data_8ZNQ # _entry.id 8ZNQ # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.406 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8ZNQ pdb_00008znq 10.2210/pdb8znq/pdb WWPDB D_1300048180 ? ? BMRB 36669 ? 10.13018/BMR36669 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date _pdbx_audit_revision_history.part_number 1 'Structure model' 1 0 2025-06-04 ? 2 'Structure model' 1 1 2025-11-05 ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_audit_revision_group.ordinal 1 _pdbx_audit_revision_group.revision_ordinal 2 _pdbx_audit_revision_group.data_content_type 'Structure model' _pdbx_audit_revision_group.group 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_CSD' 4 2 'Structure model' '_citation.journal_id_ISSN' 5 2 'Structure model' '_citation.journal_volume' 6 2 'Structure model' '_citation.page_first' 7 2 'Structure model' '_citation.page_last' 8 2 'Structure model' '_citation.pdbx_database_id_DOI' 9 2 'Structure model' '_citation.pdbx_database_id_PubMed' 10 2 'Structure model' '_citation.title' 11 2 'Structure model' '_citation.year' 12 2 'Structure model' '_citation_author.identifier_ORCID' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr . _pdbx_database_status.entry_id 8ZNQ _pdbx_database_status.recvd_initial_deposition_date 2024-05-27 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs . _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name BMRB _pdbx_database_related.details 'Solution structure of the complex of naphthyridine-azaquinolone and an RNA with ACG/AUA motif' _pdbx_database_related.db_id 36669 _pdbx_database_related.content_type unspecified # _pdbx_contact_author.id 2 _pdbx_contact_author.email gota.kawai@p.chibakoudai.jp _pdbx_contact_author.name_first Gota _pdbx_contact_author.name_last Kawai _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0003-1480-2840 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Fujiwara, A.' 1 ? 'Chen, Q.' 2 ? 'Nakatani, K.' 3 ? 'Murata, A.' 4 ? 'Kawai, G.' 5 0000-0003-1480-2840 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Chem Sci' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2041-6520 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 16 _citation.language ? _citation.page_first 16819 _citation.page_last 16828 _citation.title 'Identification and structural insights into RNA motifs targeted by a CAG repeat DNA-binding small molecule.' _citation.year 2025 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1039/d5sc05255f _citation.pdbx_database_id_PubMed 40852448 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Chen, Q.' 1 0000-0002-0465-3194 primary 'Fujiwara, A.' 2 ? primary 'Nakatani, K.' 3 0000-0002-1705-5265 primary 'Kawai, G.' 4 0000-0003-1480-2840 primary 'Murata, A.' 5 0000-0003-2073-7272 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (30-MER)' 9614.705 1 ? ? ? ? 2 non-polymer syn ;N~3~-{3-[(7-METHYL-1,8-NAPHTHYRIDIN-2-YL)AMINO]-3-OXOPROPYL}-N~1~-[(7-OXO-7,8-DIHYDRO-1,8-NAPHTHYRIDIN-2-YL)METHYL]-BET A-ALANINAMIDE ; 459.500 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ACCGUGACGGGCCUUUUGGCUAUACGCGGU _entity_poly.pdbx_seq_one_letter_code_can ACCGUGACGGGCCUUUUGGCUAUACGCGGU _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name ;N~3~-{3-[(7-METHYL-1,8-NAPHTHYRIDIN-2-YL)AMINO]-3-OXOPROPYL}-N~1~-[(7-OXO-7,8-DIHYDRO-1,8-NAPHTHYRIDIN-2-YL)METHYL]-BET A-ALANINAMIDE ; _pdbx_entity_nonpoly.comp_id NAZ # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 A n 1 2 C n 1 3 C n 1 4 G n 1 5 U n 1 6 G n 1 7 A n 1 8 C n 1 9 G n 1 10 G n 1 11 G n 1 12 C n 1 13 C n 1 14 U n 1 15 U n 1 16 U n 1 17 U n 1 18 G n 1 19 G n 1 20 C n 1 21 U n 1 22 A n 1 23 U n 1 24 A n 1 25 C n 1 26 G n 1 27 C n 1 28 G n 1 29 G n 1 30 U n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 30 _pdbx_entity_src_syn.organism_scientific 'Homo sapiens' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 9606 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 NAZ non-polymer . ;N~3~-{3-[(7-METHYL-1,8-NAPHTHYRIDIN-2-YL)AMINO]-3-OXOPROPYL}-N~1~-[(7-OXO-7,8-DIHYDRO-1,8-NAPHTHYRIDIN-2-YL)METHYL]-BET A-ALANINAMIDE ; NAPHTYRIDINE-AZAQUINOLONE 'C24 H25 N7 O3' 459.500 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 A 1 1 1 A A A . n A 1 2 C 2 2 2 C C A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 U 5 5 5 U U A . n A 1 6 G 6 6 6 G G A . n A 1 7 A 7 7 7 A A A . n A 1 8 C 8 8 8 C C A . n A 1 9 G 9 9 9 G G A . n A 1 10 G 10 10 10 G G A . n A 1 11 G 11 11 11 G G A . n A 1 12 C 12 12 12 C C A . n A 1 13 C 13 13 13 C C A . n A 1 14 U 14 14 14 U U A . n A 1 15 U 15 15 15 U U A . n A 1 16 U 16 16 16 U U A . n A 1 17 U 17 17 17 U U A . n A 1 18 G 18 18 18 G G A . n A 1 19 G 19 19 19 G G A . n A 1 20 C 20 20 20 C C A . n A 1 21 U 21 21 21 U U A . n A 1 22 A 22 22 22 A A A . n A 1 23 U 23 23 23 U U A . n A 1 24 A 24 24 24 A A A . n A 1 25 C 25 25 25 C C A . n A 1 26 G 26 26 26 G G A . n A 1 27 C 27 27 27 C C A . n A 1 28 G 28 28 28 G G A . n A 1 29 G 29 29 29 G G A . n A 1 30 U 30 30 30 U U A . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id NAZ _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id NAZ _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_nonpoly_scheme.asym_id B _pdbx_nonpoly_scheme.entity_id 2 _pdbx_nonpoly_scheme.mon_id NAZ _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 101 _pdbx_nonpoly_scheme.auth_seq_num 31 _pdbx_nonpoly_scheme.pdb_mon_id NAZ _pdbx_nonpoly_scheme.auth_mon_id NAZ _pdbx_nonpoly_scheme.pdb_strand_id A _pdbx_nonpoly_scheme.pdb_ins_code . # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8ZNQ _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 8ZNQ _struct.title 'Solution structure of the complex of naphthyridine-azaquinolone and an RNA with ACG/AUA motif' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8ZNQ _struct_keywords.text 'SMALL MOLECULE, DRUG, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8ZNQ _struct_ref.pdbx_db_accession 8ZNQ _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8ZNQ _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 30 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 8ZNQ _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 30 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 30 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'NMR Distance Restraints' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A A 1 N1 ? ? ? 1_555 A U 30 N3 ? ? A A 1 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A A 1 N6 ? ? ? 1_555 A U 30 O4 ? ? A A 1 A U 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A C 2 N3 ? ? ? 1_555 A G 29 N1 ? ? A C 2 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 2 N4 ? ? ? 1_555 A G 29 O6 ? ? A C 2 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 2 O2 ? ? ? 1_555 A G 29 N2 ? ? A C 2 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 28 N1 ? ? A C 3 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 28 O6 ? ? A C 3 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 28 N2 ? ? A C 3 A G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 27 N3 ? ? A G 4 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 27 O2 ? ? A G 4 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 27 N4 ? ? A G 4 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 5 N3 ? ? ? 1_555 A G 26 O6 ? ? A U 5 A G 26 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog13 hydrog ? ? A U 5 O2 ? ? ? 1_555 A G 26 N1 ? ? A U 5 A G 26 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog14 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 25 N3 ? ? A G 6 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 25 O2 ? ? A G 6 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 25 N4 ? ? A G 6 A C 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A A 7 N6 ? ? ? 1_555 A A 22 N7 ? ? A A 7 A A 22 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog18 hydrog ? ? A A 7 N1 ? ? ? 1_555 A A 24 N6 ? ? A A 7 A A 24 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog19 hydrog ? ? A G 10 N1 ? ? ? 1_555 A U 21 O2 ? ? A G 10 A U 21 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog20 hydrog ? ? A G 10 O6 ? ? ? 1_555 A U 21 N3 ? ? A G 10 A U 21 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog21 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 12 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 12 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 12 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 18 N1 ? ? A C 13 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 18 O6 ? ? A C 13 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 18 N2 ? ? A C 13 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_entry_details.entry_id 8ZNQ _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.has_protein_modification N # _pdbx_nmr_ensemble.entry_id 8ZNQ _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 8ZNQ _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 ;0.26 mM no RNA (30-MER), 0.26 mM no N~3~-{3-[(7-METHYL-1,8-NAPHTHYRIDIN-2-YL)AMINO]-3-OXOPROPYL}-N~1~-[(7-OXO-7,8-DIHYDRO-1,8-NAPHTHYRIDIN-2-YL)METHYL]-BET A-ALANINAMIDE, 95% H2O/5% D2O ; '95% H2O/5% D2O' sample solution 'Complex of an RNA and NAZ' 2 ;0.08 mM [U-10% 13C; U-10% 15N]U23 and [U-10% 13C; U-10% 15N]A24 RNA (30-MER), 0.08 mM no N~3~-{3-[(7-METHYL-1,8-NAPHTHYRIDIN-2-YL)AMINO]-3-OXOPROPYL}-N~1~-[(7-OXO-7,8-DIHYDRO-1,8-NAPHTHYRIDIN-2-YL)METHYL]-BET A-ALANINAMIDE, 95% H2O/5% D2O ; '95% H2O/5% D2O' sample-U23L-A24L solution 'Complex of an RNA with 13C/15N-label at U23 and A24 and NAZ' # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 'RNA (30-MER)' 0.26 ? mM no 1 ;N~3~-{3-[(7-METHYL-1,8-NAPHTHYRIDIN-2-YL)AMINO]-3-OXOPROPYL}-N~1~-[(7-OXO-7,8-DIHYDRO-1,8-NAPHTHYRIDIN-2-YL)METHYL]-BET A-ALANINAMIDE ; 0.26 ? mM no 2 'RNA (30-MER)' 0.08 ? mM '[U-10% 13C; U-10% 15N]U23 and [U-10% 13C; U-10% 15N]A24' 2 ;N~3~-{3-[(7-METHYL-1,8-NAPHTHYRIDIN-2-YL)AMINO]-3-OXOPROPYL}-N~1~-[(7-OXO-7,8-DIHYDRO-1,8-NAPHTHYRIDIN-2-YL)METHYL]-BET A-ALANINAMIDE ; 0.08 ? mM no # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 288 _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 6.5 _pdbx_nmr_exptl_sample_conditions.ionic_strength 50 _pdbx_nmr_exptl_sample_conditions.details '20 mM sodium phosphate buffer (pH 6.5) with 50 mM sodium chloride and 5% D2O' _pdbx_nmr_exptl_sample_conditions.ionic_strength_err ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_units mM _pdbx_nmr_exptl_sample_conditions.label condition1 _pdbx_nmr_exptl_sample_conditions.pH_err ? _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.pressure_err ? _pdbx_nmr_exptl_sample_conditions.temperature_err ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D NOESY' 1 isotropic 2 1 1 '2D HOHAHA' 1 isotropic 3 1 2 '2D 1H-13C HSQC' 1 isotropic # _pdbx_nmr_refine.entry_id 8ZNQ _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 2 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 'chemical shift assignment' Sparky 3.114 Goddard 2 'structure calculation' CNS 1.3 'Brunger, Adams, Clore, Gros, Nilges and Read' 3 refinement CNS 1.3 'Brunger, Adams, Clore, Gros, Nilges and Read' 4 'peak picking' Sparky 3.114 Goddard # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 NAZ C1 C N N 111 NAZ O2 O N N 112 NAZ C3 C N N 113 NAZ N4 N N N 114 NAZ C5 C N N 115 NAZ C6 C N N 116 NAZ C7 C N N 117 NAZ C8 C Y N 118 NAZ C9 C Y N 119 NAZ N10 N Y N 120 NAZ C11 C Y N 121 NAZ C12 C Y N 122 NAZ C13 C Y N 123 NAZ C14 C Y N 124 NAZ C15 C Y N 125 NAZ C16 C Y N 126 NAZ N17 N Y N 127 NAZ N18 N N N 128 NAZ C19 C N N 129 NAZ O20 O N N 130 NAZ C21 C N N 131 NAZ C22 C N N 132 NAZ N23 N N N 133 NAZ C24 C Y N 134 NAZ C25 C Y N 135 NAZ N26 N Y N 136 NAZ C27 C Y N 137 NAZ C28 C Y N 138 NAZ C29 C Y N 139 NAZ C30 C Y N 140 NAZ C31 C Y N 141 NAZ C32 C Y N 142 NAZ N33 N Y N 143 NAZ O34 O N N 144 NAZ H36 H N N 145 NAZ H37 H N N 146 NAZ H38 H N N 147 NAZ H39 H N N 148 NAZ H40 H N N 149 NAZ H41 H N N 150 NAZ H42 H N N 151 NAZ H43 H N N 152 NAZ H44 H N N 153 NAZ H45 H N N 154 NAZ H46 H N N 155 NAZ H47 H N N 156 NAZ H48 H N N 157 NAZ H49 H N N 158 NAZ H50 H N N 159 NAZ H51 H N N 160 NAZ H52 H N N 161 NAZ H53 H N N 162 NAZ H54 H N N 163 NAZ H55 H N N 164 NAZ H56 H N N 165 NAZ H35 H N N 166 NAZ H57 H N N 167 NAZ H58 H N N 168 NAZ H59 H N N 169 U OP3 O N N 170 U P P N N 171 U OP1 O N N 172 U OP2 O N N 173 U "O5'" O N N 174 U "C5'" C N N 175 U "C4'" C N R 176 U "O4'" O N N 177 U "C3'" C N S 178 U "O3'" O N N 179 U "C2'" C N R 180 U "O2'" O N N 181 U "C1'" C N R 182 U N1 N N N 183 U C2 C N N 184 U O2 O N N 185 U N3 N N N 186 U C4 C N N 187 U O4 O N N 188 U C5 C N N 189 U C6 C N N 190 U HOP3 H N N 191 U HOP2 H N N 192 U "H5'" H N N 193 U "H5''" H N N 194 U "H4'" H N N 195 U "H3'" H N N 196 U "HO3'" H N N 197 U "H2'" H N N 198 U "HO2'" H N N 199 U "H1'" H N N 200 U H3 H N N 201 U H5 H N N 202 U H6 H N N 203 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 NAZ C1 N23 sing N N 116 NAZ C1 C32 sing N N 117 NAZ C1 H36 sing N N 118 NAZ C1 H37 sing N N 119 NAZ O2 C22 doub N N 120 NAZ C3 N4 sing N N 121 NAZ C3 C21 sing N N 122 NAZ C3 H38 sing N N 123 NAZ C3 H39 sing N N 124 NAZ N4 C5 sing N N 125 NAZ N4 H40 sing N N 126 NAZ C5 C6 sing N N 127 NAZ C5 H41 sing N N 128 NAZ C5 H42 sing N N 129 NAZ C6 C7 sing N N 130 NAZ C6 H43 sing N N 131 NAZ C6 H44 sing N N 132 NAZ C7 N18 sing N N 133 NAZ C7 O20 doub N N 134 NAZ C8 C9 sing Y N 135 NAZ C8 N10 doub Y N 136 NAZ C8 N18 sing N N 137 NAZ C9 C11 doub Y N 138 NAZ C9 H45 sing N N 139 NAZ N10 C12 sing Y N 140 NAZ C11 C13 sing Y N 141 NAZ C11 H46 sing N N 142 NAZ C12 C13 sing Y N 143 NAZ C12 N17 doub Y N 144 NAZ C13 C15 doub Y N 145 NAZ C14 C15 sing Y N 146 NAZ C14 C16 doub Y N 147 NAZ C14 H47 sing N N 148 NAZ C15 H48 sing N N 149 NAZ C16 N17 sing Y N 150 NAZ C16 C19 sing N N 151 NAZ N18 H49 sing N N 152 NAZ C19 H50 sing N N 153 NAZ C19 H51 sing N N 154 NAZ C19 H52 sing N N 155 NAZ C21 C22 sing N N 156 NAZ C21 H53 sing N N 157 NAZ C21 H54 sing N N 158 NAZ C22 N23 sing N N 159 NAZ N23 H55 sing N N 160 NAZ C24 C25 sing Y N 161 NAZ C24 N26 sing Y N 162 NAZ C24 O34 doub N N 163 NAZ C25 C27 doub Y N 164 NAZ C25 H56 sing N N 165 NAZ N26 C28 sing Y N 166 NAZ N26 H35 sing N N 167 NAZ C27 C29 sing Y N 168 NAZ C27 H57 sing N N 169 NAZ C28 C29 sing Y N 170 NAZ C28 N33 doub Y N 171 NAZ C29 C31 doub Y N 172 NAZ C30 C31 sing Y N 173 NAZ C30 C32 doub Y N 174 NAZ C30 H58 sing N N 175 NAZ C31 H59 sing N N 176 NAZ C32 N33 sing Y N 177 U OP3 P sing N N 178 U OP3 HOP3 sing N N 179 U P OP1 doub N N 180 U P OP2 sing N N 181 U P "O5'" sing N N 182 U OP2 HOP2 sing N N 183 U "O5'" "C5'" sing N N 184 U "C5'" "C4'" sing N N 185 U "C5'" "H5'" sing N N 186 U "C5'" "H5''" sing N N 187 U "C4'" "O4'" sing N N 188 U "C4'" "C3'" sing N N 189 U "C4'" "H4'" sing N N 190 U "O4'" "C1'" sing N N 191 U "C3'" "O3'" sing N N 192 U "C3'" "C2'" sing N N 193 U "C3'" "H3'" sing N N 194 U "O3'" "HO3'" sing N N 195 U "C2'" "O2'" sing N N 196 U "C2'" "C1'" sing N N 197 U "C2'" "H2'" sing N N 198 U "O2'" "HO2'" sing N N 199 U "C1'" N1 sing N N 200 U "C1'" "H1'" sing N N 201 U N1 C2 sing N N 202 U N1 C6 sing N N 203 U C2 O2 doub N N 204 U C2 N3 sing N N 205 U N3 C4 sing N N 206 U N3 H3 sing N N 207 U C4 O4 doub N N 208 U C4 C5 sing N N 209 U C5 C6 doub N N 210 U C5 H5 sing N N 211 U C6 H6 sing N N 212 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8ZNQ 'double helix' 8ZNQ 'a-form double helix' 8ZNQ 'hairpin loop' 8ZNQ 'bulge loop' 8ZNQ 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A A 1 1_555 A U 30 1_555 -1.063 -0.392 -0.023 0.453 -1.577 0.293 1 A_A1:U30_A A 1 ? A 30 ? 20 1 1 A C 2 1_555 A G 29 1_555 -0.023 -0.109 -0.225 3.258 -2.503 -2.721 2 A_C2:G29_A A 2 ? A 29 ? 19 1 1 A C 3 1_555 A G 28 1_555 0.491 -0.072 -0.182 -0.093 -1.953 -1.961 3 A_C3:G28_A A 3 ? A 28 ? 19 1 1 A G 4 1_555 A C 27 1_555 -0.492 -0.166 0.197 -1.076 -5.251 -4.265 4 A_G4:C27_A A 4 ? A 27 ? 19 1 1 A U 5 1_555 A G 26 1_555 1.784 -0.096 -0.048 2.834 -4.855 6.353 5 A_U5:G26_A A 5 ? A 26 ? 28 1 1 A G 6 1_555 A C 25 1_555 0.036 -0.094 0.298 1.902 -0.573 -4.199 6 A_G6:C25_A A 6 ? A 25 ? 19 1 1 A A 7 1_555 A A 24 1_555 2.428 1.343 2.044 -1.181 -2.230 -36.778 7 A_A7:A24_A A 7 ? A 24 ? ? ? 1 A G 10 1_555 A U 21 1_555 -1.367 -0.263 -0.379 -2.874 0.142 -15.996 8 A_G10:U21_A A 10 ? A 21 ? 28 1 1 A G 11 1_555 A C 20 1_555 -0.569 -0.178 -0.160 -4.694 -9.846 -2.463 9 A_G11:C20_A A 11 ? A 20 ? 19 1 1 A C 12 1_555 A G 19 1_555 0.847 -0.466 0.048 1.157 -6.145 -1.276 10 A_C12:G19_A A 12 ? A 19 ? 19 1 1 A C 13 1_555 A G 18 1_555 -0.120 -0.088 0.017 3.485 0.451 -4.183 11 A_C13:G18_A A 13 ? A 18 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A A 1 1_555 A U 30 1_555 A C 2 1_555 A G 29 1_555 -0.169 -1.591 3.318 0.786 5.507 34.720 -3.438 0.395 3.034 9.155 -1.306 35.149 1 AA_A1C2:G29U30_AA A 1 ? A 30 ? A 2 ? A 29 ? 1 A C 2 1_555 A G 29 1_555 A C 3 1_555 A G 28 1_555 -0.026 -1.630 3.985 1.808 -10.452 30.996 -0.545 0.452 4.287 -18.877 -3.266 32.719 2 AA_C2C3:G28G29_AA A 2 ? A 29 ? A 3 ? A 28 ? 1 A C 3 1_555 A G 28 1_555 A G 4 1_555 A C 27 1_555 -0.061 -1.446 3.041 -2.238 3.328 27.750 -3.696 -0.352 2.848 6.894 4.636 28.033 3 AA_C3G4:C27G28_AA A 3 ? A 28 ? A 4 ? A 27 ? 1 A G 4 1_555 A C 27 1_555 A U 5 1_555 A G 26 1_555 0.559 -1.387 3.209 1.058 -2.985 42.264 -1.615 -0.666 3.307 -4.133 -1.464 42.378 4 AA_G4U5:G26C27_AA A 4 ? A 27 ? A 5 ? A 26 ? 1 A U 5 1_555 A G 26 1_555 A G 6 1_555 A C 25 1_555 -0.950 -1.593 3.780 -1.204 -10.873 25.479 -0.003 1.616 4.139 -23.329 2.584 27.692 5 AA_U5G6:C25G26_AA A 5 ? A 26 ? A 6 ? A 25 ? 1 A G 6 1_555 A C 25 1_555 A A 7 1_555 A A 24 1_555 -0.465 -0.831 4.704 11.428 8.630 38.659 -2.490 2.393 4.140 12.525 -16.586 41.131 6 AA_G6A7:A24C25_AA A 6 ? A 25 ? A 7 ? A 24 ? 1 A G 10 1_555 A U 21 1_555 A G 11 1_555 A C 20 1_555 0.359 -1.700 3.187 -5.509 9.428 32.793 -4.176 -1.372 2.525 16.150 9.438 34.516 7 AA_G10G11:C20U21_AA A 10 ? A 21 ? A 11 ? A 20 ? 1 A G 11 1_555 A C 20 1_555 A C 12 1_555 A G 19 1_555 -0.146 -1.083 2.991 -1.745 3.975 45.717 -1.698 0.051 2.896 5.102 2.240 45.912 8 AA_G11C12:G19C20_AA A 11 ? A 20 ? A 12 ? A 19 ? 1 A C 12 1_555 A G 19 1_555 A C 13 1_555 A G 18 1_555 -0.508 -1.680 3.034 2.091 11.863 25.859 -5.624 1.421 2.035 24.863 -4.382 28.483 9 AA_C12C13:G18G19_AA A 12 ? A 19 ? A 13 ? A 18 ? # _pdbx_audit_support.funding_organization 'Not funded' _pdbx_audit_support.country ? _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.model 'AVANCE NEO' _pdbx_nmr_spectrometer.type ? _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.field_strength 600 _pdbx_nmr_spectrometer.details ? # _atom_sites.entry_id 8ZNQ _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_ #