data_8VT5 # _entry.id 8VT5 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.395 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8VT5 pdb_00008vt5 10.2210/pdb8vt5/pdb WWPDB D_1000276444 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2024-07-24 2 'Structure model' 1 1 2024-07-31 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_audit_revision_group.ordinal 1 _pdbx_audit_revision_group.revision_ordinal 2 _pdbx_audit_revision_group.data_content_type 'Structure model' _pdbx_audit_revision_group.group 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_CSD' 4 2 'Structure model' '_citation.journal_id_ISSN' 5 2 'Structure model' '_citation.pdbx_database_id_DOI' 6 2 'Structure model' '_citation.pdbx_database_id_PubMed' 7 2 'Structure model' '_citation.title' 8 2 'Structure model' '_citation.year' 9 2 'Structure model' '_citation_author.identifier_ORCID' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8VT5 _pdbx_database_status.recvd_initial_deposition_date 2024-01-25 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email jinwei.zhang@nih.gov _pdbx_contact_author.name_first Jinwei _pdbx_contact_author.name_last Zhang _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-2114-173X # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Skeparnias, I.' 1 ? 'Zhang, J.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Nat.Struct.Mol.Biol. _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 1545-9985 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Structural basis of NEAT1 lncRNA maturation and menRNA instability.' _citation.year 2024 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41594-024-01361-z _citation.pdbx_database_id_PubMed 39026030 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Skeparnias, I.' 1 0000-0003-1188-529X primary 'Zhang, J.' 2 0000-0002-2114-173X # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man menRNA 19597.477 1 ? ? ? ? 2 water nat water 18.015 2 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GTP)GGCGCUGGUGGUGGCACGUCCAGCACGGCUGGGCCGGGGUUCGAGUCCCCGCAGUGUUC' _entity_poly.pdbx_seq_one_letter_code_can GGGCGCUGGUGGUGGCACGUCCAGCACGGCUGGGCCGGGGUUCGAGUCCCCGCAGUGUUC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name water _pdbx_entity_nonpoly.comp_id HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 G n 1 4 C n 1 5 G n 1 6 C n 1 7 U n 1 8 G n 1 9 G n 1 10 U n 1 11 G n 1 12 G n 1 13 U n 1 14 G n 1 15 G n 1 16 C n 1 17 A n 1 18 C n 1 19 G n 1 20 U n 1 21 C n 1 22 C n 1 23 A n 1 24 G n 1 25 C n 1 26 A n 1 27 C n 1 28 G n 1 29 G n 1 30 C n 1 31 U n 1 32 G n 1 33 G n 1 34 G n 1 35 C n 1 36 C n 1 37 G n 1 38 G n 1 39 G n 1 40 G n 1 41 U n 1 42 U n 1 43 C n 1 44 G n 1 45 A n 1 46 G n 1 47 U n 1 48 C n 1 49 C n 1 50 C n 1 51 C n 1 52 G n 1 53 C n 1 54 A n 1 55 G n 1 56 U n 1 57 G n 1 58 U n 1 59 U n 1 60 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 60 _entity_src_gen.gene_src_common_name human _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Homo sapiens' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 9606 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'Escherichia coli' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 562 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 C 4 4 4 C C A . n A 1 5 G 5 5 5 G G A . n A 1 6 C 6 6 6 C C A . n A 1 7 U 7 7 7 U U A . n A 1 8 G 8 8 8 G G A . n A 1 9 G 9 9 9 G G A . n A 1 10 U 10 10 10 U U A . n A 1 11 G 11 11 11 G G A . n A 1 12 G 12 12 12 G G A . n A 1 13 U 13 13 13 U U A . n A 1 14 G 14 14 14 G G A . n A 1 15 G 15 15 15 G G A . n A 1 16 C 16 16 16 C C A . n A 1 17 A 17 17 17 A A A . n A 1 18 C 18 18 18 C C A . n A 1 19 G 19 19 19 G G A . n A 1 20 U 20 20 20 U U A . n A 1 21 C 21 21 21 C C A . n A 1 22 C 22 22 22 C C A . n A 1 23 A 23 23 23 A A A . n A 1 24 G 24 24 24 G G A . n A 1 25 C 25 25 25 C C A . n A 1 26 A 26 26 26 A A A . n A 1 27 C 27 27 27 C C A . n A 1 28 G 28 28 28 G G A . n A 1 29 G 29 29 29 G G A . n A 1 30 C 30 30 30 C C A . n A 1 31 U 31 31 31 U U A . n A 1 32 G 32 32 32 G G A . n A 1 33 G 33 33 33 G G A . n A 1 34 G 34 34 34 G G A . n A 1 35 C 35 35 35 C C A . n A 1 36 C 36 36 36 C C A . n A 1 37 G 37 37 37 G G A . n A 1 38 G 38 38 38 G G A . n A 1 39 G 39 39 39 G G A . n A 1 40 G 40 40 40 G G A . n A 1 41 U 41 41 41 U U A . n A 1 42 U 42 42 42 U U A . n A 1 43 C 43 43 43 C C A . n A 1 44 G 44 44 44 G G A . n A 1 45 A 45 45 45 A A A . n A 1 46 G 46 46 46 G G A . n A 1 47 U 47 47 47 U U A . n A 1 48 C 48 48 48 C C A . n A 1 49 C 49 49 49 C C A . n A 1 50 C 50 50 50 C C A . n A 1 51 C 51 51 51 C C A . n A 1 52 G 52 52 52 G G A . n A 1 53 C 53 53 53 C C A . n A 1 54 A 54 54 54 A A A . n A 1 55 G 55 55 55 G G A . n A 1 56 U 56 56 56 U U A . n A 1 57 G 57 57 57 G G A . n A 1 58 U 58 58 58 U U A . n A 1 59 U 59 59 59 U U A . n A 1 60 C 60 60 60 C C A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 HOH 1 101 6 HOH HOH A . B 2 HOH 2 102 1 HOH HOH A . # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A U 13 ? N1 ? A U 13 N1 2 1 Y 1 A U 13 ? C2 ? A U 13 C2 3 1 Y 1 A U 13 ? O2 ? A U 13 O2 4 1 Y 1 A U 13 ? N3 ? A U 13 N3 5 1 Y 1 A U 13 ? C4 ? A U 13 C4 6 1 Y 1 A U 13 ? O4 ? A U 13 O4 7 1 Y 1 A U 13 ? C5 ? A U 13 C5 8 1 Y 1 A U 13 ? C6 ? A U 13 C6 9 1 Y 1 A A 26 ? N9 ? A A 26 N9 10 1 Y 1 A A 26 ? C8 ? A A 26 C8 11 1 Y 1 A A 26 ? N7 ? A A 26 N7 12 1 Y 1 A A 26 ? C5 ? A A 26 C5 13 1 Y 1 A A 26 ? C6 ? A A 26 C6 14 1 Y 1 A A 26 ? N6 ? A A 26 N6 15 1 Y 1 A A 26 ? N1 ? A A 26 N1 16 1 Y 1 A A 26 ? C2 ? A A 26 C2 17 1 Y 1 A A 26 ? N3 ? A A 26 N3 18 1 Y 1 A A 26 ? C4 ? A A 26 C4 19 1 Y 1 A G 28 ? N9 ? A G 28 N9 20 1 Y 1 A G 28 ? C8 ? A G 28 C8 21 1 Y 1 A G 28 ? N7 ? A G 28 N7 22 1 Y 1 A G 28 ? C5 ? A G 28 C5 23 1 Y 1 A G 28 ? C6 ? A G 28 C6 24 1 Y 1 A G 28 ? O6 ? A G 28 O6 25 1 Y 1 A G 28 ? N1 ? A G 28 N1 26 1 Y 1 A G 28 ? C2 ? A G 28 C2 27 1 Y 1 A G 28 ? N2 ? A G 28 N2 28 1 Y 1 A G 28 ? N3 ? A G 28 N3 29 1 Y 1 A G 28 ? C4 ? A G 28 C4 # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.19.2_4158: ???)' 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? AutoSol ? ? ? . 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 8VT5 _cell.details ? _cell.formula_units_Z ? _cell.length_a 48.779 _cell.length_a_esd ? _cell.length_b 48.779 _cell.length_b_esd ? _cell.length_c 288.169 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 12 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8VT5 _symmetry.cell_setting ? _symmetry.Int_Tables_number 178 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 61 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8VT5 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.53 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 51.29 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.09 M NPS (0.3M Sodium Nitrate, 0.3M Sodium phosphate dibasic, 0.3M Ammonium sulfate), 0.5 M of a mix consisting of 1 M Sodium HEPES and MOPS (pH 7.5), and 30% from a mix consisting of 40% PEG 500 and 20% PEG 20000 ; _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 293 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector CCD _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'RAYONIX MX300-HS' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2022-03-18 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator M _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 22-ID' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 22-ID _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 8VT5 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.69 _reflns.d_resolution_low 48.03 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 6340 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 95.77 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 14.2 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 6.38 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.992 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.69 _reflns_shell.d_res_low 2.787 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 577 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.96 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8VT5 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.69 _refine.ls_d_res_low 48.03 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 6087 _refine.ls_number_reflns_R_free 299 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 95.53 _refine.ls_percent_reflns_R_free 4.92 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2524 _refine.ls_R_factor_R_free 0.2912 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2498 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 32.98 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.26 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.69 _refine_hist.d_res_low 48.03 _refine_hist.number_atoms_solvent 2 _refine_hist.number_atoms_total 1270 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1268 _refine_hist.pdbx_number_atoms_ligand 0 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.006 ? 1412 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.073 ? 2202 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 14.722 ? 725 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.047 ? 298 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.010 ? 58 ? f_plane_restr ? ? # _struct.entry_id 8VT5 _struct.title 'Crystal structure of human menRNA' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8VT5 _struct_keywords.text 'non-coding RNAs, cancer, RNA, menRNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8VT5 _struct_ref.pdbx_db_accession 8VT5 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8VT5 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 60 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 8VT5 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 60 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 60 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? A GTP 1 A G 2 1_555 ? ? ? ? ? ? ? 1.617 ? ? hydrog1 hydrog ? ? A GTP 1 N1 ? ? ? 1_555 A C 60 N3 ? ? A GTP 1 A C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A GTP 1 N2 ? ? ? 1_555 A C 60 O2 ? ? A GTP 1 A C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A GTP 1 O6 ? ? ? 1_555 A C 60 N4 ? ? A GTP 1 A C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A U 59 O2 ? ? A G 2 A U 59 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog5 hydrog ? ? A G 2 O6 ? ? ? 1_555 A U 59 N3 ? ? A G 2 A U 59 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog6 hydrog ? ? A G 3 N1 ? ? ? 1_555 A U 58 O2 ? ? A G 3 A U 58 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog7 hydrog ? ? A G 3 O6 ? ? ? 1_555 A U 58 N3 ? ? A G 3 A U 58 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog8 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 57 N1 ? ? A C 4 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 57 O6 ? ? A C 4 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 57 N2 ? ? A C 4 A G 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 5 N1 ? ? ? 1_555 A U 56 O2 ? ? A G 5 A U 56 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog12 hydrog ? ? A G 5 O6 ? ? ? 1_555 A U 56 N3 ? ? A G 5 A U 56 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog13 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 55 N1 ? ? A C 6 A G 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 55 O6 ? ? A C 6 A G 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 55 N2 ? ? A C 6 A G 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 54 N1 ? ? A U 7 A A 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 54 N6 ? ? A U 7 A A 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 8 N1 ? ? ? 1_555 A C 53 N3 ? ? A G 8 A C 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 53 O2 ? ? A G 8 A C 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 8 O6 ? ? ? 1_555 A C 53 N4 ? ? A G 8 A C 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 18 N3 ? ? A G 9 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 18 O2 ? ? A G 9 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 18 N4 ? ? A G 9 A C 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A U 10 N3 ? ? ? 1_555 A A 17 N1 ? ? A U 10 A A 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A U 10 O4 ? ? ? 1_555 A A 17 N6 ? ? A U 10 A A 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 16 N3 ? ? A G 11 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 16 O2 ? ? A G 11 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 16 N4 ? ? A G 11 A C 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 16 N3 ? ? A G 12 A C 16 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog30 hydrog ? ? A G 12 N2 ? ? ? 1_555 A U 47 O2 ? ? A G 12 A U 47 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog31 hydrog ? ? A G 14 N1 ? ? ? 1_555 A U 42 O2 ? ? A G 14 A U 42 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog32 hydrog ? ? A G 15 N1 ? ? ? 1_555 A C 43 N3 ? ? A G 15 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 15 N2 ? ? ? 1_555 A C 43 O2 ? ? A G 15 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 15 O6 ? ? ? 1_555 A C 43 N4 ? ? A G 15 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 18 N4 ? ? ? 1_555 A G 46 O6 ? ? A C 18 A G 46 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog36 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 35 N3 ? ? A G 19 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 35 O2 ? ? A G 19 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 35 N4 ? ? A G 19 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 20 N3 ? ? ? 1_555 A G 34 O6 ? ? A U 20 A G 34 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog40 hydrog ? ? A U 20 O2 ? ? ? 1_555 A G 34 N1 ? ? A U 20 A G 34 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog41 hydrog ? ? A C 21 N3 ? ? ? 1_555 A G 33 N1 ? ? A C 21 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 21 N4 ? ? ? 1_555 A G 33 O6 ? ? A C 21 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 21 O2 ? ? ? 1_555 A G 33 N2 ? ? A C 21 A G 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 22 N3 ? ? ? 1_555 A G 32 N1 ? ? A C 22 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 22 N4 ? ? ? 1_555 A G 32 O6 ? ? A C 22 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 22 O2 ? ? ? 1_555 A G 32 N2 ? ? A C 22 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A A 23 N1 ? ? ? 1_555 A U 31 N3 ? ? A A 23 A U 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A A 23 N6 ? ? ? 1_555 A U 31 O4 ? ? A A 23 A U 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 24 N1 ? ? ? 1_555 A C 30 N3 ? ? A G 24 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 24 N2 ? ? ? 1_555 A C 30 O2 ? ? A G 24 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 24 O6 ? ? ? 1_555 A C 30 N4 ? ? A G 24 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 25 N3 ? ? ? 1_555 A G 29 N1 ? ? A C 25 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 25 N4 ? ? ? 1_555 A G 29 O6 ? ? A C 25 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 25 O2 ? ? ? 1_555 A G 29 N2 ? ? A C 25 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 35 N4 ? ? ? 1_555 A G 46 O6 ? ? A C 35 A G 46 1_555 ? ? ? ? ? ? 'C-G PAIR' ? ? ? hydrog56 hydrog ? ? A C 36 N3 ? ? ? 1_555 A G 52 N1 ? ? A C 36 A G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 36 N4 ? ? ? 1_555 A G 52 O6 ? ? A C 36 A G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 36 O2 ? ? ? 1_555 A G 52 N2 ? ? A C 36 A G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 37 N1 ? ? ? 1_555 A C 51 N3 ? ? A G 37 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 37 N2 ? ? ? 1_555 A C 51 O2 ? ? A G 37 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 37 O6 ? ? ? 1_555 A C 51 N4 ? ? A G 37 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 38 N1 ? ? ? 1_555 A C 50 N3 ? ? A G 38 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 38 N2 ? ? ? 1_555 A C 50 O2 ? ? A G 38 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 38 O6 ? ? ? 1_555 A C 50 N4 ? ? A G 38 A C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 39 N1 ? ? ? 1_555 A C 49 N3 ? ? A G 39 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 39 N2 ? ? ? 1_555 A C 49 O2 ? ? A G 39 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A G 39 O6 ? ? ? 1_555 A C 49 N4 ? ? A G 39 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A G 40 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 40 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A G 40 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 40 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A G 40 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 40 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A U 41 N3 ? ? ? 1_555 A A 45 N7 ? ? A U 41 A A 45 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog72 hydrog ? ? A U 41 O2 ? ? ? 1_555 A A 45 N6 ? ? A U 41 A A 45 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 1 _pdbx_validate_close_contact.auth_atom_id_1 O _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 HOH _pdbx_validate_close_contact.auth_seq_id_1 101 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 O _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 HOH _pdbx_validate_close_contact.auth_seq_id_2 102 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 2.03 # _pdbx_validate_symm_contact.id 1 _pdbx_validate_symm_contact.PDB_model_num 1 _pdbx_validate_symm_contact.auth_atom_id_1 "O2'" _pdbx_validate_symm_contact.auth_asym_id_1 A _pdbx_validate_symm_contact.auth_comp_id_1 U _pdbx_validate_symm_contact.auth_seq_id_1 31 _pdbx_validate_symm_contact.PDB_ins_code_1 ? _pdbx_validate_symm_contact.label_alt_id_1 ? _pdbx_validate_symm_contact.site_symmetry_1 1_555 _pdbx_validate_symm_contact.auth_atom_id_2 OP1 _pdbx_validate_symm_contact.auth_asym_id_2 A _pdbx_validate_symm_contact.auth_comp_id_2 U _pdbx_validate_symm_contact.auth_seq_id_2 58 _pdbx_validate_symm_contact.PDB_ins_code_2 ? _pdbx_validate_symm_contact.label_alt_id_2 ? _pdbx_validate_symm_contact.site_symmetry_2 8_545 _pdbx_validate_symm_contact.dist 2.03 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 N1 A C 22 ? ? C2 A C 22 ? ? O2 A C 22 ? ? 114.56 118.90 -4.34 0.60 N 2 1 N3 A G 33 ? ? C4 A G 33 ? ? C5 A G 33 ? ? 131.81 128.60 3.21 0.50 N 3 1 N3 A G 33 ? ? C4 A G 33 ? ? N9 A G 33 ? ? 121.64 126.00 -4.36 0.60 N # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x 0.4454 _pdbx_refine_tls.origin_y -17.7620 _pdbx_refine_tls.origin_z 1.9723 _pdbx_refine_tls.T[1][1] 1.3976 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] 0.1566 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.1056 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 1.4136 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] 0.0639 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.3558 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 1.2893 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] -0.8114 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] 0.7011 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 0.6090 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] -0.1291 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 1.2205 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] -0.3009 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] -0.4371 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] -0.0623 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] 0.0996 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] 0.3729 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] -0.1176 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] -0.0750 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] -0.3779 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] -0.0483 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id ? _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id ? _pdbx_refine_tls_group.beg_auth_seq_id ? _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id ? _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id ? _pdbx_refine_tls_group.end_auth_seq_id ? _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # _pdbx_entry_details.entry_id 8VT5 _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification ? # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GTP PG P N N 111 GTP O1G O N N 112 GTP O2G O N N 113 GTP O3G O N N 114 GTP O3B O N N 115 GTP PB P N N 116 GTP O1B O N N 117 GTP O2B O N N 118 GTP O3A O N N 119 GTP PA P N N 120 GTP O1A O N N 121 GTP O2A O N N 122 GTP "O5'" O N N 123 GTP "C5'" C N N 124 GTP "C4'" C N R 125 GTP "O4'" O N N 126 GTP "C3'" C N S 127 GTP "O3'" O N N 128 GTP "C2'" C N R 129 GTP "O2'" O N N 130 GTP "C1'" C N R 131 GTP N9 N Y N 132 GTP C8 C Y N 133 GTP N7 N Y N 134 GTP C5 C Y N 135 GTP C6 C N N 136 GTP O6 O N N 137 GTP N1 N N N 138 GTP C2 C N N 139 GTP N2 N N N 140 GTP N3 N N N 141 GTP C4 C Y N 142 GTP HOG2 H N N 143 GTP HOG3 H N N 144 GTP HOB2 H N N 145 GTP HOA2 H N N 146 GTP "H5'" H N N 147 GTP "H5''" H N N 148 GTP "H4'" H N N 149 GTP "H3'" H N N 150 GTP "HO3'" H N N 151 GTP "H2'" H N N 152 GTP "HO2'" H N N 153 GTP "H1'" H N N 154 GTP H8 H N N 155 GTP HN1 H N N 156 GTP HN21 H N N 157 GTP HN22 H N N 158 HOH O O N N 159 HOH H1 H N N 160 HOH H2 H N N 161 U OP3 O N N 162 U P P N N 163 U OP1 O N N 164 U OP2 O N N 165 U "O5'" O N N 166 U "C5'" C N N 167 U "C4'" C N R 168 U "O4'" O N N 169 U "C3'" C N S 170 U "O3'" O N N 171 U "C2'" C N R 172 U "O2'" O N N 173 U "C1'" C N R 174 U N1 N N N 175 U C2 C N N 176 U O2 O N N 177 U N3 N N N 178 U C4 C N N 179 U O4 O N N 180 U C5 C N N 181 U C6 C N N 182 U HOP3 H N N 183 U HOP2 H N N 184 U "H5'" H N N 185 U "H5''" H N N 186 U "H4'" H N N 187 U "H3'" H N N 188 U "HO3'" H N N 189 U "H2'" H N N 190 U "HO2'" H N N 191 U "H1'" H N N 192 U H3 H N N 193 U H5 H N N 194 U H6 H N N 195 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GTP PG O1G doub N N 116 GTP PG O2G sing N N 117 GTP PG O3G sing N N 118 GTP PG O3B sing N N 119 GTP O2G HOG2 sing N N 120 GTP O3G HOG3 sing N N 121 GTP O3B PB sing N N 122 GTP PB O1B doub N N 123 GTP PB O2B sing N N 124 GTP PB O3A sing N N 125 GTP O2B HOB2 sing N N 126 GTP O3A PA sing N N 127 GTP PA O1A doub N N 128 GTP PA O2A sing N N 129 GTP PA "O5'" sing N N 130 GTP O2A HOA2 sing N N 131 GTP "O5'" "C5'" sing N N 132 GTP "C5'" "C4'" sing N N 133 GTP "C5'" "H5'" sing N N 134 GTP "C5'" "H5''" sing N N 135 GTP "C4'" "O4'" sing N N 136 GTP "C4'" "C3'" sing N N 137 GTP "C4'" "H4'" sing N N 138 GTP "O4'" "C1'" sing N N 139 GTP "C3'" "O3'" sing N N 140 GTP "C3'" "C2'" sing N N 141 GTP "C3'" "H3'" sing N N 142 GTP "O3'" "HO3'" sing N N 143 GTP "C2'" "O2'" sing N N 144 GTP "C2'" "C1'" sing N N 145 GTP "C2'" "H2'" sing N N 146 GTP "O2'" "HO2'" sing N N 147 GTP "C1'" N9 sing N N 148 GTP "C1'" "H1'" sing N N 149 GTP N9 C8 sing Y N 150 GTP N9 C4 sing Y N 151 GTP C8 N7 doub Y N 152 GTP C8 H8 sing N N 153 GTP N7 C5 sing Y N 154 GTP C5 C6 sing N N 155 GTP C5 C4 doub Y N 156 GTP C6 O6 doub N N 157 GTP C6 N1 sing N N 158 GTP N1 C2 sing N N 159 GTP N1 HN1 sing N N 160 GTP C2 N2 sing N N 161 GTP C2 N3 doub N N 162 GTP N2 HN21 sing N N 163 GTP N2 HN22 sing N N 164 GTP N3 C4 sing N N 165 HOH O H1 sing N N 166 HOH O H2 sing N N 167 U OP3 P sing N N 168 U OP3 HOP3 sing N N 169 U P OP1 doub N N 170 U P OP2 sing N N 171 U P "O5'" sing N N 172 U OP2 HOP2 sing N N 173 U "O5'" "C5'" sing N N 174 U "C5'" "C4'" sing N N 175 U "C5'" "H5'" sing N N 176 U "C5'" "H5''" sing N N 177 U "C4'" "O4'" sing N N 178 U "C4'" "C3'" sing N N 179 U "C4'" "H4'" sing N N 180 U "O4'" "C1'" sing N N 181 U "C3'" "O3'" sing N N 182 U "C3'" "C2'" sing N N 183 U "C3'" "H3'" sing N N 184 U "O3'" "HO3'" sing N N 185 U "C2'" "O2'" sing N N 186 U "C2'" "C1'" sing N N 187 U "C2'" "H2'" sing N N 188 U "O2'" "HO2'" sing N N 189 U "C1'" N1 sing N N 190 U "C1'" "H1'" sing N N 191 U N1 C2 sing N N 192 U N1 C6 sing N N 193 U C2 O2 doub N N 194 U C2 N3 sing N N 195 U N3 C4 sing N N 196 U N3 H3 sing N N 197 U C4 O4 doub N N 198 U C4 C5 sing N N 199 U C5 C6 doub N N 200 U C5 H5 sing N N 201 U C6 H6 sing N N 202 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8VT5 'double helix' 8VT5 'a-form double helix' 8VT5 'parallel strands' 8VT5 'hairpin loop' 8VT5 'bulge loop' 8VT5 'mismatched base pair' 8VT5 'four-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A GTP 1 1_555 A C 60 1_555 -0.529 -0.239 0.334 3.869 -15.943 -9.714 1 A_GTP1:C60_A A 1 ? A 60 ? 19 1 1 A G 2 1_555 A U 59 1_555 -2.016 -0.494 -0.138 0.453 -17.895 -0.730 2 A_G2:U59_A A 2 ? A 59 ? 28 1 1 A G 3 1_555 A U 58 1_555 -3.019 -0.702 -0.128 -4.143 -12.693 -2.439 3 A_G3:U58_A A 3 ? A 58 ? 28 1 1 A C 4 1_555 A G 57 1_555 0.186 -0.096 0.113 2.411 -9.084 -0.689 4 A_C4:G57_A A 4 ? A 57 ? 19 1 1 A G 5 1_555 A U 56 1_555 -2.624 -0.767 0.415 4.958 -8.356 -3.717 5 A_G5:U56_A A 5 ? A 56 ? 28 1 1 A C 6 1_555 A G 55 1_555 0.070 -0.140 0.292 -4.757 -7.983 -0.560 6 A_C6:G55_A A 6 ? A 55 ? 19 1 1 A U 7 1_555 A A 54 1_555 -0.015 -0.175 0.663 -9.163 -6.413 1.006 7 A_U7:A54_A A 7 ? A 54 ? 20 1 1 A G 8 1_555 A C 53 1_555 -0.232 -0.117 0.595 2.035 -1.616 -1.052 8 A_G8:C53_A A 8 ? A 53 ? 19 1 1 A C 36 1_555 A G 52 1_555 0.303 -0.024 0.056 0.589 -8.750 3.783 9 A_C36:G52_A A 36 ? A 52 ? 19 1 1 A G 37 1_555 A C 51 1_555 -0.224 -0.124 0.336 -7.295 -4.189 0.676 10 A_G37:C51_A A 37 ? A 51 ? 19 1 1 A G 38 1_555 A C 50 1_555 -0.177 -0.104 0.361 0.064 -3.007 0.240 11 A_G38:C50_A A 38 ? A 50 ? 19 1 1 A G 39 1_555 A C 49 1_555 -0.160 -0.090 -0.011 -0.075 -8.854 0.418 12 A_G39:C49_A A 39 ? A 49 ? 19 1 1 A G 40 1_555 A C 48 1_555 -0.116 -0.097 -0.155 -10.039 -4.356 2.985 13 A_G40:C48_A A 40 ? A 48 ? 19 1 1 A U 41 1_555 A A 45 1_555 4.735 -1.968 0.215 -4.031 3.279 -104.988 14 A_U41:A45_A A 41 ? A 45 ? 24 4 1 A U 42 1_555 A G 14 1_555 0.806 -5.484 -0.062 22.878 -3.785 -103.052 15 A_U42:G14_A A 42 ? A 14 ? ? 6 1 A G 29 1_555 A C 25 1_555 -0.204 -0.084 0.147 -10.815 5.111 5.704 16 A_G29:C25_A A 29 ? A 25 ? 19 1 1 A C 30 1_555 A G 24 1_555 0.257 -0.152 0.162 -4.909 0.955 0.523 17 A_C30:G24_A A 30 ? A 24 ? 19 1 1 A U 31 1_555 A A 23 1_555 0.006 -0.107 -0.043 2.758 -4.146 0.023 18 A_U31:A23_A A 31 ? A 23 ? 20 1 1 A G 32 1_555 A C 22 1_555 -0.084 -0.128 -0.616 -4.763 -11.215 -2.815 19 A_G32:C22_A A 32 ? A 22 ? 19 1 1 A G 33 1_555 A C 21 1_555 -0.227 -0.134 0.119 7.245 -8.869 -1.846 20 A_G33:C21_A A 33 ? A 21 ? 19 1 1 A G 34 1_555 A U 20 1_555 -1.528 -0.407 0.075 3.090 -4.466 1.545 21 A_G34:U20_A A 34 ? A 20 ? 28 1 1 A C 35 1_555 A G 19 1_555 0.269 -0.099 -0.440 14.963 -7.895 -1.332 22 A_C35:G19_A A 35 ? A 19 ? 19 1 1 A G 9 1_555 A C 18 1_555 -0.222 -0.050 0.066 3.537 3.518 4.648 23 A_G9:C18_A A 9 ? A 18 ? 19 1 1 A U 10 1_555 A A 17 1_555 0.420 0.040 0.392 -2.028 -0.823 12.975 24 A_U10:A17_A A 10 ? A 17 ? 20 1 1 A G 11 1_555 A C 16 1_555 -0.249 -0.111 -0.463 -6.931 5.692 1.397 25 A_G11:C16_A A 11 ? A 16 ? 19 1 1 A G 12 1_555 A U 47 1_555 -0.400 5.606 -0.794 -32.928 -4.232 102.151 26 A_G12:U47_A A 12 ? A 47 ? ? 2 1 A G 15 1_555 A C 43 1_555 -0.250 -0.125 -0.188 -19.103 -16.781 -1.792 27 A_G15:C43_A A 15 ? A 43 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A GTP 1 1_555 A C 60 1_555 A G 2 1_555 A U 59 1_555 0.168 -2.034 3.127 -0.444 10.106 30.902 -5.161 -0.367 2.359 18.359 0.807 32.477 1 AA_GTP1G2:U59C60_AA A 1 ? A 60 ? A 2 ? A 59 ? 1 A G 2 1_555 A U 59 1_555 A G 3 1_555 A U 58 1_555 -0.284 -1.952 3.190 -5.724 12.890 25.847 -6.203 -0.486 2.026 26.456 11.748 29.387 2 AA_G2G3:U58U59_AA A 2 ? A 59 ? A 3 ? A 58 ? 1 A G 3 1_555 A U 58 1_555 A C 4 1_555 A G 57 1_555 -0.064 -0.937 3.064 -3.742 9.479 46.740 -1.846 -0.193 2.831 11.784 4.652 47.777 3 AA_G3C4:G57U58_AA A 3 ? A 58 ? A 4 ? A 57 ? 1 A C 4 1_555 A G 57 1_555 A G 5 1_555 A U 56 1_555 1.383 -2.774 3.098 -3.126 4.190 12.310 -15.240 -8.419 1.665 18.486 13.790 13.370 4 AA_C4G5:U56G57_AA A 4 ? A 57 ? A 5 ? A 56 ? 1 A G 5 1_555 A U 56 1_555 A C 6 1_555 A G 55 1_555 -0.313 -2.059 3.545 -2.175 1.714 43.228 -2.969 0.197 3.476 2.324 2.949 43.312 5 AA_G5C6:G55U56_AA A 5 ? A 56 ? A 6 ? A 55 ? 1 A C 6 1_555 A G 55 1_555 A U 7 1_555 A A 54 1_555 -0.562 -1.719 3.254 -5.178 10.417 28.320 -5.162 0.121 2.539 20.243 10.062 30.571 6 AA_C6U7:A54G55_AA A 6 ? A 55 ? A 7 ? A 54 ? 1 A U 7 1_555 A A 54 1_555 A G 8 1_555 A C 53 1_555 -0.362 -0.907 2.695 -1.116 11.641 34.234 -2.752 0.460 2.286 19.098 1.831 36.119 7 AA_U7G8:C53A54_AA A 7 ? A 54 ? A 8 ? A 53 ? 1 A G 8 1_555 A C 53 1_555 A C 36 1_555 A G 52 1_555 -0.962 -1.488 3.242 2.034 3.298 47.298 -2.107 1.355 3.096 4.102 -2.531 47.448 8 AA_G8C36:G52C53_AA A 8 ? A 53 ? A 36 ? A 52 ? 1 A C 36 1_555 A G 52 1_555 A G 37 1_555 A C 51 1_555 -0.977 -2.008 3.287 -1.332 4.728 29.523 -4.833 1.626 2.976 9.198 2.590 29.920 9 AA_C36G37:C51G52_AA A 36 ? A 52 ? A 37 ? A 51 ? 1 A G 37 1_555 A C 51 1_555 A G 38 1_555 A C 50 1_555 0.370 -1.403 3.046 0.322 4.354 30.340 -3.430 -0.642 2.825 8.265 -0.612 30.645 10 AA_G37G38:C50C51_AA A 37 ? A 51 ? A 38 ? A 50 ? 1 A G 38 1_555 A C 50 1_555 A G 39 1_555 A C 49 1_555 0.747 -1.988 3.201 5.031 3.730 29.737 -4.513 -0.456 3.017 7.169 -9.668 30.375 11 AA_G38G39:C49C50_AA A 38 ? A 50 ? A 39 ? A 49 ? 1 A G 39 1_555 A C 49 1_555 A G 40 1_555 A C 48 1_555 0.684 -2.128 3.312 5.083 5.676 37.982 -3.892 -0.421 3.038 8.615 -7.715 38.711 12 AA_G39G40:C48C49_AA A 39 ? A 49 ? A 40 ? A 48 ? 1 A G 40 1_555 A C 48 1_555 A U 41 1_555 A A 45 1_555 -2.073 -1.911 3.386 3.194 4.462 87.428 -1.479 1.567 3.244 3.225 -2.309 87.566 13 AA_G40U41:A45C48_AA A 40 ? A 48 ? A 41 ? A 45 ? 1 A U 41 1_555 A A 45 1_555 A U 42 1_555 A G 14 1_555 2.070 -1.678 2.951 5.745 -1.051 33.790 -2.688 -2.644 3.297 -1.792 -9.792 34.276 14 AA_U41U42:G14A45_AA A 41 ? A 45 ? A 42 ? A 14 ? 1 A G 29 1_555 A C 25 1_555 A C 30 1_555 A G 24 1_555 -1.099 -1.401 3.263 -0.478 7.069 34.942 -3.273 1.730 2.947 11.625 0.787 35.631 15 AA_G29C30:G24C25_AA A 29 ? A 25 ? A 30 ? A 24 ? 1 A C 30 1_555 A G 24 1_555 A U 31 1_555 A A 23 1_555 -0.187 -1.297 3.046 3.172 6.437 31.439 -3.358 0.840 2.703 11.690 -5.761 32.227 16 AA_C30U31:A23G24_AA A 30 ? A 24 ? A 31 ? A 23 ? 1 A U 31 1_555 A A 23 1_555 A G 32 1_555 A C 22 1_555 0.326 -1.261 3.470 4.990 15.334 31.323 -4.352 0.195 2.612 26.329 -8.567 35.138 17 AA_U31G32:C22A23_AA A 31 ? A 23 ? A 32 ? A 22 ? 1 A G 32 1_555 A C 22 1_555 A G 33 1_555 A C 21 1_555 0.077 -1.337 2.789 -3.820 7.155 24.609 -4.561 -1.013 2.278 16.234 8.667 25.892 18 AA_G32G33:C21C22_AA A 32 ? A 22 ? A 33 ? A 21 ? 1 A G 33 1_555 A C 21 1_555 A G 34 1_555 A U 20 1_555 -0.294 -1.850 3.000 -1.429 8.005 34.649 -4.029 0.302 2.534 13.216 2.359 35.562 19 AA_G33G34:U20C21_AA A 33 ? A 21 ? A 34 ? A 20 ? 1 A G 34 1_555 A U 20 1_555 A C 35 1_555 A G 19 1_555 0.022 -0.985 2.911 5.799 5.475 34.725 -2.302 0.697 2.699 9.026 -9.560 35.602 20 AA_G34C35:G19U20_AA A 34 ? A 20 ? A 35 ? A 19 ? 1 A C 35 1_555 A G 19 1_555 A G 9 1_555 A C 18 1_555 -0.589 -1.543 3.219 -5.747 14.037 42.224 -3.214 0.288 2.656 18.774 7.687 44.748 21 AA_C35G9:C18G19_AA A 35 ? A 19 ? A 9 ? A 18 ? 1 A G 9 1_555 A C 18 1_555 A U 10 1_555 A A 17 1_555 0.473 -2.615 3.222 -2.305 2.941 33.568 -4.952 -1.168 2.951 5.072 3.975 33.770 22 AA_G9U10:A17C18_AA A 9 ? A 18 ? A 10 ? A 17 ? 1 A U 10 1_555 A A 17 1_555 A G 11 1_555 A C 16 1_555 -1.213 -2.314 3.327 5.104 0.121 27.026 -4.899 3.783 3.040 0.256 -10.798 27.495 23 AA_U10G11:C16A17_AA A 10 ? A 17 ? A 11 ? A 16 ? 1 A G 11 1_555 A C 16 1_555 A G 12 1_555 A U 47 1_555 2.388 -1.909 2.737 13.503 10.631 -5.793 1.896 12.864 0.219 -44.236 56.187 -18.129 24 AA_G11G12:U47C16_AA A 11 ? A 16 ? A 12 ? A 47 ? # _pdbx_audit_support.funding_organization 'National Institutes of Health/National Institute of Diabetes and Digestive and Kidney Disease (NIH/NIDDK)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id GTP _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id GTP _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 8V1I _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 8VT5 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.020500 _atom_sites.fract_transf_matrix[1][2] 0.011836 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.023672 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.003470 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C N O P # loop_