data_8VPV # _entry.id 8VPV # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.396 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8VPV pdb_00008vpv 10.2210/pdb8vpv/pdb WWPDB D_1000280703 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2024-10-02 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8VPV _pdbx_database_status.recvd_initial_deposition_date 2024-01-17 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email joseph_wedekind@urmc.rochester.edu _pdbx_contact_author.name_first Joseph _pdbx_contact_author.name_last Wedekind _pdbx_contact_author.name_mi E. _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-4269-4229 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Srivastava, Y.' 1 0000-0001-9091-9851 'Jenkins, J.L.' 2 0000-0003-2548-3275 'Wedekind, J.E.' 3 0000-0002-4269-4229 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'New insights into Class III PreQ1 metabolite binding' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Srivastava, Y.' 1 0000-0001-9091-9851 primary 'Jermaine, J.L.' 2 0000-0003-2548-3275 primary 'Wedekind, J.E.' 3 0000-0002-4269-4229 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (101-MER)' 32310.047 1 ? ? ? ? 2 non-polymer syn 7-DEAZA-7-AMINOMETHYL-GUANINE 179.179 1 ? ? ? ? 3 water nat water 18.015 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code ;(GTP)AGCAACUUAGGAUUUUAGGCUCCCCGGCGUGUCUCGAACCAUGCCGGGCCAAACCCAUAGGGCUGGCGGUCCCUG UGCGGUCAAAUUCAUCCGCCGGAG ; _entity_poly.pdbx_seq_one_letter_code_can ;GAGCAACUUAGGAUUUUAGGCUCCCCGGCGUGUCUCGAACCAUGCCGGGCCAAACCCAUAGGGCUGGCGGUCCCUGUGCG GUCAAAUUCAUCCGCCGGAG ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 7-DEAZA-7-AMINOMETHYL-GUANINE PRF 3 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 A n 1 3 G n 1 4 C n 1 5 A n 1 6 A n 1 7 C n 1 8 U n 1 9 U n 1 10 A n 1 11 G n 1 12 G n 1 13 A n 1 14 U n 1 15 U n 1 16 U n 1 17 U n 1 18 A n 1 19 G n 1 20 G n 1 21 C n 1 22 U n 1 23 C n 1 24 C n 1 25 C n 1 26 C n 1 27 G n 1 28 G n 1 29 C n 1 30 G n 1 31 U n 1 32 G n 1 33 U n 1 34 C n 1 35 U n 1 36 C n 1 37 G n 1 38 A n 1 39 A n 1 40 C n 1 41 C n 1 42 A n 1 43 U n 1 44 G n 1 45 C n 1 46 C n 1 47 G n 1 48 G n 1 49 G n 1 50 C n 1 51 C n 1 52 A n 1 53 A n 1 54 A n 1 55 C n 1 56 C n 1 57 C n 1 58 A n 1 59 U n 1 60 A n 1 61 G n 1 62 G n 1 63 G n 1 64 C n 1 65 U n 1 66 G n 1 67 G n 1 68 C n 1 69 G n 1 70 G n 1 71 U n 1 72 C n 1 73 C n 1 74 C n 1 75 U n 1 76 G n 1 77 U n 1 78 G n 1 79 C n 1 80 G n 1 81 G n 1 82 U n 1 83 C n 1 84 A n 1 85 A n 1 86 A n 1 87 U n 1 88 U n 1 89 C n 1 90 A n 1 91 U n 1 92 C n 1 93 C n 1 94 G n 1 95 C n 1 96 C n 1 97 G n 1 98 G n 1 99 A n 1 100 G n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 100 _pdbx_entity_src_syn.organism_scientific 'Faecalibacterium prausnitzii' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 853 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 PRF non-polymer . 7-DEAZA-7-AMINOMETHYL-GUANINE ? 'C7 H9 N5 O' 179.179 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP A . n A 1 2 A 2 2 2 A A A . n A 1 3 G 3 3 3 G G A . n A 1 4 C 4 4 4 C C A . n A 1 5 A 5 5 5 A A A . n A 1 6 A 6 6 6 A A A . n A 1 7 C 7 7 7 C C A . n A 1 8 U 8 8 8 U U A . n A 1 9 U 9 9 9 U U A . n A 1 10 A 10 10 10 A A A . n A 1 11 G 11 11 11 G G A . n A 1 12 G 12 12 12 G G A . n A 1 13 A 13 13 13 A A A . n A 1 14 U 14 14 14 U U A . n A 1 15 U 15 15 15 U U A . n A 1 16 U 16 16 16 U U A . n A 1 17 U 17 17 17 U U A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 G 20 20 20 G G A . n A 1 21 C 21 21 21 C C A . n A 1 22 U 22 22 22 U U A . n A 1 23 C 23 23 23 C C A . n A 1 24 C 24 24 24 C C A . n A 1 25 C 25 25 25 C C A . n A 1 26 C 26 26 26 C C A . n A 1 27 G 27 27 27 G G A . n A 1 28 G 28 28 28 G G A . n A 1 29 C 29 29 29 C C A . n A 1 30 G 30 30 30 G G A . n A 1 31 U 31 31 31 U U A . n A 1 32 G 32 32 32 G G A . n A 1 33 U 33 33 33 U U A . n A 1 34 C 34 34 34 C C A . n A 1 35 U 35 35 35 U U A . n A 1 36 C 36 36 36 C C A . n A 1 37 G 37 37 37 G G A . n A 1 38 A 38 38 38 A A A . n A 1 39 A 39 39 39 A A A . n A 1 40 C 40 40 40 C C A . n A 1 41 C 41 41 41 C C A . n A 1 42 A 42 42 42 A A A . n A 1 43 U 43 43 43 U U A . n A 1 44 G 44 44 44 G G A . n A 1 45 C 45 45 45 C C A . n A 1 46 C 46 46 46 C C A . n A 1 47 G 47 47 47 G G A . n A 1 48 G 48 48 48 G G A . n A 1 49 G 49 49 49 G G A . n A 1 50 C 50 50 50 C C A . n A 1 51 C 51 51 51 C C A . n A 1 52 A 52 52 52 A A A . n A 1 53 A 53 53 53 A A A . n A 1 54 A 54 54 54 A A A . n A 1 55 C 55 55 55 C C A . n A 1 56 C 56 56 56 C C A . n A 1 57 C 57 57 57 C C A . n A 1 58 A 58 58 58 A A A . n A 1 59 U 59 59 59 U U A . n A 1 60 A 60 60 60 A A A . n A 1 61 G 61 61 61 G G A . n A 1 62 G 62 62 62 G G A . n A 1 63 G 63 63 63 G G A . n A 1 64 C 64 64 64 C C A . n A 1 65 U 65 65 65 U U A . n A 1 66 G 66 66 66 G G A . n A 1 67 G 67 67 67 G G A . n A 1 68 C 68 68 68 C C A . n A 1 69 G 69 69 69 G G A . n A 1 70 G 70 70 70 G G A . n A 1 71 U 71 71 71 U U A . n A 1 72 C 72 72 72 C C A . n A 1 73 C 73 73 73 C C A . n A 1 74 C 74 74 74 C C A . n A 1 75 U 75 75 75 U U A . n A 1 76 G 76 76 76 G G A . n A 1 77 U 77 77 77 U U A . n A 1 78 G 78 78 78 G G A . n A 1 79 C 79 79 79 C C A . n A 1 80 G 80 80 80 G G A . n A 1 81 G 81 81 81 G G A . n A 1 82 U 82 82 82 U U A . n A 1 83 C 83 83 83 C C A . n A 1 84 A 84 85 85 A A A . n A 1 85 A 85 86 86 A A A . n A 1 86 A 86 87 87 A A A . n A 1 87 U 87 88 88 U U A . n A 1 88 U 88 89 89 U U A . n A 1 89 C 89 90 90 C C A . n A 1 90 A 90 91 91 A A A . n A 1 91 U 91 92 92 U U A . n A 1 92 C 92 93 93 C C A . n A 1 93 C 93 94 94 C C A . n A 1 94 G 94 95 95 G G A . n A 1 95 C 95 96 96 C C A . n A 1 96 C 96 97 97 C C A . n A 1 97 G 97 98 98 G G A . n A 1 98 G 98 99 99 G G A . n A 1 99 A 99 100 100 A A A . n A 1 100 G 100 101 101 G G A . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id PRF _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id PRF _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 PRF 1 201 201 PRF PRF A . C 3 HOH 1 301 1 HOH HOH A . # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A C 34 ? P ? A C 34 P 2 1 Y 1 A C 34 ? OP1 ? A C 34 OP1 3 1 Y 1 A C 34 ? OP2 ? A C 34 OP2 4 1 Y 1 A C 34 ? "O5'" ? A C 34 "O5'" 5 1 Y 1 A C 34 ? "C5'" ? A C 34 "C5'" 6 1 Y 1 A C 34 ? "C4'" ? A C 34 "C4'" 7 1 Y 1 A C 34 ? "O4'" ? A C 34 "O4'" 8 1 Y 1 A C 34 ? "C3'" ? A C 34 "C3'" 9 1 Y 1 A C 34 ? "C2'" ? A C 34 "C2'" 10 1 Y 1 A C 34 ? "O2'" ? A C 34 "O2'" 11 1 Y 1 A C 34 ? "C1'" ? A C 34 "C1'" 12 1 Y 1 A C 34 ? N1 ? A C 34 N1 13 1 Y 1 A C 34 ? C2 ? A C 34 C2 14 1 Y 1 A C 34 ? O2 ? A C 34 O2 15 1 Y 1 A C 34 ? N3 ? A C 34 N3 16 1 Y 1 A C 34 ? C4 ? A C 34 C4 17 1 Y 1 A C 34 ? N4 ? A C 34 N4 18 1 Y 1 A C 34 ? C5 ? A C 34 C5 19 1 Y 1 A C 34 ? C6 ? A C 34 C6 # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.20.1_4487: ???)' 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? Aimless ? ? ? 0.7.4 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? . 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 8VPV _cell.details ? _cell.formula_units_Z ? _cell.length_a 82.685 _cell.length_a_esd ? _cell.length_b 82.685 _cell.length_b_esd ? _cell.length_c 282.007 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 12 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8VPV _symmetry.cell_setting ? _symmetry.Int_Tables_number 179 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 65 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8VPV _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 4.30 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 71.42 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 7 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '3.5 M Sodium Malonate' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 293.15 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2020-12-04 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97946 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRL BEAMLINE BL12-1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97946 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL12-1 _diffrn_source.pdbx_synchrotron_site SSRL # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 8VPV _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.04 _reflns.d_resolution_low 39.29 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 11152 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.9 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 9.1 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 8.9 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 0.98 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.124 _reflns.pdbx_Rpim_I_all 0.056 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.911 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.113 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 3.04 _reflns_shell.d_res_low 3.31 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 1.9 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 1954 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 9.1 _reflns_shell.pdbx_chi_squared 1.01 _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all 0.327 _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.991 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all 100 _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 0.662 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8VPV _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.04 _refine.ls_d_res_low 39.29 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 11127 _refine.ls_number_reflns_R_free 1121 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 94.84 _refine.ls_percent_reflns_R_free 10.07 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2527 _refine.ls_R_factor_R_free 0.2997 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2476 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'FOURIER SYNTHESIS' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.10 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 42.74 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.53 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 3.04 _refine_hist.d_res_low 39.29 _refine_hist.number_atoms_solvent 1 _refine_hist.number_atoms_total 2132 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 2131 _refine_hist.pdbx_number_atoms_ligand 0 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.001 ? 2376 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.333 ? 3699 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 13.575 ? 1187 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.018 ? 494 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.001 ? 100 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 3.04 3.18 . . 134 1185 93.00 . . . . 0.4432 . . . . . . . . . . . 0.4127 'X-RAY DIFFRACTION' 3.18 3.35 . . 131 1179 94.00 . . . . 0.3841 . . . . . . . . . . . 0.4297 'X-RAY DIFFRACTION' 3.35 3.56 . . 135 1181 92.00 . . . . 0.4039 . . . . . . . . . . . 0.4431 'X-RAY DIFFRACTION' 3.56 3.83 . . 139 1214 94.00 . . . . 0.3591 . . . . . . . . . . . 0.4355 'X-RAY DIFFRACTION' 3.83 4.22 . . 142 1258 97.00 . . . . 0.2951 . . . . . . . . . . . 0.3328 'X-RAY DIFFRACTION' 4.22 4.83 . . 144 1298 98.00 . . . . 0.2647 . . . . . . . . . . . 0.3057 'X-RAY DIFFRACTION' 4.83 6.07 . . 146 1307 97.00 . . . . 0.2623 . . . . . . . . . . . 0.3081 'X-RAY DIFFRACTION' 6.08 39.29 . . 150 1384 94.00 . . . . 0.1824 . . . . . . . . . . . 0.2410 # _struct.entry_id 8VPV _struct.title 'Class III PreQ1 riboswitch mutant delta84' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8VPV _struct_keywords.text ;PREQ1, QUEUOSINE, THREE-WAY HELICAL JUNCTION, APTAMER, METABOLITE, TRANSLATIONAL REGULATION, HL(OUT)-TYPE PSEUDOKNOT, RIBOSWITCH, RNA ; _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? # _struct_ref.id 1 _struct_ref.db_name GB _struct_ref.db_code CP065381.1 _struct_ref.pdbx_db_accession 2094528044 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ;GAGCAACUUAGGAUUUUAGGCUCCCCGGCGUGUCUCGAACCAUGCCGGGCCAAACCCAUAGGGCUGGCGGUCCCUGUGCG GUCAAAAUUCAUCCGCCGGAG ; _struct_ref.pdbx_align_begin 722729 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8VPV _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 100 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2094528044 _struct_ref_seq.db_align_beg 722729 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 722629 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 101 # _struct_ref_seq_dif.align_id 1 _struct_ref_seq_dif.pdbx_pdb_id_code 8VPV _struct_ref_seq_dif.mon_id ? _struct_ref_seq_dif.pdbx_pdb_strand_id A _struct_ref_seq_dif.seq_num ? _struct_ref_seq_dif.pdbx_pdb_ins_code ? _struct_ref_seq_dif.pdbx_seq_db_name GB _struct_ref_seq_dif.pdbx_seq_db_accession_code 2094528044 _struct_ref_seq_dif.db_mon_id A _struct_ref_seq_dif.pdbx_seq_db_seq_num 722643 _struct_ref_seq_dif.details deletion _struct_ref_seq_dif.pdbx_auth_seq_num ? _struct_ref_seq_dif.pdbx_ordinal 1 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A A 2 P ? ? A GTP 1 A A 2 1_555 ? ? ? ? ? ? ? 1.599 ? ? hydrog1 hydrog ? ? A GTP 1 N1 ? ? ? 1_555 A C 23 N3 ? ? A GTP 1 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A GTP 1 N2 ? ? ? 1_555 A C 23 O2 ? ? A GTP 1 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A GTP 1 O6 ? ? ? 1_555 A C 23 N4 ? ? A GTP 1 A C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A A 2 N1 ? ? ? 1_555 A U 22 N3 ? ? A A 2 A U 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A A 2 N6 ? ? ? 1_555 A U 22 O4 ? ? A A 2 A U 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 3 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 3 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 3 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 20 N1 ? ? A C 4 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 20 O6 ? ? A C 4 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 4 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 5 N1 ? ? ? 1_555 A G 19 N1 ? ? A A 5 A G 19 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog13 hydrog ? ? A A 5 N6 ? ? ? 1_555 A G 19 O6 ? ? A A 5 A G 19 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog14 hydrog ? ? A A 6 N1 ? ? ? 1_555 A A 18 N6 ? ? A A 6 A A 18 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog15 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 84 N7 ? ? A U 8 A A 85 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog16 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 84 N6 ? ? A U 8 A A 85 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog17 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 85 N7 ? ? A U 9 A A 86 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog18 hydrog ? ? A U 9 O4 ? ? ? 1_555 A A 85 N6 ? ? A U 9 A A 86 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog19 hydrog ? ? A A 10 N1 ? ? ? 1_555 A A 86 N6 ? ? A A 10 A A 87 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog20 hydrog ? ? A A 10 N6 ? ? ? 1_555 A A 86 N7 ? ? A A 10 A A 87 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog21 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 89 N3 ? ? A G 11 A C 90 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 89 O2 ? ? A G 11 A C 90 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 89 N4 ? ? A G 11 A C 90 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 12 N1 ? ? ? 1_555 A U 88 O2 ? ? A G 12 A U 89 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog25 hydrog ? ? A G 12 O6 ? ? ? 1_555 A U 88 N3 ? ? A G 12 A U 89 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog26 hydrog ? ? A A 13 N1 ? ? ? 1_555 A U 87 N3 ? ? A A 13 A U 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 13 N6 ? ? ? 1_555 A U 87 O4 ? ? A A 13 A U 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 86 N1 ? ? A U 14 A A 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 86 N6 ? ? A U 14 A A 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 15 N3 ? ? ? 1_555 A A 85 N1 ? ? A U 15 A A 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 15 O4 ? ? ? 1_555 A A 85 N6 ? ? A U 15 A A 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A U 16 N3 ? ? ? 1_555 A A 84 N1 ? ? A U 16 A A 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A U 16 O4 ? ? ? 1_555 A A 84 N6 ? ? A U 16 A A 85 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 49 N2 ? ? A C 24 A G 49 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog35 hydrog ? ? A C 25 N3 ? ? ? 1_555 A G 48 N1 ? ? A C 25 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 25 N4 ? ? ? 1_555 A G 48 O6 ? ? A C 25 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 25 O2 ? ? ? 1_555 A G 48 N2 ? ? A C 25 A G 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 26 N3 ? ? ? 1_555 A G 47 N1 ? ? A C 26 A G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 26 N4 ? ? ? 1_555 A G 47 O6 ? ? A C 26 A G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 26 O2 ? ? ? 1_555 A G 47 N2 ? ? A C 26 A G 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 46 N3 ? ? A G 27 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 46 O2 ? ? A G 27 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 46 N4 ? ? A G 27 A C 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 28 N1 ? ? ? 1_555 A C 45 N3 ? ? A G 28 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 45 O2 ? ? A G 28 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 28 O6 ? ? ? 1_555 A C 45 N4 ? ? A G 28 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 29 N3 ? ? ? 1_555 A G 44 N1 ? ? A C 29 A G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 29 N4 ? ? ? 1_555 A G 44 O6 ? ? A C 29 A G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 29 O2 ? ? ? 1_555 A G 44 N2 ? ? A C 29 A G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 30 N1 ? ? ? 1_555 A U 43 O2 ? ? A G 30 A U 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog51 hydrog ? ? A G 30 O6 ? ? ? 1_555 A U 43 N3 ? ? A G 30 A U 43 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog52 hydrog ? ? A U 31 N3 ? ? ? 1_555 A A 42 N1 ? ? A U 31 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A U 31 O4 ? ? ? 1_555 A A 42 N6 ? ? A U 31 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 32 N1 ? ? ? 1_555 A C 41 N3 ? ? A G 32 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 32 N2 ? ? ? 1_555 A C 41 O2 ? ? A G 32 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 32 O6 ? ? ? 1_555 A C 41 N4 ? ? A G 32 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A U 33 O4 ? ? ? 1_555 A C 40 N4 ? ? A U 33 A C 40 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog58 hydrog ? ? A A 53 N6 ? ? ? 1_555 A C 83 N3 ? ? A A 53 A C 83 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog59 hydrog ? ? A A 54 N1 ? ? ? 1_555 A U 82 N3 ? ? A A 54 A U 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A A 54 N6 ? ? ? 1_555 A U 82 O4 ? ? A A 54 A U 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A C 55 N3 ? ? ? 1_555 A G 81 N1 ? ? A C 55 A G 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A C 55 N4 ? ? ? 1_555 A G 81 O6 ? ? A C 55 A G 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A C 55 O2 ? ? ? 1_555 A G 81 N2 ? ? A C 55 A G 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A C 56 N3 ? ? ? 1_555 A G 80 N1 ? ? A C 56 A G 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A C 56 N4 ? ? ? 1_555 A G 80 O6 ? ? A C 56 A G 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A C 56 O2 ? ? ? 1_555 A G 80 N2 ? ? A C 56 A G 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A C 57 N3 ? ? ? 1_555 A G 78 N1 ? ? A C 57 A G 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A C 57 N4 ? ? ? 1_555 A G 78 O6 ? ? A C 57 A G 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A C 57 O2 ? ? ? 1_555 A G 78 N2 ? ? A C 57 A G 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A A 58 N1 ? ? ? 1_555 A U 77 N3 ? ? A A 58 A U 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A A 58 N6 ? ? ? 1_555 A U 77 O4 ? ? A A 58 A U 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A U 59 N3 ? ? ? 1_555 A G 76 O6 ? ? A U 59 A G 76 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog73 hydrog ? ? A U 59 O2 ? ? ? 1_555 A G 76 N1 ? ? A U 59 A G 76 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog74 hydrog ? ? A A 60 N1 ? ? ? 1_555 A U 75 N3 ? ? A A 60 A U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A A 60 N6 ? ? ? 1_555 A U 75 O4 ? ? A A 60 A U 75 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A G 61 N1 ? ? ? 1_555 A C 74 N3 ? ? A G 61 A C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A G 61 N2 ? ? ? 1_555 A C 74 O2 ? ? A G 61 A C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A G 61 O6 ? ? ? 1_555 A C 74 N4 ? ? A G 61 A C 74 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A G 62 N1 ? ? ? 1_555 A C 73 N3 ? ? A G 62 A C 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A G 62 N2 ? ? ? 1_555 A C 73 O2 ? ? A G 62 A C 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A G 62 O6 ? ? ? 1_555 A C 73 N4 ? ? A G 62 A C 73 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A G 63 N1 ? ? ? 1_555 A C 72 N3 ? ? A G 63 A C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A G 63 N2 ? ? ? 1_555 A C 72 O2 ? ? A G 63 A C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A G 63 O6 ? ? ? 1_555 A C 72 N4 ? ? A G 63 A C 72 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _pdbx_entry_details.entry_id 8VPV _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification ? # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 1 _pdbx_validate_close_contact.auth_atom_id_1 "HO2'" _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 U _pdbx_validate_close_contact.auth_seq_id_1 65 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 OP2 _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 G _pdbx_validate_close_contact.auth_seq_id_2 67 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 1.59 # loop_ _pdbx_validate_symm_contact.id _pdbx_validate_symm_contact.PDB_model_num _pdbx_validate_symm_contact.auth_atom_id_1 _pdbx_validate_symm_contact.auth_asym_id_1 _pdbx_validate_symm_contact.auth_comp_id_1 _pdbx_validate_symm_contact.auth_seq_id_1 _pdbx_validate_symm_contact.PDB_ins_code_1 _pdbx_validate_symm_contact.label_alt_id_1 _pdbx_validate_symm_contact.site_symmetry_1 _pdbx_validate_symm_contact.auth_atom_id_2 _pdbx_validate_symm_contact.auth_asym_id_2 _pdbx_validate_symm_contact.auth_comp_id_2 _pdbx_validate_symm_contact.auth_seq_id_2 _pdbx_validate_symm_contact.PDB_ins_code_2 _pdbx_validate_symm_contact.label_alt_id_2 _pdbx_validate_symm_contact.site_symmetry_2 _pdbx_validate_symm_contact.dist 1 1 "O2'" A C 46 ? ? 1_555 "O2'" A G 99 ? ? 5_565 1.92 2 1 "O2'" A G 63 ? ? 1_555 OP2 A U 92 ? ? 7_555 2.06 3 1 "O2'" A A 6 ? ? 1_555 "O2'" A C 21 ? ? 12_555 2.09 # _pdbx_struct_mod_residue.id 1 _pdbx_struct_mod_residue.label_asym_id A _pdbx_struct_mod_residue.label_comp_id GTP _pdbx_struct_mod_residue.label_seq_id 1 _pdbx_struct_mod_residue.auth_asym_id A _pdbx_struct_mod_residue.auth_comp_id GTP _pdbx_struct_mod_residue.auth_seq_id 1 _pdbx_struct_mod_residue.PDB_ins_code ? _pdbx_struct_mod_residue.parent_comp_id G _pdbx_struct_mod_residue.details 'modified residue' # loop_ _pdbx_refine_tls.id _pdbx_refine_tls.pdbx_refine_id _pdbx_refine_tls.details _pdbx_refine_tls.method _pdbx_refine_tls.origin_x _pdbx_refine_tls.origin_y _pdbx_refine_tls.origin_z _pdbx_refine_tls.T[1][1] _pdbx_refine_tls.T[1][1]_esd _pdbx_refine_tls.T[1][2] _pdbx_refine_tls.T[1][2]_esd _pdbx_refine_tls.T[1][3] _pdbx_refine_tls.T[1][3]_esd _pdbx_refine_tls.T[2][2] _pdbx_refine_tls.T[2][2]_esd _pdbx_refine_tls.T[2][3] _pdbx_refine_tls.T[2][3]_esd _pdbx_refine_tls.T[3][3] _pdbx_refine_tls.T[3][3]_esd _pdbx_refine_tls.L[1][1] _pdbx_refine_tls.L[1][1]_esd _pdbx_refine_tls.L[1][2] _pdbx_refine_tls.L[1][2]_esd _pdbx_refine_tls.L[1][3] _pdbx_refine_tls.L[1][3]_esd _pdbx_refine_tls.L[2][2] _pdbx_refine_tls.L[2][2]_esd _pdbx_refine_tls.L[2][3] _pdbx_refine_tls.L[2][3]_esd _pdbx_refine_tls.L[3][3] _pdbx_refine_tls.L[3][3]_esd _pdbx_refine_tls.S[1][1] _pdbx_refine_tls.S[1][1]_esd _pdbx_refine_tls.S[1][2] _pdbx_refine_tls.S[1][2]_esd _pdbx_refine_tls.S[1][3] _pdbx_refine_tls.S[1][3]_esd _pdbx_refine_tls.S[2][1] _pdbx_refine_tls.S[2][1]_esd _pdbx_refine_tls.S[2][2] _pdbx_refine_tls.S[2][2]_esd _pdbx_refine_tls.S[2][3] _pdbx_refine_tls.S[2][3]_esd _pdbx_refine_tls.S[3][1] _pdbx_refine_tls.S[3][1]_esd _pdbx_refine_tls.S[3][2] _pdbx_refine_tls.S[3][2]_esd _pdbx_refine_tls.S[3][3] _pdbx_refine_tls.S[3][3]_esd 1 'X-RAY DIFFRACTION' ? refined 38.6947 31.9447 112.7623 2.0638 ? 0.3849 ? -0.1739 ? 1.2620 ? -0.0408 ? 0.8274 ? 3.7857 ? 0.1212 ? 1.8821 ? 3.0321 ? -3.0485 ? 4.1483 ? -0.3959 ? 0.7860 ? -0.3235 ? -1.6032 ? 0.7543 ? -0.2266 ? -1.2033 ? 1.4671 ? 1.0304 ? 2 'X-RAY DIFFRACTION' ? refined 37.0323 33.3130 111.9950 1.3739 ? 0.4547 ? -0.0247 ? 1.3306 ? -0.0744 ? 0.7497 ? 4.3842 ? 2.5628 ? -0.5472 ? 4.2084 ? -3.2955 ? 7.0461 ? -0.1964 ? 0.9607 ? 0.4948 ? -0.1449 ? 0.3635 ? 0.5852 ? -0.7938 ? 0.3294 ? 0.1924 ? 3 'X-RAY DIFFRACTION' ? refined 28.8119 33.2027 139.9806 2.3147 ? 0.6770 ? -0.0924 ? 2.6986 ? -0.4342 ? 0.9253 ? 1.9124 ? -0.0155 ? -0.3649 ? 8.9370 ? -7.0009 ? 5.5867 ? -0.6543 ? -0.3980 ? 0.6882 ? 1.9880 ? 2.5770 ? 0.8063 ? -2.3711 ? -3.7629 ? 8.1163 ? 4 'X-RAY DIFFRACTION' ? refined 28.6945 27.9799 158.1315 3.1045 ? 0.4315 ? 0.0102 ? 3.8343 ? 0.0323 ? 2.1715 ? 3.1350 ? 2.8045 ? -0.3254 ? 4.2847 ? -3.9885 ? 7.7599 ? 1.1388 ? 0.5783 ? 0.3833 ? 4.1286 ? 0.6123 ? -1.4793 ? 1.5497 ? -0.9009 ? -1.0883 ? 5 'X-RAY DIFFRACTION' ? refined 32.4007 27.0478 143.6616 1.5836 ? 0.4460 ? -0.0291 ? 1.4201 ? 0.1256 ? 1.0509 ? 3.0206 ? -2.7979 ? -0.0861 ? 7.7846 ? -4.3708 ? 3.8100 ? -1.9414 ? -1.9172 ? 0.8349 ? -0.1192 ? 0.3391 ? -1.6957 ? 0.5408 ? 0.2779 ? 1.3410 ? 6 'X-RAY DIFFRACTION' ? refined 24.7077 35.4073 128.0716 1.9923 ? 0.5169 ? -0.1476 ? 2.6987 ? -0.1860 ? 0.8579 ? 0.0450 ? 0.6687 ? 0.2030 ? 8.9347 ? 2.6983 ? 0.8171 ? 0.0976 ? -0.1485 ? 0.1891 ? 3.6902 ? -1.1724 ? -0.5300 ? 1.0938 ? -0.7702 ? 0.0627 ? 7 'X-RAY DIFFRACTION' ? refined 19.3015 39.3724 106.3297 1.6184 ? 0.3330 ? 0.4895 ? 2.5196 ? 0.0734 ? 0.5630 ? 0.0096 ? 0.0312 ? -0.0779 ? 0.1056 ? -0.2695 ? 0.6532 ? -0.0314 ? 0.3372 ? -0.1883 ? -0.2537 ? 0.0680 ? 0.1104 ? 0.0733 ? -0.4497 ? 0.7336 ? 8 'X-RAY DIFFRACTION' ? refined 7.7250 51.8087 109.7230 1.4126 ? 0.0377 ? -0.0807 ? 1.1205 ? -0.1307 ? 0.4262 ? 2.9609 ? -0.0836 ? 0.5783 ? 1.5179 ? 3.0504 ? 6.3167 ? -0.4974 ? -0.3608 ? 0.6614 ? -0.9905 ? -0.0539 ? 0.0318 ? -2.0290 ? 0.0583 ? -0.4634 ? 9 'X-RAY DIFFRACTION' ? refined 0.2278 59.2637 101.9735 2.9282 ? 0.1979 ? 0.1360 ? 1.5820 ? -0.1466 ? 0.0188 ? 0.6745 ? 0.0199 ? -0.1244 ? 0.2734 ? -0.3864 ? 2.3815 ? 0.2890 ? 0.3054 ? 0.3839 ? 0.2202 ? 0.1453 ? -0.2306 ? -1.1840 ? -0.2464 ? 0.4193 ? 10 'X-RAY DIFFRACTION' ? refined 14.6551 47.4000 111.6901 1.9807 ? 0.4468 ? 0.2585 ? 1.8938 ? -0.2658 ? -0.1598 ? 2.5287 ? -1.1896 ? -1.0241 ? 2.0731 ? 1.4307 ? 4.0680 ? -0.3692 ? 0.1920 ? -0.4105 ? 0.0680 ? 0.6426 ? -0.1149 ? 0.4282 ? 0.2038 ? 2.1562 ? 11 'X-RAY DIFFRACTION' ? refined 14.0779 31.9943 109.7817 2.6436 ? 0.0073 ? -0.7299 ? 2.0414 ? 0.7168 ? 1.6586 ? 4.6901 ? 6.7113 ? -3.2322 ? 9.6159 ? -4.9636 ? 9.4305 ? -2.9573 ? -2.3882 ? -1.1743 ? -1.9070 ? 2.8110 ? 1.5808 ? 1.9896 ? -1.0819 ? -0.0175 ? 12 'X-RAY DIFFRACTION' ? refined 42.1390 38.1613 97.1426 2.0913 ? 0.3643 ? 0.1990 ? 1.7161 ? 0.1027 ? 0.8696 ? 7.5499 ? -0.3296 ? -2.4696 ? 6.4037 ? 2.7876 ? 2.8139 ? -0.2561 ? -0.4143 ? 1.6153 ? -1.6038 ? 0.7564 ? 0.2161 ? -2.6085 ? -0.0852 ? -0.4827 ? 13 'X-RAY DIFFRACTION' ? refined 63.7774 25.8668 93.7691 2.4208 ? -0.5314 ? 0.4240 ? 3.3995 ? 0.2681 ? 0.8506 ? 0.4139 ? -0.1782 ? -0.9629 ? 3.1513 ? -2.2196 ? 4.1294 ? -0.7664 ? 0.4161 ? -0.3957 ? -1.4055 ? -0.8129 ? -0.9547 ? 1.6326 ? 2.5422 ? -0.1502 ? # loop_ _pdbx_refine_tls_group.id _pdbx_refine_tls_group.pdbx_refine_id _pdbx_refine_tls_group.refine_tls_id _pdbx_refine_tls_group.beg_label_asym_id _pdbx_refine_tls_group.beg_label_seq_id _pdbx_refine_tls_group.beg_auth_asym_id _pdbx_refine_tls_group.beg_auth_seq_id _pdbx_refine_tls_group.beg_PDB_ins_code _pdbx_refine_tls_group.end_label_asym_id _pdbx_refine_tls_group.end_label_seq_id _pdbx_refine_tls_group.end_auth_asym_id _pdbx_refine_tls_group.end_auth_seq_id _pdbx_refine_tls_group.end_PDB_ins_code _pdbx_refine_tls_group.selection _pdbx_refine_tls_group.selection_details 1 'X-RAY DIFFRACTION' 1 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 2 through 10 ) ; 2 'X-RAY DIFFRACTION' 2 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 11 through 22 ) ; 3 'X-RAY DIFFRACTION' 3 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 23 through 30 ) ; 4 'X-RAY DIFFRACTION' 4 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 31 through 40 ) ; 5 'X-RAY DIFFRACTION' 5 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 41 through 46 ) ; 6 'X-RAY DIFFRACTION' 6 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 47 through 51 ) ; 7 'X-RAY DIFFRACTION' 7 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 52 through 56 ) ; 8 'X-RAY DIFFRACTION' 8 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 57 through 63 ) ; 9 'X-RAY DIFFRACTION' 9 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 64 through 72 ) ; 10 'X-RAY DIFFRACTION' 10 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 73 through 79 ) ; 11 'X-RAY DIFFRACTION' 11 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 80 through 83 ) ; 12 'X-RAY DIFFRACTION' 12 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 85 through 94 ) ; 13 'X-RAY DIFFRACTION' 13 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 95 through 101 ) ; # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GTP PG P N N 111 GTP O1G O N N 112 GTP O2G O N N 113 GTP O3G O N N 114 GTP O3B O N N 115 GTP PB P N N 116 GTP O1B O N N 117 GTP O2B O N N 118 GTP O3A O N N 119 GTP PA P N N 120 GTP O1A O N N 121 GTP O2A O N N 122 GTP "O5'" O N N 123 GTP "C5'" C N N 124 GTP "C4'" C N R 125 GTP "O4'" O N N 126 GTP "C3'" C N S 127 GTP "O3'" O N N 128 GTP "C2'" C N R 129 GTP "O2'" O N N 130 GTP "C1'" C N R 131 GTP N9 N Y N 132 GTP C8 C Y N 133 GTP N7 N Y N 134 GTP C5 C Y N 135 GTP C6 C N N 136 GTP O6 O N N 137 GTP N1 N N N 138 GTP C2 C N N 139 GTP N2 N N N 140 GTP N3 N N N 141 GTP C4 C Y N 142 GTP HOG2 H N N 143 GTP HOG3 H N N 144 GTP HOB2 H N N 145 GTP HOA2 H N N 146 GTP "H5'" H N N 147 GTP "H5''" H N N 148 GTP "H4'" H N N 149 GTP "H3'" H N N 150 GTP "HO3'" H N N 151 GTP "H2'" H N N 152 GTP "HO2'" H N N 153 GTP "H1'" H N N 154 GTP H8 H N N 155 GTP HN1 H N N 156 GTP HN21 H N N 157 GTP HN22 H N N 158 HOH O O N N 159 HOH H1 H N N 160 HOH H2 H N N 161 PRF N1 N N N 162 PRF C2 C N N 163 PRF N3 N N N 164 PRF C4 C Y N 165 PRF C5 C Y N 166 PRF C6 C N N 167 PRF O6 O N N 168 PRF C7 C Y N 169 PRF C10 C N N 170 PRF N11 N N N 171 PRF C8 C Y N 172 PRF N9 N Y N 173 PRF N2 N N N 174 PRF H91 H N N 175 PRF H101 H N N 176 PRF H102 H N N 177 PRF H111 H N N 178 PRF H112 H N N 179 PRF H81 H N N 180 PRF HN91 H N N 181 PRF HN21 H N N 182 PRF HN22 H N N 183 U OP3 O N N 184 U P P N N 185 U OP1 O N N 186 U OP2 O N N 187 U "O5'" O N N 188 U "C5'" C N N 189 U "C4'" C N R 190 U "O4'" O N N 191 U "C3'" C N S 192 U "O3'" O N N 193 U "C2'" C N R 194 U "O2'" O N N 195 U "C1'" C N R 196 U N1 N N N 197 U C2 C N N 198 U O2 O N N 199 U N3 N N N 200 U C4 C N N 201 U O4 O N N 202 U C5 C N N 203 U C6 C N N 204 U HOP3 H N N 205 U HOP2 H N N 206 U "H5'" H N N 207 U "H5''" H N N 208 U "H4'" H N N 209 U "H3'" H N N 210 U "HO3'" H N N 211 U "H2'" H N N 212 U "HO2'" H N N 213 U "H1'" H N N 214 U H3 H N N 215 U H5 H N N 216 U H6 H N N 217 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GTP PG O1G doub N N 116 GTP PG O2G sing N N 117 GTP PG O3G sing N N 118 GTP PG O3B sing N N 119 GTP O2G HOG2 sing N N 120 GTP O3G HOG3 sing N N 121 GTP O3B PB sing N N 122 GTP PB O1B doub N N 123 GTP PB O2B sing N N 124 GTP PB O3A sing N N 125 GTP O2B HOB2 sing N N 126 GTP O3A PA sing N N 127 GTP PA O1A doub N N 128 GTP PA O2A sing N N 129 GTP PA "O5'" sing N N 130 GTP O2A HOA2 sing N N 131 GTP "O5'" "C5'" sing N N 132 GTP "C5'" "C4'" sing N N 133 GTP "C5'" "H5'" sing N N 134 GTP "C5'" "H5''" sing N N 135 GTP "C4'" "O4'" sing N N 136 GTP "C4'" "C3'" sing N N 137 GTP "C4'" "H4'" sing N N 138 GTP "O4'" "C1'" sing N N 139 GTP "C3'" "O3'" sing N N 140 GTP "C3'" "C2'" sing N N 141 GTP "C3'" "H3'" sing N N 142 GTP "O3'" "HO3'" sing N N 143 GTP "C2'" "O2'" sing N N 144 GTP "C2'" "C1'" sing N N 145 GTP "C2'" "H2'" sing N N 146 GTP "O2'" "HO2'" sing N N 147 GTP "C1'" N9 sing N N 148 GTP "C1'" "H1'" sing N N 149 GTP N9 C8 sing Y N 150 GTP N9 C4 sing Y N 151 GTP C8 N7 doub Y N 152 GTP C8 H8 sing N N 153 GTP N7 C5 sing Y N 154 GTP C5 C6 sing N N 155 GTP C5 C4 doub Y N 156 GTP C6 O6 doub N N 157 GTP C6 N1 sing N N 158 GTP N1 C2 sing N N 159 GTP N1 HN1 sing N N 160 GTP C2 N2 sing N N 161 GTP C2 N3 doub N N 162 GTP N2 HN21 sing N N 163 GTP N2 HN22 sing N N 164 GTP N3 C4 sing N N 165 HOH O H1 sing N N 166 HOH O H2 sing N N 167 PRF N1 C2 sing N N 168 PRF N1 C6 sing N N 169 PRF N1 H91 sing N N 170 PRF C2 N3 doub N N 171 PRF C2 N2 sing N N 172 PRF N3 C4 sing N N 173 PRF C4 C5 doub Y N 174 PRF C4 N9 sing Y N 175 PRF C5 C6 sing N N 176 PRF C5 C7 sing Y N 177 PRF C6 O6 doub N N 178 PRF C7 C10 sing N N 179 PRF C7 C8 doub Y N 180 PRF C10 N11 sing N N 181 PRF C10 H101 sing N N 182 PRF C10 H102 sing N N 183 PRF N11 H111 sing N N 184 PRF N11 H112 sing N N 185 PRF C8 N9 sing Y N 186 PRF C8 H81 sing N N 187 PRF N9 HN91 sing N N 188 PRF N2 HN21 sing N N 189 PRF N2 HN22 sing N N 190 U OP3 P sing N N 191 U OP3 HOP3 sing N N 192 U P OP1 doub N N 193 U P OP2 sing N N 194 U P "O5'" sing N N 195 U OP2 HOP2 sing N N 196 U "O5'" "C5'" sing N N 197 U "C5'" "C4'" sing N N 198 U "C5'" "H5'" sing N N 199 U "C5'" "H5''" sing N N 200 U "C4'" "O4'" sing N N 201 U "C4'" "C3'" sing N N 202 U "C4'" "H4'" sing N N 203 U "O4'" "C1'" sing N N 204 U "C3'" "O3'" sing N N 205 U "C3'" "C2'" sing N N 206 U "C3'" "H3'" sing N N 207 U "O3'" "HO3'" sing N N 208 U "C2'" "O2'" sing N N 209 U "C2'" "C1'" sing N N 210 U "C2'" "H2'" sing N N 211 U "O2'" "HO2'" sing N N 212 U "C1'" N1 sing N N 213 U "C1'" "H1'" sing N N 214 U N1 C2 sing N N 215 U N1 C6 sing N N 216 U C2 O2 doub N N 217 U C2 N3 sing N N 218 U N3 C4 sing N N 219 U N3 H3 sing N N 220 U C4 O4 doub N N 221 U C4 C5 sing N N 222 U C5 C6 doub N N 223 U C5 H5 sing N N 224 U C6 H6 sing N N 225 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8VPV 'double helix' 8VPV 'a-form double helix' 8VPV 'hairpin loop' 8VPV 'bulge loop' 8VPV 'mismatched base pair' 8VPV 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A A 18 1_555 A A 6 1_555 -2.905 1.827 -0.333 10.379 -5.115 -35.940 1 A_A18:A6_A A 18 ? A 6 ? ? ? 1 A G 19 1_555 A A 5 1_555 0.346 1.741 -0.118 7.631 -6.053 -21.437 2 A_G19:A5_A A 19 ? A 5 ? 8 1 1 A G 20 1_555 A C 4 1_555 0.591 0.056 0.416 5.420 -13.052 -6.499 3 A_G20:C4_A A 20 ? A 4 ? 19 1 1 A C 21 1_555 A G 3 1_555 0.095 -0.312 0.170 10.532 -18.257 -9.126 4 A_C21:G3_A A 21 ? A 3 ? 19 1 1 A U 22 1_555 A A 2 1_555 -1.192 -0.225 -0.080 -2.818 -17.312 -11.081 5 A_U22:A2_A A 22 ? A 2 ? 20 1 1 A C 23 1_555 A GTP 1 1_555 -0.105 0.015 -0.154 3.880 -0.963 -0.505 6 A_C23:GTP1_A A 23 ? A 1 ? 19 1 1 A C 24 1_555 A G 49 1_555 -0.222 0.524 0.366 2.391 -7.203 11.035 7 A_C24:G49_A A 24 ? A 49 ? ? 1 1 A C 25 1_555 A G 48 1_555 -0.157 0.000 0.181 9.706 -11.169 8.287 8 A_C25:G48_A A 25 ? A 48 ? 19 1 1 A C 26 1_555 A G 47 1_555 -0.138 -0.182 -0.238 7.309 -11.739 -4.550 9 A_C26:G47_A A 26 ? A 47 ? 19 1 1 A G 27 1_555 A C 46 1_555 -0.051 0.002 0.246 5.374 -1.768 -1.740 10 A_G27:C46_A A 27 ? A 46 ? 19 1 1 A G 28 1_555 A C 45 1_555 0.354 -0.156 -0.047 -11.005 -26.255 -2.436 11 A_G28:C45_A A 28 ? A 45 ? 19 1 1 A C 29 1_555 A G 44 1_555 -0.378 0.275 0.071 3.447 -21.101 1.044 12 A_C29:G44_A A 29 ? A 44 ? 19 1 1 A G 30 1_555 A U 43 1_555 -2.338 -0.567 -0.123 -0.139 -24.084 -10.879 13 A_G30:U43_A A 30 ? A 43 ? 28 1 1 A U 31 1_555 A A 42 1_555 -0.292 -0.020 0.087 9.867 -8.635 8.147 14 A_U31:A42_A A 31 ? A 42 ? 20 1 1 A G 32 1_555 A C 41 1_555 0.169 0.475 -0.417 -12.457 -11.544 4.063 15 A_G32:C41_A A 32 ? A 41 ? 19 1 1 A U 33 1_555 A C 40 1_555 -1.836 -0.302 -1.010 16.157 -8.811 -34.976 16 A_U33:C40_A A 33 ? A 40 ? ? ? 1 A G 11 1_555 A C 89 1_555 0.965 0.435 0.172 7.743 6.563 -9.777 17 A_G11:C90_A A 11 ? A 90 ? 19 1 1 A G 12 1_555 A U 88 1_555 -1.606 -0.110 0.214 5.155 -18.782 0.689 18 A_G12:U89_A A 12 ? A 89 ? 28 1 1 A A 13 1_555 A U 87 1_555 0.746 0.155 -0.162 1.116 -17.894 1.393 19 A_A13:U88_A A 13 ? A 88 ? 20 1 1 A U 14 1_555 A A 86 1_555 0.023 -0.074 -0.338 11.043 -10.285 -0.924 20 A_U14:A87_A A 14 ? A 87 ? 20 1 1 A U 15 1_555 A A 85 1_555 -0.009 0.289 -0.389 8.069 -1.806 8.989 21 A_U15:A86_A A 15 ? A 86 ? 20 1 1 A U 16 1_555 A A 84 1_555 -0.312 0.102 -0.334 6.449 8.473 14.606 22 A_U16:A85_A A 16 ? A 85 ? 20 1 1 A A 53 1_555 A C 83 1_555 -2.577 -0.427 -0.647 -23.085 -14.879 8.289 23 A_A53:C83_A A 53 ? A 83 ? ? 1 1 A A 54 1_555 A U 82 1_555 -0.100 -0.019 -0.100 -10.833 -7.711 8.869 24 A_A54:U82_A A 54 ? A 82 ? 20 1 1 A C 55 1_555 A G 81 1_555 0.267 0.037 -0.100 9.907 -16.294 5.726 25 A_C55:G81_A A 55 ? A 81 ? 19 1 1 A C 56 1_555 A G 80 1_555 0.544 -0.209 -0.020 -1.596 -0.441 4.952 26 A_C56:G80_A A 56 ? A 80 ? 19 1 1 A C 57 1_555 A G 78 1_555 -0.632 0.407 -0.620 19.748 -19.388 9.748 27 A_C57:G78_A A 57 ? A 78 ? 19 1 1 A A 58 1_555 A U 77 1_555 -0.229 0.255 0.081 -6.068 -12.073 12.779 28 A_A58:U77_A A 58 ? A 77 ? 20 1 1 A U 59 1_555 A G 76 1_555 1.767 -0.179 -0.089 -0.425 -12.032 5.335 29 A_U59:G76_A A 59 ? A 76 ? 28 1 1 A A 60 1_555 A U 75 1_555 -0.270 -0.268 -0.419 -3.204 -1.162 5.224 30 A_A60:U75_A A 60 ? A 75 ? 20 1 1 A G 61 1_555 A C 74 1_555 0.088 -0.090 -0.610 -5.142 -10.044 1.654 31 A_G61:C74_A A 61 ? A 74 ? 19 1 1 A G 62 1_555 A C 73 1_555 0.643 0.231 -1.265 -30.725 -20.535 1.947 32 A_G62:C73_A A 62 ? A 73 ? 19 1 1 A G 63 1_555 A C 72 1_555 0.638 0.320 -0.596 -16.478 -4.814 0.902 33 A_G63:C72_A A 63 ? A 72 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A A 18 1_555 A A 6 1_555 A G 19 1_555 A A 5 1_555 0.807 -1.733 3.416 -3.417 5.270 40.385 -3.063 -1.532 3.100 7.578 4.913 40.850 1 AA_A18G19:A5A6_AA A 18 ? A 6 ? A 19 ? A 5 ? 1 A G 19 1_555 A A 5 1_555 A G 20 1_555 A C 4 1_555 0.647 -1.811 3.191 -5.579 7.405 32.990 -4.129 -1.893 2.595 12.730 9.591 34.233 2 AA_G19G20:C4A5_AA A 19 ? A 5 ? A 20 ? A 4 ? 1 A G 20 1_555 A C 4 1_555 A C 21 1_555 A G 3 1_555 0.218 -1.799 3.064 1.406 0.113 33.388 -3.147 -0.161 3.065 0.196 -2.445 33.417 3 AA_G20C21:G3C4_AA A 20 ? A 4 ? A 21 ? A 3 ? 1 A C 21 1_555 A G 3 1_555 A U 22 1_555 A A 2 1_555 -0.148 -3.628 3.512 0.971 7.044 18.342 -13.580 0.840 1.982 21.099 -2.909 19.661 4 AA_C21U22:A2G3_AA A 21 ? A 3 ? A 22 ? A 2 ? 1 A U 22 1_555 A A 2 1_555 A C 23 1_555 A GTP 1 1_555 2.163 -1.701 3.153 2.928 -1.162 37.885 -2.465 -2.950 3.354 -1.786 -4.501 38.011 5 AA_U22C23:GTP1A2_AA A 22 ? A 2 ? A 23 ? A 1 ? 1 A C 23 1_555 A GTP 1 1_555 A C 24 1_555 A G 49 1_555 1.391 -1.876 3.077 -2.466 7.958 35.681 -3.934 -2.508 2.516 12.774 3.958 36.610 6 AA_C23C24:G49GTP1_AA A 23 ? A 1 ? A 24 ? A 49 ? 1 A C 24 1_555 A G 49 1_555 A C 25 1_555 A G 48 1_555 -0.005 -1.620 2.982 -1.912 3.402 32.194 -3.432 -0.288 2.796 6.106 3.433 32.423 7 AA_C24C25:G48G49_AA A 24 ? A 49 ? A 25 ? A 48 ? 1 A C 25 1_555 A G 48 1_555 A C 26 1_555 A G 47 1_555 -0.845 -1.636 3.213 1.441 7.170 33.805 -3.780 1.629 2.781 12.154 -2.443 34.564 8 AA_C25C26:G47G48_AA A 25 ? A 48 ? A 26 ? A 47 ? 1 A C 26 1_555 A G 47 1_555 A G 27 1_555 A C 46 1_555 -0.144 -1.709 3.258 -4.167 10.670 29.560 -4.932 -0.439 2.503 19.992 7.807 31.655 9 AA_C26G27:C46G47_AA A 26 ? A 47 ? A 27 ? A 46 ? 1 A G 27 1_555 A C 46 1_555 A G 28 1_555 A C 45 1_555 0.512 -2.391 3.699 6.856 9.358 32.519 -5.561 0.254 2.963 16.087 -11.785 34.474 10 AA_G27G28:C45C46_AA A 27 ? A 46 ? A 28 ? A 45 ? 1 A G 28 1_555 A C 45 1_555 A C 29 1_555 A G 44 1_555 -0.372 -1.674 2.818 -3.518 -1.212 30.109 -2.985 0.088 2.905 -2.322 6.740 30.332 11 AA_G28C29:G44C45_AA A 28 ? A 45 ? A 29 ? A 44 ? 1 A C 29 1_555 A G 44 1_555 A G 30 1_555 A U 43 1_555 -0.502 -2.086 3.152 0.039 16.863 26.443 -6.376 0.938 1.569 32.947 -0.077 31.281 12 AA_C29G30:U43G44_AA A 29 ? A 44 ? A 30 ? A 43 ? 1 A G 30 1_555 A U 43 1_555 A U 31 1_555 A A 42 1_555 0.919 -0.912 3.106 -4.966 3.485 41.555 -1.608 -1.759 2.900 4.881 6.955 41.976 13 AA_G30U31:A42U43_AA A 30 ? A 43 ? A 31 ? A 42 ? 1 A U 31 1_555 A A 42 1_555 A G 32 1_555 A C 41 1_555 -0.359 -1.905 3.624 5.948 19.487 32.853 -5.195 1.248 2.117 31.022 -9.469 38.510 14 AA_U31G32:C41A42_AA A 31 ? A 42 ? A 32 ? A 41 ? 1 A G 32 1_555 A C 41 1_555 A U 33 1_555 A C 40 1_555 -2.365 -0.759 2.725 2.183 12.680 16.446 -5.987 7.203 1.449 37.696 -6.490 20.854 15 AA_G32U33:C40C41_AA A 32 ? A 41 ? A 33 ? A 40 ? 1 A G 11 1_555 A C 89 1_555 A G 12 1_555 A U 88 1_555 0.949 -1.972 2.985 -1.669 14.944 27.019 -5.904 -2.030 1.633 29.283 3.270 30.853 16 AA_G11G12:U89C90_AA A 11 ? A 90 ? A 12 ? A 89 ? 1 A G 12 1_555 A U 88 1_555 A A 13 1_555 A U 87 1_555 -0.384 -1.102 3.409 -0.635 5.534 40.693 -2.186 0.477 3.244 7.913 0.908 41.056 17 AA_G12A13:U88U89_AA A 12 ? A 89 ? A 13 ? A 88 ? 1 A A 13 1_555 A U 87 1_555 A U 14 1_555 A A 86 1_555 -0.272 -1.457 2.892 -0.165 5.850 30.800 -3.627 0.478 2.579 10.891 0.308 31.338 18 AA_A13U14:A87U88_AA A 13 ? A 88 ? A 14 ? A 87 ? 1 A U 14 1_555 A A 86 1_555 A U 15 1_555 A A 85 1_555 1.143 -1.749 3.397 -0.667 3.811 30.656 -4.025 -2.276 3.137 7.173 1.255 30.893 19 AA_U14U15:A86A87_AA A 14 ? A 87 ? A 15 ? A 86 ? 1 A U 15 1_555 A A 85 1_555 A U 16 1_555 A A 84 1_555 -0.035 -2.242 3.343 -2.933 1.560 24.814 -5.637 -0.792 3.181 3.609 6.787 25.032 20 AA_U15U16:A85A86_AA A 15 ? A 86 ? A 16 ? A 85 ? 1 A A 53 1_555 A C 83 1_555 A A 54 1_555 A U 82 1_555 0.149 -0.451 3.267 -14.421 16.073 38.150 -2.112 -1.552 2.665 22.528 20.213 43.638 21 AA_A53A54:U82C83_AA A 53 ? A 83 ? A 54 ? A 82 ? 1 A A 54 1_555 A U 82 1_555 A C 55 1_555 A G 81 1_555 -0.343 -1.461 2.887 -3.212 6.491 31.466 -3.603 0.136 2.564 11.774 5.826 32.268 22 AA_A54C55:G81U82_AA A 54 ? A 82 ? A 55 ? A 81 ? 1 A C 55 1_555 A G 81 1_555 A C 56 1_555 A G 80 1_555 0.204 -1.620 3.604 -2.650 9.509 34.701 -4.019 -0.719 3.046 15.557 4.336 36.036 23 AA_C55C56:G80G81_AA A 55 ? A 81 ? A 56 ? A 80 ? 1 A C 56 1_555 A G 80 1_555 A C 57 1_555 A G 78 1_555 1.421 -0.625 2.857 5.060 11.646 30.954 -2.779 -1.738 2.650 20.759 -9.020 33.398 24 AA_C56C57:G78G80_AA A 56 ? A 80 ? A 57 ? A 78 ? 1 A C 57 1_555 A G 78 1_555 A A 58 1_555 A U 77 1_555 0.263 -1.593 3.690 -7.691 17.707 33.086 -4.697 -1.384 2.444 28.297 12.291 38.170 25 AA_C57A58:U77G78_AA A 57 ? A 78 ? A 58 ? A 77 ? 1 A A 58 1_555 A U 77 1_555 A U 59 1_555 A G 76 1_555 -0.575 -1.047 3.103 2.564 6.470 37.830 -2.329 1.166 2.849 9.877 -3.914 38.442 26 AA_A58U59:G76U77_AA A 58 ? A 77 ? A 59 ? A 76 ? 1 A U 59 1_555 A G 76 1_555 A A 60 1_555 A U 75 1_555 -0.187 -1.774 3.248 0.703 12.316 23.093 -6.808 0.578 2.045 28.319 -1.616 26.142 27 AA_U59A60:U75G76_AA A 59 ? A 76 ? A 60 ? A 75 ? 1 A A 60 1_555 A U 75 1_555 A G 61 1_555 A C 74 1_555 0.182 -1.476 3.467 1.154 8.264 30.870 -4.185 -0.120 2.987 15.181 -2.119 31.952 28 AA_A60G61:C74U75_AA A 60 ? A 75 ? A 61 ? A 74 ? 1 A G 61 1_555 A C 74 1_555 A G 62 1_555 A C 73 1_555 0.153 -1.592 4.008 4.453 16.781 36.587 -4.449 0.346 3.024 25.072 -6.654 40.370 29 AA_G61G62:C73C74_AA A 61 ? A 74 ? A 62 ? A 73 ? 1 A G 62 1_555 A C 73 1_555 A G 63 1_555 A C 72 1_555 -0.218 -0.988 2.889 -4.389 9.217 29.337 -3.344 -0.305 2.479 17.542 8.354 31.025 30 AA_G62G63:C72C73_AA A 62 ? A 73 ? A 63 ? A 72 ? # _pdbx_audit_support.funding_organization 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number GM63162-14 _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 4rzd _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 8VPV _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.012094 _atom_sites.fract_transf_matrix[1][2] 0.006983 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.013965 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.003546 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_