 B G 22 1_555 -1.742 -1.579 2.769 1.107 11.083 40.701 -3.087 2.511 2.237 15.585 -1.556 42.135 5 AA_U5C7:G22G23_BB A 5 ? B 23 ? A 7 ? B 22 ? 1 A C 7 1_555 B G 22 1_555 A U 8 1_555 B A 21 1_555 -0.194 -2.487 3.144 -1.324 4.096 26.673 -6.269 0.111 2.745 8.806 2.847 27.012 6 AA_C7U8:A21G22_BB A 7 ? B 22 ? A 8 ? B 21 ? 1 A U 8 1_555 B A 21 1_555 A U 9 1_555 B G 20 1_555 1.143 -2.033 3.248 6.077 1.654 32.910 -3.803 -0.973 3.297 2.886 -10.605 33.491 7 AA_U8U9:G20A21_BB A 8 ? B 21 ? A 9 ? B 20 ? 1 A U 9 1_555 B G 20 1_555 A U 10 1_555 B G 19 1_555 0.384 -1.919 3.036 3.364 7.779 35.547 -4.001 -0.206 2.597 12.522 -5.415 36.512 8 AA_U9U10:G19G20_BB A 9 ? B 20 ? A 10 ? B 19 ? 1 A U 10 1_555 B G 19 1_555 A A 11 1_555 B U 18 1_555 -1.999 -1.368 2.693 -0.794 6.093 22.181 -5.100 4.794 2.308 15.459 2.014 23.006 9 AA_U10A11:U18G19_BB A 10 ? B 19 ? A 11 ? B 18 ? 1 A A 11 1_555 B U 18 1_555 A G 13 1_555 B C 17 1_555 -0.943 -1.360 3.210 -3.372 11.518 43.309 -2.767 0.947 2.839 15.260 4.467 44.864 10 AA_A11G13:C17U18_BB A 11 ? B 18 ? A 13 ? B 17 ? 1 A G 13 1_555 B C 17 1_555 A C 14 1_555 B G 16 1_555 -0.582 -1.929 3.267 -0.491 -0.360 37.991 -2.917 0.831 3.292 -0.553 0.754 37.996 11 AA_G13C14:G16C17_BB A 13 ? B 17 ? A 14 ? B 16 ? 1 A C 14 1_555 B G 16 1_555 A G 16 1_555 B C 14 1_555 1.685 -2.470 6.060 5.571 16.659 53.761 -4.294 -1.223 5.281 17.893 -5.984 56.355 12 AA_C14G16:C14G16_BB A 14 ? B 16 ? A 16 ? B 14 ? 1 A G 16 1_555 B C 14 1_555 A C 17 1_555 B G 13 1_555 -0.774 -1.430 3.188 -2.040 3.508 37.432 -2.655 0.944 3.082 5.447 3.168 37.644 13 AA_G16C17:G13C14_BB A 16 ? B 14 ? A 17 ? B 13 ? 1 A C 17 1_555 B G 13 1_555 A U 18 1_555 B A 12 1_555 0.095 -2.009 3.008 0.712 4.404 33.996 -4.018 -0.063 2.735 7.491 -1.211 34.278 14 AA_C17U18:A12G13_BB A 17 ? B 13 ? A 18 ? B 12 ? 1 A U 18 1_555 B A 12 1_555 A G 19 1_555 B U 10 1_555 1.537 -0.906 3.156 1.906 5.301 38.358 -1.986 -2.094 3.078 8.014 -2.882 38.754 15 AA_U18G19:U10A12_BB A 18 ? B 12 ? A 19 ? B 10 ? 1 A G 19 1_555 B U 10 1_555 A G 20 1_555 B U 9 1_555 0.326 -1.624 3.095 -3.517 10.326 31.844 -4.272 -1.062 2.417 18.166 6.187 33.614 16 AA_G19G20:U9U10_BB A 19 ? B 10 ? A 20 ? B 9 ? 1 A G 20 1_555 B U 9 1_555 A A 21 1_555 B U 8 1_555 0.158 -1.813 3.348 -0.426 5.152 37.877 -3.410 -0.294 3.082 7.891 0.653 38.215 17 AA_G20A21:U8U9_BB A 20 ? B 9 ? A 21 ? B 8 ? 1 A A 21 1_555 B U 8 1_555 A G 22 1_555 B C 7 1_555 0.884 -2.125 3.396 2.780 3.085 27.371 -5.202 -1.164 3.214 6.473 -5.832 27.679 18 AA_A21G22:C7U8_BB A 21 ? B 8 ? A 22 ? B 7 ? 1 A G 22 1_555 B C 7 1_555 A G 23 1_555 B U 5 1_555 1.423 -1.144 2.982 -4.712 7.249 45.399 -1.995 -2.163 2.627 9.292 6.041 46.172 19 AA_G22G23:U5C7_BB A 22 ? B 7 ? A 23 ? B 5 ? 1 A G 23 1_555 B U 5 1_555 A A 24 1_555 B U 4 1_555 0.751 -1.252 3.058 -2.341 3.044 42.927 -1.979 -1.234 2.924 4.150 3.191 43.090 20 AA_G23A24:U4U5_BB A 23 ? B 5 ? A 24 ? B 4 ? 1 A A 24 1_555 B U 4 1_555 A G 25 1_555 B C 3 1_555 -0.344 -2.006 3.288 0.544 5.276 27.073 -5.427 0.848 2.846 11.134 -1.148 27.578 21 AA_A24G25:C3U4_BB A 24 ? B 4 ? A 25 ? B 3 ? 1 A G 25 1_555 B C 3 1_555 A C 26 1_555 B G 2 1_555 -0.438 -1.631 3.173 -5.093 4.673 36.703 -3.135 0.045 2.982 7.341 8.001 37.326 22 AA_G25C26:G2C3_BB A 25 ? B 3 ? A 26 ? B 2 ? 1 A C 26 1_555 B G 2 1_555 A U 27 1_555 B A 1 1_555 0.027 -1.465 3.178 0.515 5.815 28.454 -4.109 0.051 2.829 11.675 -1.035 29.034 23 AA_C26U27:A1G2_BB A 26 ? B 2 ? A 27 ? B 1 ? # _pdbx_audit_support.funding_organization 'National Institutes of Health/National Heart, Lung, and Blood Institute (NIH/NHLBI)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name Other _pdbx_initial_refinement_model.accession_code ? _pdbx_initial_refinement_model.details 'RNA 5 nts duplex' # _space_group.name_H-M_alt 'P 43 21 2' _space_group.name_Hall 'P 4nw 2abw' _space_group.IT_number 96 _space_group.crystal_system tetragonal _space_group.id 1 # _atom_sites.entry_id 8VFS _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.015723 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.015723 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.011608 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source C ? ? 3.54356 2.42580 ? ? 25.62398 1.50364 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 4.01032 2.96436 ? ? 19.97189 1.75589 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 7.96527 ? ? ? 9.05267 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 9.51135 5.44231 ? ? 1.42069 35.72801 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_ # loop_ #